The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	35998	46638	5229229	integrase,capsid	Enterobacteria_phage(71.43%)	11	35926:35948	46637:46659
35926:35948	attL	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
WP_075394335.1|35998_37189_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.4	2.0e-106
WP_075394336.1|37222_39670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394337.1|39881_40448_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.9	8.7e-60
WP_000468229.1|40463_40703_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	61.7	1.7e-20
WP_075394338.1|40706_41450_-|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_075394339.1|41987_42254_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	3.7e-29
WP_061357468.1|42250_42808_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	67.6	1.1e-30
WP_001216597.1|42804_43032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394340.1|43028_43349_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_075394341.1|43363_45697_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.1	0.0e+00
WP_075394342.1|46173_46638_+	hypothetical protein	NA	A0A2H4J2P5	uncultured_Caudovirales_phage	61.3	8.2e-40
46637:46659	attR	AATTGGTACACGTTTAGGTACAC	NA	NA	NA	NA
>prophage 2
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	3263339	3348195	5229229	terminase,tail,capsid,integrase,head,holin,tRNA,portal	Klebsiella_phage(45.0%)	92	3255847:3255863	3343443:3343459
3255847:3255863	attL	GCGCTGGCGCAGCGCCA	NA	NA	NA	NA
WP_004150803.1|3263339_3264446_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|3264502_3264961_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_075394743.1|3264977_3265628_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|3265868_3267119_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_075394744.1|3267236_3268364_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.7	3.9e-120
WP_012542206.1|3268344_3268590_-	excisionase	NA	NA	NA	NA	NA
WP_181875752.1|3268642_3268933_-	3'-5' exoribonuclease	NA	A0A2I7RDR9	Vibrio_phage	59.2	1.3e-22
WP_014228879.1|3269147_3269492_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_039103071.1|3269534_3269729_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_012542200.1|3270571_3270961_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	60.2	6.7e-35
WP_012542199.1|3271062_3271278_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	57.5	2.0e-17
WP_075394746.1|3271280_3271835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073553640.1|3271879_3272899_+	helix-turn-helix domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	40.9	2.1e-32
WP_040223221.1|3272891_3273356_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	71.5	4.1e-63
WP_075394747.1|3273369_3273810_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075394748.1|3273920_3275075_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	30.4	3.2e-32
WP_075394749.1|3275042_3276032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075394750.1|3276031_3277423_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_043875512.1|3278259_3278652_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_075394751.1|3278851_3279883_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	49.6	3.6e-96
WP_032432828.1|3279899_3280502_+	hypothetical protein	NA	H9C175	Pectobacterium_phage	68.1	4.2e-76
WP_004147997.1|3280745_3280949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139042930.1|3281716_3281836_-	small membrane protein	NA	NA	NA	NA	NA
WP_016160648.1|3282753_3282969_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	88.7	2.7e-30
WP_075394752.1|3282968_3283466_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	84.8	2.8e-78
WP_016160650.1|3283462_3283813_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	38.1	7.9e-11
WP_049115059.1|3284762_3285200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394753.1|3285238_3285463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162924227.1|3285641_3285806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|3285789_3286152_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_023289183.1|3286103_3286427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023289184.1|3286423_3286855_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	62.0	1.1e-41
WP_012542168.1|3287102_3287537_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_012542167.1|3287536_3289258_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.4	1.1e-190
WP_032418045.1|3289251_3289431_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.6	4.0e-11
WP_012542166.1|3289430_3290690_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	90.2	2.8e-223
WP_023159878.1|3290726_3291647_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.6	5.6e-149
WP_023159877.1|3291724_3293011_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	85.7	9.1e-206
WP_032430713.1|3293069_3293357_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	79.6	2.5e-18
WP_020317538.1|3293337_3293655_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_014228910.1|3293651_3293990_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_023159875.1|3293970_3294360_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	85.3	2.1e-57
WP_017898997.1|3294356_3294758_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	94.0	1.7e-62
WP_014228913.1|3294789_3295251_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|3295308_3295674_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_075394754.1|3295906_3299242_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.2	0.0e+00
WP_023159871.1|3299241_3299580_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_023289191.1|3299576_3300332_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_023159869.1|3300333_3301044_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	90.7	1.7e-137
WP_048337012.1|3301076_3301424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023159867.1|3301475_3302069_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.6	2.2e-77
WP_075394755.1|3314781_3316206_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	48.7	2.9e-96
WP_032430712.1|3316628_3317687_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	31.1	6.1e-14
WP_023159863.1|3318042_3318735_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004892953.1|3319383_3319536_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_060568688.1|3319808_3320522_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004150798.1|3320518_3320911_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_008807712.1|3320903_3321227_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_020805510.1|3321345_3321522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140530.1|3321675_3321903_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_021462619.1|3322015_3323209_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_049108709.1|3323276_3323612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|3323831_3324017_+	general stress protein	NA	NA	NA	NA	NA
WP_075394756.1|3324107_3324602_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|3324628_3325135_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|3325151_3326039_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_075394757.1|3326094_3327501_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004183659.1|3327497_3328508_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|3328623_3328821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075394758.1|3329387_3330020_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_032409986.1|3330059_3330239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|3330636_3331323_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020804938.1|3331435_3331600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|3331633_3333142_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_058229099.1|3333262_3334153_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032414790.1|3334159_3335944_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_004140494.1|3336017_3337226_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_075394759.1|3337528_3338572_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|3339233_3340148_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|3340237_3340876_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|3341006_3341270_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|3341329_3341455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|3341572_3341647_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|3341646_3341748_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_032423723.1|3341805_3342819_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.8	2.4e-12
WP_004179368.1|3343119_3343359_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_075203370.1|3343348_3343687_-	DUF488 family protein	NA	NA	NA	NA	NA
3343443:3343459	attR	TGGCGCTGCGCCAGCGC	NA	NA	NA	NA
WP_004179371.1|3344346_3345039_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|3345070_3346246_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004140469.1|3346353_3347148_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|3347131_3347578_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|3347694_3348195_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	3489487	3550998	5229229	terminase,transposase,plate,tail,integrase,holin	Salmonella_phage(33.96%)	74	3489883:3489900	3527653:3527670
WP_023279949.1|3489487_3490249_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	6.3e-21
3489883:3489900	attL	GCTGCTGGCCGATGGCGG	NA	NA	NA	NA
WP_032102838.1|3490465_3491998_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.5e-21
WP_048269059.1|3492196_3492709_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_032692707.1|3492941_3494123_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.0	3.7e-201
WP_009309074.1|3494103_3494295_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	75.4	2.3e-20
WP_032419897.1|3494305_3494452_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	72.9	5.8e-16
WP_032692705.1|3494448_3494673_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	55.4	1.2e-17
WP_032419898.1|3494656_3495091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419899.1|3495083_3495791_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	86.2	4.5e-106
WP_032420387.1|3495796_3496315_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	79.1	3.6e-76
WP_032692703.1|3496358_3496790_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	96.4	1.4e-73
WP_064757943.1|3496786_3497005_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	88.4	6.4e-27
WP_176372916.1|3496976_3497141_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	77.8	6.5e-16
WP_032692767.1|3497182_3497470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071993356.1|3497510_3497720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032692699.1|3497899_3498313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049181672.1|3498475_3499171_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	79.5	4.0e-99
WP_071889436.1|3499295_3499529_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	63.9	9.9e-18
WP_032692765.1|3499530_3499728_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_032692697.1|3499724_3500642_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	41.3	3.8e-36
WP_032692695.1|3500745_3502617_+	toprim domain-containing protein	NA	K7PK08	Enterobacteria_phage	61.1	1.2e-225
WP_032692693.1|3502619_3502937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032692692.1|3502933_3503716_+	antitermination protein	NA	F1C595	Cronobacter_phage	78.8	1.7e-114
WP_032692764.1|3504034_3504604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_181875750.1|3505003_3505849_+	hypothetical protein	NA	A0A1B2IGT1	Erwinia_phage	72.8	4.7e-110
WP_032692691.1|3505851_3506001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048334541.1|3506038_3506158_-	small membrane protein	NA	NA	NA	NA	NA
WP_012542609.1|3506868_3507138_+|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_075395146.1|3507115_3507613_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	82.4	4.0e-77
WP_032692688.1|3507609_3507999_+	DUF2570 domain-containing protein	NA	A0A192Y6H8	Salmonella_phage	50.0	2.4e-24
WP_021441335.1|3508492_3508981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394779.1|3508931_3510332_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	68.6	3.9e-186
WP_032692682.1|3510569_3512021_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	6.5e-192
WP_075395147.1|3512076_3512625_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	1.4e-46
WP_075394780.1|3512676_3513879_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	53.6	5.9e-106
WP_049182550.1|3513882_3514377_+	bacteriophage protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	1.6e-49
WP_038435199.1|3514388_3515330_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.4	1.3e-137
WP_032692673.1|3515369_3515651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032692671.1|3515619_3516039_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	7.4e-40
WP_032692670.1|3516035_3516542_+	hypothetical protein	NA	A0A2H4J488	uncultured_Caudovirales_phage	37.2	1.8e-16
WP_032692668.1|3516541_3516946_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	71.5	1.1e-43
WP_075394781.1|3516938_3517490_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	44.4	9.8e-40
WP_025269950.1|3517491_3518643_+	DUF3383 family protein	NA	A0A0M4RD26	Salmonella_phage	81.5	2.1e-177
WP_032692661.1|3518653_3519094_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	83.6	7.5e-67
WP_000393949.1|3519097_3519547_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	55.3	1.1e-36
WP_032692658.1|3519588_3519741_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	82.0	2.4e-17
WP_049106312.1|3519730_3521653_+	bacteriophage protein	NA	A0A0M4REK7	Salmonella_phage	56.1	5.6e-191
WP_032419937.1|3521652_3522228_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	70.7	1.0e-63
WP_075212099.1|3522303_3522531_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	54.7	1.3e-19
WP_075394782.1|3522533_3523598_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	67.3	5.9e-134
WP_032419940.1|3523597_3523930_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.2	1.3e-23
WP_032419941.1|3524017_3525247_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	60.6	8.5e-92
WP_032419942.1|3525309_3525963_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	56.7	2.3e-72
WP_075394783.1|3525964_3526318_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	79.5	4.3e-49
WP_032419943.1|3526317_3527517_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.1	1.4e-155
WP_032419944.1|3527513_3528290_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	56.9	2.3e-79
3527653:3527670	attR	CCGCCATCGGCCAGCAGC	NA	NA	NA	NA
WP_130944435.1|3528289_3529207_+	hypothetical protein	NA	A0A1I9SEW2	Klebsiella_phage	61.0	1.1e-46
WP_075394784.1|3529206_3529608_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	57.7	6.7e-14
WP_032419946.1|3529637_3531110_-	glucosyltransferase domain-containing protein	NA	A0A192Y7W8	Salmonella_phage	29.4	6.4e-38
WP_075394785.1|3531117_3532035_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	76.8	4.0e-131
WP_077253336.1|3532031_3532391_-	GtrA family protein	NA	F1C5B1	Cronobacter_phage	59.3	2.6e-33
WP_019705237.1|3533378_3533627_-	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.0e-25
WP_004176434.1|3534472_3534964_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075394786.1|3535006_3536551_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_023286325.1|3536560_3537904_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004176431.1|3537900_3538590_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_075394787.1|3538586_3540287_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002902160.1|3540291_3540783_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_075394788.1|3541047_3543702_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.2e-97
WP_075395148.1|3543703_3546046_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.2	2.0e-17
WP_075394789.1|3546060_3548253_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_015958252.1|3548239_3549007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179560.1|3549186_3549708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074422598.1|3549900_3550998_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	7.4e-47
>prophage 4
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	3676202	3722350	5229229	terminase,integrase,lysis,head,coat	Cronobacter_phage(27.91%)	62	3719582:3719596	3730364:3730378
WP_004224598.1|3676202_3676718_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	53.5	4.6e-23
WP_002903398.1|3677010_3677169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016530209.1|3677780_3678041_-	pyocin activator PrtN family protein	NA	A0A1L5C290	Pseudoalteromonas_phage	43.7	1.5e-11
WP_075394820.1|3678432_3679068_-	hypothetical protein	NA	R9VWB9	Serratia_phage	50.9	1.2e-52
WP_075394821.1|3679060_3679405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075394822.1|3679401_3679626_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	59.5	3.6e-17
WP_075394823.1|3679622_3680186_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	38.3	4.8e-26
WP_124053771.1|3680194_3680416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075394824.1|3680488_3680782_-	host cell division inhibitory peptide Kil	NA	NA	NA	NA	NA
WP_075394825.1|3681406_3681610_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	4.5e-19
WP_075394826.1|3681652_3682573_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	47.9	1.3e-89
WP_047667478.1|3682651_3683350_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	83.7	3.1e-107
WP_032443511.1|3683461_3683689_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	76.1	1.1e-24
WP_004196543.1|3683728_3684049_+	hypothetical protein	NA	A0A0M4RU01	Salmonella_phage	68.9	5.0e-36
WP_023312759.1|3684244_3684499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394827.1|3684495_3685545_+	hypothetical protein	NA	K7PLZ7	Enterobacterial_phage	51.5	2.7e-30
WP_075394828.1|3685571_3685967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394829.1|3686180_3686966_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.9	1.8e-63
WP_064167230.1|3687093_3688170_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	6.2e-147
WP_075394832.1|3689603_3689999_+	hypothetical protein	NA	A0A1I9LJU8	Stx_converting_phage	78.6	1.0e-51
WP_044350682.1|3690045_3690315_+	hypothetical protein	NA	H6WRY4	Salmonella_phage	80.7	2.7e-35
WP_023312768.1|3690868_3691177_+	DUF968 domain-containing protein	NA	Q6V7S4	Burkholderia_virus	57.6	2.1e-23
WP_075394833.1|3691169_3691829_+	phage N-6-adenine-methyltransferase	NA	Q8HA94	Salmonella_phage	80.0	1.4e-101
WP_075394834.1|3691825_3692404_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	55.6	1.2e-48
WP_142745332.1|3692699_3692819_-	small membrane protein	NA	NA	NA	NA	NA
WP_048964767.1|3693522_3693843_+	hypothetical protein	NA	O64361	Escherichia_phage	51.1	3.1e-22
WP_075394835.1|3693826_3694351_+	lysozyme	NA	Q71TF3	Escherichia_phage	54.2	3.8e-49
WP_075394836.1|3694347_3694815_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	72.3	1.3e-56
WP_181875749.1|3694817_3694955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134910892.1|3695100_3695955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394838.1|3696333_3696660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075394839.1|3696685_3697258_+|terminase	terminase small subunit	terminase	I6PDJ6	Cronobacter_phage	78.0	1.4e-65
WP_075394840.1|3697254_3698814_+|terminase	terminase	terminase	G8C7P3	Escherichia_phage	87.5	1.2e-289
WP_075394841.1|3698825_3700247_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	70.0	6.4e-184
WP_075394842.1|3700209_3701238_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	70.1	3.7e-117
WP_075394844.1|3701541_3702927_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.7	1.5e-166
WP_046619515.1|3702930_3703362_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	6.2e-42
WP_075394845.1|3703373_3704471_+|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	73.0	2.7e-150
WP_075394846.1|3704480_3704774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394847.1|3704776_3705157_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	1.2e-28
WP_075394848.1|3705156_3705330_+	50S ribosomal protein L13	NA	I6R0P9	Salmonella_phage	57.9	4.9e-14
WP_075394849.1|3705329_3705692_+	hypothetical protein	NA	A0A0M3LSC9	Mannheimia_phage	48.3	1.6e-19
WP_032431569.1|3705694_3706063_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	1.0e-48
WP_075394850.1|3706059_3706443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394851.1|3706500_3707265_+	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	43.2	6.7e-39
WP_075394852.1|3707332_3708037_+	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.6	2.8e-63
WP_040239875.1|3708149_3708353_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_032456984.1|3708440_3708821_+	lipoprotein	NA	NA	NA	NA	NA
WP_075394853.1|3708925_3709267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394854.1|3709318_3709933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075394855.1|3709992_3713355_+	tape measure protein	NA	R9TMK1	Aeromonas_phage	63.6	5.3e-229
WP_075394856.1|3713395_3713575_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_072032582.1|3713554_3713818_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_075394857.1|3713931_3714408_+	hypothetical protein	NA	F1C5F0	Cronobacter_phage	55.6	2.4e-42
WP_023301685.1|3714407_3714878_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	1.6e-27
WP_023328737.1|3714874_3715270_+	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	55.6	1.2e-36
WP_075394858.1|3715256_3717734_+	MoaD/ThiS family protein	NA	R9TR21	Aeromonas_phage	46.8	1.4e-197
WP_115207285.1|3717820_3719779_+	SGNH/GDSL hydrolase family protein	NA	A0A286S1P0	Klebsiella_phage	56.4	2.0e-18
3719582:3719596	attL	AGCTACCCGCTGACC	NA	NA	NA	NA
WP_075394860.1|3719793_3720540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048336948.1|3720607_3720847_+	hypothetical protein	NA	K7P7N3	Enterobacteria_phage	51.9	3.6e-15
WP_064323903.1|3720846_3721164_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.0	5.3e-22
WP_075394861.1|3721249_3722350_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	56.6	9.8e-116
3730364:3730378	attR	AGCTACCCGCTGACC	NA	NA	NA	NA
>prophage 5
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	3797910	3808797	5229229		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|3797910_3798531_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|3798523_3799789_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|3799800_3800703_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|3800963_3801725_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_063864611.1|3801745_3802606_-	class A beta-lactamase SHV-108	NA	A0A077SL40	Escherichia_phage	99.0	1.1e-154
WP_004176262.1|3802903_3803164_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_075394878.1|3803250_3804339_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	1.8e-210
WP_075394879.1|3804369_3805635_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_077273986.1|3805689_3808797_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
>prophage 6
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	4745315	4758633	5229229	transposase	Escherichia_phage(22.22%)	12	NA	NA
WP_004149013.1|4745315_4746320_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.0e-31
WP_004144151.1|4746720_4746843_+	small membrane protein	NA	NA	NA	NA	NA
WP_077255456.1|4747534_4747639_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075395162.1|4747853_4748861_-	acyltransferase	NA	NA	NA	NA	NA
WP_039819510.1|4749253_4750420_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819508.1|4750599_4751154_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_004175259.1|4751168_4752059_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_023278825.1|4752090_4752960_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_039819536.1|4752973_4754038_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819506.1|4754192_4755563_-	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_004180506.1|4755584_4757000_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_000043543.1|4757226_4758633_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 7
NZ_CP015134	Klebsiella pneumoniae strain ATCC 35657 chromosome, complete genome	5229229	4802077	4808982	5229229	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_075395073.1|4802077_4803556_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	2.9e-30
WP_004175198.1|4803552_4804275_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|4804593_4805955_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|4806197_4807094_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_049026291.1|4807334_4808108_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004175147.1|4808118_4808982_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 1
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	0	7186	158741		uncultured_virus(50.0%)	4	NA	NA
WP_000758228.1|3162_3603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|3729_6177_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|6217_6415_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|6448_7186_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
>prophage 2
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	12279	44178	158741	holin,transposase	Stx2-converting_phage(25.0%)	35	NA	NA
WP_001188930.1|12279_12960_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_002436614.1|12956_14357_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	2.4e-18
WP_065520246.1|14572_15007_+	copper-binding protein	NA	NA	NA	NA	NA
WP_065520247.1|15139_16729_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.9	1.6e-188
WP_032414478.1|16758_17109_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_015632445.1|17105_17513_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_004118688.1|17886_17985_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_065520248.1|17971_18151_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_064177598.1|18463_18709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064177597.1|18713_19286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064177596.1|19316_19811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213596.1|19871_20075_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_049118762.1|20088_20319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106475472.1|20451_21680_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.5e-170
WP_044246670.1|21771_22026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|22201_22468_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_064177585.1|22455_22962_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077255522.1|23144_24491_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032422684.1|24539_24938_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_074194396.1|25117_26149_+|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_071717249.1|26240_26516_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023343081.1|28609_29887_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_023307506.1|29949_31947_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	24.9	4.1e-19
WP_001114073.1|33553_33907_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	4.1e-23
WP_004118102.1|33954_34317_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_019704517.1|34334_36086_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004118136.1|36133_37423_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	2.1e-170
WP_004118138.1|37435_37861_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.2e-50
WP_064177590.1|38211_38826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064177587.1|39081_40047_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004206594.1|40043_40862_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.6	1.4e-29
WP_064177588.1|40866_41529_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_020325003.1|41525_42197_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004206591.1|42220_43069_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020806218.1|43224_44178_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	25.0	3.3e-11
>prophage 3
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	52887	60640	158741		Bacillus_virus(25.0%)	6	NA	NA
WP_004152282.1|52887_53655_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|53753_54047_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_176702297.1|54377_54665_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_064177606.1|54998_56009_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_064177607.1|56361_57444_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	2.0e-185
WP_004152287.1|57565_60640_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
>prophage 4
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	66835	67971	158741	transposase	Shigella_phage(100.0%)	2	NA	NA
WP_000537151.1|66835_67120_+|transposase	IS3 family transposase	transposase	U5P4I9	Shigella_phage	47.1	4.7e-14
WP_077254108.1|67116_67971_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	54.2	5.2e-80
>prophage 5
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	77449	78175	158741		Xanthomonas_phage(100.0%)	1	NA	NA
WP_023284651.1|77449_78175_-	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.0	6.0e-05
>prophage 6
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	112158	115761	158741		Cronobacter_phage(25.0%)	7	NA	NA
WP_015065622.1|112158_112980_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.1	1.2e-44
WP_004182074.1|113813_114227_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|114227_114506_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|114495_114816_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152719.1|114896_115121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021313197.1|115131_115344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|115404_115761_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
>prophage 7
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	120051	124416	158741		Emiliania_huxleyi_virus(33.33%)	4	NA	NA
WP_047062076.1|120051_122109_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	1.8e-22
WP_047062077.1|122178_122427_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_014343512.1|122475_123018_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_047062065.1|123852_124416_-	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	2.2e-18
>prophage 8
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	127556	138290	158741	integrase	Macacine_betaherpesvirus(42.86%)	11	133925:133938	142657:142670
WP_023320090.1|127556_127811_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	1.2e-11
WP_047062067.1|128047_128473_-	antirestriction protein	NA	NA	NA	NA	NA
WP_047062068.1|128995_129226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047062069.1|129438_129864_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	3.7e-31
WP_004118485.1|129863_131135_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.0	1.9e-155
WP_004118488.1|131213_131465_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_016156495.1|131518_131824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047062010.1|132933_133905_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	3.1e-150
WP_000523813.1|133904_135071_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
133925:133938	attL	GTTTAATCAGACGA	NA	NA	NA	NA
WP_000200071.1|135822_136833_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	54.3	8.8e-87
WP_001515717.1|137549_138290_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
142657:142670	attR	GTTTAATCAGACGA	NA	NA	NA	NA
>prophage 9
NZ_CP015135	Klebsiella pneumoniae strain ATCC 35657 plasmid p35657-1, complete sequence	158741	151972	155297	158741		Bacillus_phage(66.67%)	4	NA	NA
WP_000694953.1|151972_152323_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_000790483.1|152466_152898_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|153148_154624_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|154616_155297_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
