The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	3091	56503	3187449	transposase,tRNA	Escherichia_phage(33.33%)	56	NA	NA
WP_017378478.1|3091_4471_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4585_6478_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6525_7152_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7171_8056_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8088_8979_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9093_9492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|9496_10312_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10363_10768_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10822_11293_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11304_11832_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|11848_13390_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13415_14276_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14306_15698_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|15722_16151_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_082303751.1|17666_19502_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	2.2e-120
WP_036773290.1|19615_20344_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_082303752.1|20871_21210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303753.1|21442_22417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22683_23340_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_155764770.1|24037_24652_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|24843_25101_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|25213_25966_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_082303754.1|26028_26739_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|26930_27563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29297_30701_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|30697_30922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|31001_31976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|31995_32313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32390_32603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|32849_33269_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33366_33813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303755.1|34157_34379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303756.1|34488_34860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303757.1|34822_35158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35190_35544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303758.1|35588_35831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36257_37676_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|37902_38844_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|38878_40858_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|40854_41460_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|41461_41803_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|41803_42640_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|42805_43123_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43200_44622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303759.1|44618_45314_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|46788_47634_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47643_47982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48550_49954_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|49986_50931_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|51135_51309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|51916_52966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53120_53339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764771.1|53658_54477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764772.1|54370_55063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55073_55631_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55627_56503_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	191938	265885	3187449	transposase,protease,tRNA	Acinetobacter_phage(20.0%)	57	NA	NA
WP_017377604.1|191938_193921_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194130_195474_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195740_198410_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198433_200350_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200519_201941_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202085_203060_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203069_203369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203486_203708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203871_205533_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205605_205896_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206122_206578_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206642_207107_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207198_208545_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208544_209450_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209511_210498_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210490_210733_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210852_212397_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212443_213730_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213772_215176_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_155764777.1|218115_218364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303775.1|218295_218757_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219251_219947_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|220048_221611_-	APC family permease	NA	NA	NA	NA	NA
WP_082303776.1|221938_223732_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223818_224091_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224096_224723_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377630.1|226463_227519_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227487_228165_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228154_229003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772063.1|229557_230370_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230668_231523_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231676_232726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|232771_233428_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233445_234726_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234999_236361_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236421_236973_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|242402_243674_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243730_244714_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244710_245496_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245805_246255_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246348_247752_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248189_249671_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249726_250836_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|252408_252621_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252661_253357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303777.1|253620_255831_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|256033_256600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256757_257318_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257437_258841_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082303778.1|258837_259098_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259450_260275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|260973_261498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261783_262758_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_082303779.1|262857_263202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303780.1|263191_263410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|263522_264176_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264427_265885_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	277541	384208	3187449	transposase,tRNA	Staphylococcus_phage(38.46%)	85	NA	NA
WP_017376853.1|277541_278273_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_155764778.1|278497_278806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303784.1|278821_279262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279587_280463_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281865_282021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|282214_283924_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284577_284886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|284903_287096_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375921.1|288265_288499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288733_289264_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289268_289982_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290608_291334_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|291342_293406_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293585_294065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294557_295925_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420597.1|298698_299685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299801_299981_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376536.1|300638_300998_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301167_302793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303517_304945_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305238_306420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|309032_310331_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310686_311580_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311576_311882_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311907_312687_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_155764779.1|312792_312948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313099_313345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313531_314323_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|315022_315745_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315741_316623_+	ROK family protein	NA	NA	NA	NA	NA
WP_082303786.1|316646_318137_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	6.1e-20
WP_027243039.1|318226_319114_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|319786_320278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320282_320510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320602_321577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321553_322792_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243188.1|323274_323820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375937.1|324171_324990_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_036772717.1|325065_327435_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_082303787.1|328720_330148_+	amino acid permease	NA	NA	NA	NA	NA
WP_155046624.1|330181_330712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764780.1|330758_331451_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764781.1|331344_331917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764782.1|332309_332456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333155_334559_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082303788.1|334649_335153_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335192_336167_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336163_336733_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_082303789.1|338542_339517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339506_341279_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341279_341468_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341505_342480_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342538_342733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342799_343027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343156_344032_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344259_344409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344400_344667_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344811_345711_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345797_346055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243074.1|347984_348524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303790.1|348700_349291_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349324_349813_-	VUT family protein	NA	NA	NA	NA	NA
WP_155764783.1|350029_350227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303791.1|350327_350840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|351411_352710_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352826_353117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764784.1|353155_355810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356525_356780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|357089_357818_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|358588_359773_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359791_360736_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_082303793.1|361041_361698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361942_362311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653746.1|369463_370987_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371191_371419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371563_371821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372388_373360_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|373284_373593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|373998_374973_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|375026_375998_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|376077_377052_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036774478.1|380254_381136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381146_381803_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_082303794.1|381869_382574_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382804_384208_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	424459	491183	3187449	transposase,tRNA	Staphylococcus_phage(13.33%)	58	NA	NA
WP_048875857.1|424459_425434_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378346.1|426658_427129_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017378347.1|427382_427667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242731.1|427709_430034_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_016210694.1|430030_430264_-	ferrous iron transporter A	NA	NA	NA	NA	NA
WP_017378349.1|430764_431193_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_017378350.1|431204_431594_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_017378351.1|431760_432387_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_016210689.1|432398_432827_+	stringent starvation B family protein	NA	NA	NA	NA	NA
WP_017378352.1|432861_433446_-	phosphoheptose isomerase	NA	NA	NA	NA	NA
WP_027242730.1|433537_433873_-	YraN family protein	NA	NA	NA	NA	NA
WP_017378354.1|433862_435653_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_017378355.1|435739_436288_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.9	5.9e-29
WP_017378356.1|436319_437294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063730.1|437568_437880_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_017378358.1|437899_438160_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_082303800.1|438265_439342_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_017378360.1|439562_441131_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	6.7e-09
WP_155764787.1|441222_441564_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764788.1|441567_442386_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.2	2.7e-25
WP_144420756.1|442439_443441_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443522_444092_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|444305_445277_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_036772406.1|446907_447939_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448270_449374_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449485_450670_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_155046621.1|453187_453409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420609.1|453894_455268_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455285_456272_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_082304412.1|456274_457429_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457425_458121_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378378.1|459776_460826_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460892_462287_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463219_465151_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465155_465686_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465720_465915_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465957_466317_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466448_467444_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467456_469838_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_082303801.1|469868_470132_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	37.3	2.1e-08
WP_080963621.1|470398_470605_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|472213_472987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|472988_473930_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|474065_475643_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_155764789.1|475836_476436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303802.1|476419_476845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477236_477443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478247_478892_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478959_480216_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480471_480651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480873_481101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303803.1|482376_483135_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_144420757.1|483352_483916_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|484019_484568_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_017377698.1|486664_486961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619438.1|488368_488920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|490070_490208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490454_491183_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 5
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	496295	563655	3187449	transposase,tRNA	Staphylococcus_phage(46.15%)	57	NA	NA
WP_048875900.1|496295_497228_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497724_500538_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500530_501040_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|501043_501487_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501582_502884_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|503146_503515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303804.1|503506_504229_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.8	2.1e-26
WP_017377273.1|506642_506882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507416_508391_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508801_509131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509516_509882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764790.1|510037_510820_+	DUF692 family protein	NA	NA	NA	NA	NA
WP_017377268.1|510854_511634_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|511709_512393_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|513377_513881_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|514082_514337_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_036771922.1|515875_517066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303805.1|517900_519283_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082303806.1|519614_519857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520415_521390_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521555_521822_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521818_522319_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522439_523315_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|524974_525505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|525504_526029_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_082303807.1|526191_527307_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527543_528704_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_082303808.1|529155_531159_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531227_532235_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532308_533493_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533502_534957_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534987_536025_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536347_536638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537992_538967_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_146619442.1|539100_539763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540291_540543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540747_541911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619443.1|541933_542146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377798.1|542771_543422_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543522_544182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546243_547005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547423_547684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547769_548432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|548548_549676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764791.1|550052_550214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552346_552718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303809.1|552997_553477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303810.1|553596_554241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764792.1|554434_554596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303811.1|554750_555635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555663_556290_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556320_557520_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557758_558856_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|559009_560548_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560868_561204_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|562016_562310_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562680_563655_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 6
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	572156	758916	3187449	transposase,protease,tRNA	Staphylococcus_phage(18.92%)	164	NA	NA
WP_082303813.1|572156_572639_-|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_017377787.1|573775_574003_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|574259_575234_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_082303814.1|575657_577064_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155764794.1|577074_577899_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|578017_578713_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|579217_579724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999966.1|580675_582025_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|582111_582369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582436_583147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|583291_583471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303816.1|584000_585260_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|585392_585866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585874_587257_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|587249_587864_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|591328_592303_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|593466_594975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|595146_596238_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|596270_596909_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596947_597220_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|597318_597561_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_082303817.1|597578_597884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376579.1|597967_598510_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598671_599298_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|599303_600143_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|600132_600783_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600786_601620_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601709_602837_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|603103_603256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|603363_603558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603750_604401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376587.1|605744_607109_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|607233_608430_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608486_609050_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609982_610651_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610797_612099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613589_613994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|614227_615310_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|615294_615915_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615979_616855_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616932_617508_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|618316_618610_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618726_618876_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|620204_621179_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|621277_621433_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|621351_621612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|621788_622316_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|622570_622795_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622939_623761_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623718_624012_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|625488_625776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|626268_627039_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|627108_628521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628887_630258_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|630254_630419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630478_630766_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|631797_632388_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632514_633900_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633997_634195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|634287_635121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635659_636013_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|636025_636262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|636261_636468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636629_637349_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637437_639222_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639528_639684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639610_639865_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_080963580.1|641015_641240_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|641345_642749_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|643313_643502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643631_643898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|644283_645924_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_082303818.1|646036_647386_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	36.8	2.5e-73
WP_027243130.1|647382_648252_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|649178_650492_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_017377193.1|650488_650668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303819.1|650589_651258_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_048875914.1|652189_653350_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|653318_653915_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|654883_655111_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|656078_656483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656486_657482_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|657467_658670_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046615.1|659913_660075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660354_660900_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660933_661599_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|661658_662615_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|662893_663571_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663613_664195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664340_665012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665618_666206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|667174_667402_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|667374_667770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303820.1|668199_669015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377725.1|670262_670784_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670817_671069_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_082303821.1|671079_672357_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_017377722.1|673050_673578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303822.1|676229_676484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303823.1|676543_676954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377718.1|677210_677675_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|679091_679319_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|679453_680917_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|680919_681972_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377714.1|681961_682417_+	arginine repressor	NA	NA	NA	NA	NA
WP_027242900.1|682441_682768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377712.1|683111_683423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927332.1|683552_684335_+	lipoprotein	NA	NA	NA	NA	NA
WP_017377709.1|685415_685619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303824.1|685959_686184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764795.1|686167_686602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|686676_686994_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|687011_687224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|688177_688405_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|689562_690324_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082303826.1|692513_693494_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	8.1e-29
WP_027242902.1|693613_695050_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|695129_696590_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696710_696998_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|697195_698239_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|698254_699154_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|699150_699669_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699738_700356_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700365_701853_+	ribonuclease G	NA	NA	NA	NA	NA
WP_082303827.1|701862_702537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303828.1|702533_705545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|707733_708708_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708750_709746_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709798_710773_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|711085_711970_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|712100_712922_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712923_713961_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713964_716622_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716699_717509_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717915_718683_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_082303829.1|718847_719726_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719729_720467_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|720470_721028_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|721035_721782_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_082303830.1|721832_722597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|722685_723561_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|723657_725235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420623.1|725434_725632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725679_727590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|728126_728666_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728662_729691_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_082303831.1|729680_730745_-	GHMP kinase	NA	NA	NA	NA	NA
WP_155764796.1|730732_732982_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_155764797.1|732947_734015_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_017376206.1|737443_738493_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|738510_738957_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738956_739730_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739748_740903_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|741116_741686_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|741709_745216_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_082303832.1|745293_746253_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|746227_747688_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|747723_749253_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|749286_750690_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|752602_754417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754501_755905_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155764798.1|756050_756542_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764799.1|756507_757455_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757941_758916_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 7
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	771396	831626	3187449	transposase	Acinetobacter_phage(18.18%)	54	NA	NA
WP_048876012.1|771396_772800_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|773018_773444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303838.1|773577_774321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303839.1|774490_774985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775295_775835_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|776124_776352_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|777597_778173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764802.1|778286_779282_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082303840.1|779227_779692_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764803.1|779806_779980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780353_780767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303841.1|781458_783246_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783412_784033_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784379_784520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|784539_786516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786888_788346_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788414_789995_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_082303842.1|790635_794532_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.1	2.2e-117
WP_016210741.1|794538_794862_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794935_795409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303843.1|795440_796118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303844.1|796137_796437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303845.1|796959_798330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798689_799637_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799957_800302_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_082303847.1|801109_801937_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_017377241.1|802114_802552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|803437_803857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803966_804548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|804902_806183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|806303_807167_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_082303848.1|807255_808050_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_082304414.1|808287_809274_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|809279_810806_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810901_812146_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_082303850.1|812199_813579_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.4	1.2e-33
WP_026063614.1|813696_814482_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814824_815469_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|815503_817309_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|817332_817908_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818957_819932_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|822468_823146_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|824645_824867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|825747_825909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|825845_826346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|826441_826870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|827129_827579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|827631_828066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082303852.1|828042_829008_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	9.1e-49
WP_017377288.1|829226_829487_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829581_830316_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830344_830497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303853.1|830701_831175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764804.1|831182_831626_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	845328	920651	3187449	transposase,protease,integrase	Bacillus_phage(21.43%)	53	870110:870169	920544:921304
WP_017377305.1|845328_846630_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|846697_849130_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|849233_849506_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_017377308.1|851519_852404_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|852412_852808_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|853231_855379_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|855350_856700_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377315.1|858814_860518_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860652_861795_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861851_862880_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_082303861.1|863006_864521_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864627_864828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864972_865308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|865452_865689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865959_866838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|867474_868419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|868692_870096_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|870100_870886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
870110:870169	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_075275282.1|871276_872119_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377467.1|872115_872412_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_082303862.1|873894_874506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|874574_875381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875684_876659_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876830_878723_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_155764806.1|879292_881611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|882025_883429_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883869_884349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|884416_885673_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885819_886344_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886748_886889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|888647_888959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303864.1|889736_889946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|890009_890237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|890444_891209_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|891435_891729_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|892254_893658_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|894127_895105_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|895201_896662_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_082303865.1|896688_897342_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|897466_898033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|898329_900063_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_082303867.1|901830_902583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375855.1|904592_905039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|907537_908980_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|909111_909180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|909378_910710_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910814_911789_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911838_912543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764807.1|912983_913631_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764808.1|913855_916366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303868.1|916612_917887_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|919234_919459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919487_920651_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
920544:921304	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACAACTTTAGTTTTAAATTCAGCGCTTGGCTTCTTTCTTTTTTGACTCATCTCATAGCTCCTAAAATGTTAAGCATCATTTTAACCTTTCAGGAATAAATCGTTAAATTATCCTGTCTGAAAACTCGGGAGCATTCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGGCCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTAGTGGAGTGTGCCGATTCAAGGCACGTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGATATTGCGTTGGCGGTTGCGGCCATTCCAGAAGGTTTACCGGCGGCGTTTACAATTATTTTAGCGATTGGTGTGTCGCGTATGGCACGTAAAGGTGCGATTATTCGTAAGTTACCCGCAGTGGAAACATTGGGTAGTACGACGGTCGTCTGTTCTGATAAAACGGGTACACTGACAAAAAATCAGATGACAGTAAAAGAAGTGGTGGTTGGTCAGGAGCGTTATACTATCAGCGGCGCCGGTTATGAGCCTGTTGGTACGGTGAAAAATTCGGCAGGGCA	NA	NA	NA	NA
>prophage 9
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	927381	989569	3187449	transposase,tRNA	Staphylococcus_phage(16.67%)	49	NA	NA
WP_144420638.1|927381_928464_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|928779_928986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303871.1|929083_929614_+	cytochrome B	NA	NA	NA	NA	NA
WP_017377681.1|929901_931080_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_036773927.1|937108_937744_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|938256_939504_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939726_941163_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|941338_942556_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|943017_943797_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944803_945778_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155764809.1|946907_947138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|947134_948217_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|948527_948734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950454_951816_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951926_952298_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952520_953171_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_069971648.1|955023_955998_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|956868_957096_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|959276_960830_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|961618_961855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961974_963018_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|963264_963666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963839_964739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|965133_966345_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|966355_966580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376857.1|966901_967132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764772.1|967158_967851_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764810.1|967744_968563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303875.1|968729_968972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|969320_969503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155051404.1|969543_969714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|970119_971169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|971237_972260_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_082303876.1|972420_973221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|974189_974417_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|974373_975243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976682_977399_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243175.1|979807_981553_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981632_982082_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_082303878.1|982134_982350_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982596_983613_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983661_984291_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984631_985843_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|985875_986226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764811.1|986191_986569_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764812.1|986462_986873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376035.1|987149_987569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|987714_988551_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|988594_989569_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
>prophage 10
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1008655	1057685	3187449	transposase,protease,tRNA	Staphylococcus_phage(15.38%)	52	NA	NA
WP_026063502.1|1008655_1009531_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009797_1009992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|1010136_1010610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010879_1011053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1011257_1012571_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012567_1013212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303895.1|1013675_1014920_-	MFS transporter	NA	NA	NA	NA	NA
WP_155764813.1|1015052_1015367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764814.1|1015413_1015743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015816_1017166_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_082304416.1|1017269_1019450_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019519_1020395_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|1020441_1020738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020861_1021269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1021248_1021827_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1022249_1022912_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022942_1023311_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1023321_1024638_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024884_1025496_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|1025571_1025751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025921_1026215_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026455_1026758_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026812_1029086_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1029145_1029391_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1029515_1030271_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1030379_1031354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_017376076.1|1032307_1033264_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_082303898.1|1033526_1036025_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|1036028_1036769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|1037218_1038013_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1038175_1038964_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1038960_1040172_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|1040164_1040521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1040615_1041044_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_017376085.1|1042303_1043032_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1043089_1043977_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1044061_1044436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1044535_1045813_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|1045824_1046556_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_082303899.1|1046542_1047553_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_155764815.1|1047590_1047785_+	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_027242841.1|1047894_1049298_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|1049450_1049621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|1051026_1051857_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|1052084_1052234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|1052428_1053250_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|1053246_1054140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|1054185_1054707_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_082303901.1|1054784_1055270_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|1055403_1056060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1056056_1056365_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|1056713_1057685_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1066795	1132353	3187449	transposase,protease,tRNA	Bacillus_virus(14.29%)	52	NA	NA
WP_017377892.1|1066795_1068217_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1068247_1068769_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068765_1069371_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377888.1|1070571_1071276_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1071310_1071742_+	protein TolR	NA	NA	NA	NA	NA
WP_082303907.1|1071744_1072152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303908.1|1072180_1072840_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072899_1074252_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1074287_1074929_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1075001_1075901_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075903_1076551_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_017377879.1|1077588_1077804_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077807_1078041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1078102_1079695_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_047927659.1|1081962_1082733_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082791_1083766_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083873_1084236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1084405_1086115_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1086355_1087759_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087810_1088068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303910.1|1088816_1090061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1090584_1090962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304418.1|1091106_1091418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764816.1|1092159_1092852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092919_1093060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1093260_1093458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1093595_1094195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771696.1|1094377_1095838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303911.1|1096398_1098003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303912.1|1098440_1099304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1101918_1103322_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082303914.1|1103441_1104071_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|1104309_1105029_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|1105142_1108682_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_036773465.1|1109566_1111606_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_082303915.1|1111621_1112677_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|1112687_1113218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|1116441_1116582_-	phosphatase	NA	NA	NA	NA	NA
WP_155764817.1|1116888_1117041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|1117472_1117856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|1117865_1118225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303917.1|1119159_1119321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|1119547_1120804_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420651.1|1121559_1122213_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|1122417_1122744_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1123515_1124919_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1125089_1126460_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1126506_1127406_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_082303918.1|1127386_1130191_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1130270_1130867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1131280_1132036_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|1132125_1132353_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 12
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1152070	1208468	3187449	transposase,tRNA	Klosneuvirus(22.22%)	49	NA	NA
WP_017375591.1|1152070_1152274_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1152492_1153170_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|1153449_1153707_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_017377788.1|1154153_1155272_+	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_082303922.1|1156722_1157379_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_082303923.1|1157433_1157790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927085.1|1157773_1158520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303924.1|1158509_1158845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764818.1|1158923_1159079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|1159241_1159907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303929.1|1160478_1160721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303930.1|1160859_1161369_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_082303932.1|1161407_1161896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303933.1|1161892_1162843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303935.1|1162936_1164649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303936.1|1164605_1165133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377414.1|1165333_1166926_+	flagellin	NA	NA	NA	NA	NA
WP_144420782.1|1167216_1168728_+	B-type flagellin	NA	NA	NA	NA	NA
WP_036772815.1|1168833_1169265_+	flaG family protein	NA	NA	NA	NA	NA
WP_082303938.1|1169375_1170761_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_017377418.1|1170786_1171224_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_027242887.1|1171228_1171564_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_036772810.1|1171578_1171821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|1171888_1172254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|1172391_1172610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|1172638_1172866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|1173075_1174335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377420.1|1174810_1175149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377421.1|1175262_1176264_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_082303939.1|1177464_1179147_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.0	2.2e-21
WP_026063633.1|1179298_1179574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963565.1|1179718_1180216_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377424.1|1180609_1181593_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_017377425.1|1181585_1181807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377426.1|1181845_1182487_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377427.1|1182643_1183222_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377428.1|1183337_1184198_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_155764819.1|1184408_1185044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303942.1|1185072_1185561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|1187596_1187812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377432.1|1187708_1188038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377433.1|1188060_1189596_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_048875970.1|1192170_1192644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303945.1|1194216_1194921_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1195171_1196146_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036773116.1|1200286_1201261_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1201458_1202940_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1203399_1204062_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376399.1|1205696_1208468_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 13
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1212813	1363386	3187449	transposase,tRNA,integrase	uncultured_Mediterranean_phage(27.78%)	114	1289599:1289658	1294979:1296058
WP_017376405.1|1212813_1213854_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1214038_1215154_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1215192_1215546_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1215566_1217435_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1217456_1218401_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1218634_1218913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1219275_1219914_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376412.1|1221512_1222190_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1222310_1223585_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_144420654.1|1225804_1226584_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1226636_1226924_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1226983_1227334_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1227527_1227680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1227607_1228081_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1228093_1228729_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1229240_1230116_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|1231722_1233081_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1233304_1233493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1233506_1234640_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1234840_1238713_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|1238747_1239473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1239862_1240591_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240993_1241722_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241785_1242613_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|1242794_1243163_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_082303949.1|1243159_1243978_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|1244078_1244894_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|1245177_1247238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|1247846_1249340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|1249472_1250288_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|1250383_1250800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|1251182_1251722_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|1252638_1252800_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|1253511_1254573_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|1256063_1256417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|1256625_1258338_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|1258784_1260638_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|1260740_1261073_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|1261103_1261700_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|1261696_1262821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|1262932_1263580_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_082303951.1|1263631_1265545_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	3.1e-117
WP_082303952.1|1266846_1269066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303954.1|1269211_1270174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303955.1|1270880_1271849_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|1271978_1272467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1272908_1273142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1273451_1273640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|1274128_1274614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|1274884_1275154_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_144420783.1|1276567_1277215_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|1277408_1279367_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_082303957.1|1279510_1282441_+	peptidase M16	NA	NA	NA	NA	NA
WP_082303958.1|1283262_1284651_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1286091_1286877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303960.1|1286967_1288617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1288761_1289607_-	hypothetical protein	NA	NA	NA	NA	NA
1289599:1289658	attL	TAATGGCACTACCTTAAGAGCTAGATCTGAACAAAAACGCACTTTAGCGCAATAATCACT	NA	NA	NA	NA
WP_082303961.1|1289720_1291079_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155764820.1|1291598_1292417_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_082303962.1|1292674_1293043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1293409_1294069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303965.1|1294337_1294652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082303967.1|1294677_1294965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1295100_1296090_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
1294979:1296058	attR	TAATGGCACTACCTTAAGAGCTAGATCTGAACAAAAACGCACTTTAGCGCAATAATCACTTGAAGTCAGCAACCGTATAAGGTTGTATATTTTCGTCTAACAACTCAGACGGAAACTGACAGATGCATTATGTAATTAATAAACTAAAATCACAAATTGAAAAACAAAAAGCAACCCTTTTAGATGATGAAGGAAGTCTAAGCATTGAAAGCCTTCTGTCCTCCGATAAGTTTCAAAGCATCATCAACAATTGCCGAAGCTTTAGATCGCGTTTTTATACGCCATTTGTAACACTCATACTATTTATACGGCAAGTACTCTCTCCAGATAAATCATGCAAAAATACGGTTGCTACTTTCCTTGCATCAGTGTCGACAGAGGATAATAATAACATCCCATCAAGCAATACAGGACCTTACTGTAAAGCACGTCAAAAGTTACCAATAGAAACGCTTGAATCACTCGTTAAACTCAGTGGAGATAGTTTATCTAAAAGCAGTAATGCACGTTGGAAGATTTATAATCGAGAGGTGAAGCTTATTGATGGGACAAGCCTTACGATGGCAGATAGCGAGGAAAATCAATCACGTTATCCTCAACATGATGCTCAAAAGGCAGGCGCAGGCTTCCCTATTATGCGACTTGTTGCCATTATGTCACTTACAACGGGAGGCATTATTGATTATGCAGTTGGCGCTTATAAAGGTAAAGGAACGGGTGAACACGCGCTGTTAAGACAAATTAAGGACAGCATTCATAAGGATGATATTGTGATGGGTGATCGGTATTTCCCTTGTTTTTTCGTGATGGGTGATTTGCAGTCAATAGGTGCTGATGGTATTTTTAAAGCACATTCACAGAGGAAGTATGACTTTCGTAAAGGAAGGAAGTTGGGTTCAAAAAATCACCTTGTCATTTGGAAAAAGCCTCACAAACCTGACTGGATGACACAAGAAACATACGATAGTTATCCTGATCAAATGACGGTAAGAGAGTTCAAAATCAAAGGGGAGGTTTATGTAACAACTTTTCAAGATCATAAAAAATACAATAAAGTTGCATTGGCTAATCATTACAAAC	NA	NA	NA	NA
WP_144420658.1|1296066_1296828_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|1296860_1297640_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764821.1|1297872_1298553_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1298549_1298714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1298912_1299887_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|1299945_1300167_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378286.1|1301028_1301940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303969.1|1304540_1304903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875981.1|1305084_1305549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963642.1|1306605_1307196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378279.1|1307192_1307474_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017378278.1|1307476_1308271_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017378277.1|1308311_1308833_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082303971.1|1309532_1310387_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_017378274.1|1310416_1310695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378273.1|1310770_1311484_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.0	7.4e-40
WP_017378269.1|1314885_1315791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771488.1|1315831_1316857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148565130.1|1317410_1317827_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209964.1|1317819_1318572_+	dotC-like type IV secretion system protein	NA	NA	NA	NA	NA
WP_080963643.1|1318571_1319699_+	ATPase	NA	NA	NA	NA	NA
WP_082303972.1|1319700_1319940_+	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_017378262.1|1322331_1322835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378260.1|1323886_1324453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209975.1|1324503_1324935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378258.1|1327935_1328733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303974.1|1328762_1331882_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_082303975.1|1331912_1332662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|1332969_1333512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303977.1|1333512_1333848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378253.1|1333854_1334265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420661.1|1335188_1335776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764822.1|1336064_1336244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303978.1|1336822_1338604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303980.1|1338622_1339441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764823.1|1339406_1339622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303981.1|1340277_1343904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242796.1|1344576_1345848_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_017378245.1|1345870_1346599_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_017378243.1|1346861_1348004_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_017378242.1|1348020_1349622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378241.1|1350092_1350269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303983.1|1350265_1351543_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_017378239.1|1351892_1352162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771505.1|1352368_1352869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303984.1|1353029_1353281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303986.1|1353444_1354023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303987.1|1355813_1357115_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_082303989.1|1357291_1358140_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_017378228.1|1362465_1363386_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1372456	1434632	3187449	transposase,protease,tRNA	Vibrio_phage(13.33%)	50	NA	NA
WP_017378219.1|1372456_1372927_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|1373036_1374287_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|1374975_1375440_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|1375878_1377351_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|1377467_1377920_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|1378044_1378200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1378344_1378548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1378738_1379137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1379322_1379928_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1379936_1380233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1380237_1380774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|1380918_1381488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1381567_1382542_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|1382538_1383036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1383443_1383860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764824.1|1383927_1384746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764772.1|1384639_1385332_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275305.1|1385328_1385949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1386221_1387196_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|1387360_1387984_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376443.1|1390078_1390732_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1390900_1392076_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1392429_1393755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303990.1|1393853_1394636_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376448.1|1395795_1397058_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_155764825.1|1397684_1399139_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.4e-87
WP_017376451.1|1399203_1399869_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1399962_1401723_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_082303991.1|1402000_1402714_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155764826.1|1402692_1402875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082303993.1|1403211_1403673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376456.1|1403706_1406277_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376457.1|1406384_1406870_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376458.1|1407044_1408085_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376459.1|1408062_1408545_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_082303994.1|1408541_1411136_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|1411442_1411706_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|1412078_1412954_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155764827.1|1413068_1413218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376469.1|1419063_1420086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|1420442_1421810_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|1422085_1422340_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|1422388_1423642_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|1423661_1424876_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|1424875_1425769_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_082303996.1|1425985_1427272_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	7.8e-64
WP_027242812.1|1427361_1428639_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376476.1|1431050_1431809_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|1431985_1432375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1433903_1434632_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 15
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1452492	1510847	3187449	transposase,tRNA	Acinetobacter_phage(15.38%)	56	NA	NA
WP_048875989.1|1452492_1453896_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|1454045_1454408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304003.1|1457456_1458707_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|1459006_1459342_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|1459653_1459902_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|1459937_1460447_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|1460446_1461226_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|1461243_1461591_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_080963600.1|1462138_1462495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|1462893_1463229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|1463433_1464210_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|1464166_1465039_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|1465323_1465611_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|1465694_1466414_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|1466544_1467153_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|1467958_1468933_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|1469012_1469390_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155764828.1|1469488_1470523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|1472255_1472753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|1472897_1473296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|1473381_1474287_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|1474504_1474825_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_082304006.1|1474906_1475590_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_082304007.1|1476257_1476638_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|1477126_1477981_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_155764829.1|1478357_1479323_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.4e-25
WP_017377585.1|1479513_1479771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|1479884_1481141_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1481396_1481576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|1482069_1482312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|1482337_1483696_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|1483977_1484337_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|1484768_1486403_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|1486409_1487246_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|1487267_1488545_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|1488631_1488949_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_082304009.1|1488971_1490063_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|1490254_1491844_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|1491904_1492678_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|1492848_1493898_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|1494627_1494819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|1495648_1496425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|1496625_1496937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|1497029_1497995_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|1499208_1499463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|1499869_1500112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|1500124_1501000_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|1501326_1501767_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|1503358_1503763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999986.1|1503924_1504122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|1504325_1505300_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017377185.1|1505648_1506587_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|1506650_1508645_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|1508647_1509244_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|1509240_1509579_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|1509971_1510847_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1569199	1584772	3187449	transposase	unidentified_phage(33.33%)	12	NA	NA
WP_048876002.1|1569199_1570183_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1570982_1572136_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_082304022.1|1572313_1572832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376485.1|1574968_1576198_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1576392_1576839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304024.1|1577030_1578389_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1579054_1579228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304025.1|1579357_1580275_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1580616_1581276_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1581356_1581860_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1581832_1582120_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1583797_1584772_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 17
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1610753	1653081	3187449	transposase,protease,integrase	Staphylococcus_phage(40.0%)	39	1600836:1600895	1659455:1659995
1600836:1600895	attL	ACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTT	NA	NA	NA	NA
WP_082304035.1|1610753_1611782_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155764892.1|1611930_1612143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1612916_1614218_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1614386_1615487_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1615843_1616086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1616079_1616397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1617619_1617847_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155764833.1|1618457_1618760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1619154_1619454_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1619450_1619696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|1619988_1620945_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|1621229_1621433_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082304040.1|1621563_1622595_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_082304041.1|1623565_1624423_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.9	3.1e-24
WP_082304043.1|1625892_1626165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|1627764_1628616_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1628818_1631275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1631794_1632196_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1632782_1633757_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_016211143.1|1635392_1635962_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1635977_1636289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211147.1|1637380_1637734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1637737_1638802_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1638802_1640542_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1640548_1640971_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1640954_1641584_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1641819_1641918_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082304044.1|1641950_1642829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304046.1|1642830_1643514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304047.1|1643544_1643826_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_048876007.1|1643973_1644948_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|1645027_1645171_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_082304049.1|1645344_1646439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|1647187_1647466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1647733_1648690_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_082304051.1|1649414_1649657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304052.1|1649637_1650252_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_144420681.1|1651877_1652063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1652106_1653081_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
1659455:1659995	attR	AACGCTTGTCAGTAATCATGAAGCACCACAAAGCCCTAGCGACCATGCAGCTCATTAAGTTCTAACAGGAGCAGTCCGTCTATAATCAGGTTTTAAGCCTATTTTTAGCTGCTTTATCGATTATTGGCACCTGCACTTCGAATACTGGGAGTAATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAATATTGTATTACCTAAGCGCAGATTTAGTTATTTAACTATTAAAATGAAAATCGGGATAACGCACTGTAGCCCGCTTTCTTTATTTAGACCGACACAGTTGAGGCCTTCGACGTTTTCGGCCTGGCTGCTGCTGACTATTACGATGATCTTCCCTGCGTTTTCCTTGCATGCTGCCTCCCAAGCGCTGCCCTCCCTGATGTTCGATTTCTGGTTTTTTAGGCGCTTTTGATCTGCGATCTAAACTAGAAACAGGTACATCATGCACTGGCTCAAATCCATCAACGAGTTTACGGGCTAATAACTGTCCGATTAAATGTTCAATATCAGATAATTGTTTGAT	NA	NA	NA	NA
>prophage 18
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1675468	1735438	3187449	transposase,tRNA	Staphylococcus_phage(25.0%)	43	NA	NA
WP_082304058.1|1675468_1677238_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1677462_1678596_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_082304060.1|1682643_1683369_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1685964_1686525_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_155764834.1|1686453_1686657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929542.1|1686730_1687063_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1687122_1687410_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1688062_1689088_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1689215_1690190_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_082304061.1|1690424_1691339_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1691508_1691757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1691939_1692464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1692918_1693746_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1693814_1694000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1694200_1694659_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1694799_1695027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304063.1|1695191_1696577_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	35.8	1.0e-05
WP_082304064.1|1699347_1700337_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1700658_1700844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963614.1|1703265_1703388_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1703430_1704405_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|1704627_1705089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|1708633_1709980_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075275422.1|1712620_1713052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772316.1|1713203_1713947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377201.1|1715594_1716065_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_017377202.1|1716626_1717229_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_027243048.1|1717998_1719486_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_065653751.1|1721042_1721507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1721534_1722113_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_082304067.1|1722385_1723450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304069.1|1723412_1723916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|1725440_1725818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1727008_1727296_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1727355_1727652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1727796_1728453_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1728692_1729073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1729724_1731128_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1731124_1731406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1731810_1732275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1732455_1733049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1733235_1734210_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1734613_1735438_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1754373	1808129	3187449	transposase,tRNA	Tupanvirus(25.0%)	46	NA	NA
WP_048875984.1|1754373_1754910_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1754920_1755106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1755541_1756513_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1756494_1757466_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376768.1|1758624_1758954_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764838.1|1759209_1759806_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1759782_1760010_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_082304075.1|1760993_1761659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764839.1|1761658_1761847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|1762063_1762441_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1764364_1765750_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1765756_1767295_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1767337_1768063_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1768233_1769466_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1769668_1770490_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_082304076.1|1771505_1771832_-	DUF3418 domain-containing protein	NA	NA	NA	NA	NA
WP_082304078.1|1771840_1775407_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.5e-51
WP_082304079.1|1775536_1776412_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1776476_1776755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1776899_1777475_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1777523_1777682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1778430_1779147_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1780277_1780694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1781608_1782538_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1782509_1782668_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1782816_1783131_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1784040_1785024_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1785174_1785522_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1785521_1786121_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1786495_1786834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|1786652_1787042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|1787045_1787990_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1787977_1788121_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|1788482_1788815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|1791707_1792709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|1792781_1793246_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|1793618_1794038_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420694.1|1794898_1795135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376672.1|1795428_1798485_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_082304081.1|1798774_1800022_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|1800456_1801473_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|1801581_1801980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|1802019_1803843_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_082304082.1|1803839_1804985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304084.1|1805205_1807149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772026.1|1807253_1808129_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1839365	1880589	3187449	transposase	Burkholderia_virus(16.67%)	33	NA	NA
WP_017377787.1|1839365_1839593_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1841461_1842436_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1842494_1842758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1842767_1844081_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1844285_1844459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1844526_1844670_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1844688_1844886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1844903_1845410_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1846332_1847208_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378158.1|1847691_1850772_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017378160.1|1852366_1853017_+	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1853350_1853995_+	porin family protein	NA	NA	NA	NA	NA
WP_017378162.1|1854333_1854873_+	porin family protein	NA	NA	NA	NA	NA
WP_155764843.1|1855387_1855600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|1855698_1855992_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377970.1|1856766_1856958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420699.1|1857582_1857912_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_026063694.1|1858001_1858586_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_017377966.1|1858721_1859408_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|1859531_1860716_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|1860931_1862374_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242961.1|1862513_1863464_+	DMT family transporter	NA	NA	NA	NA	NA
WP_048876021.1|1863562_1864336_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_082304105.1|1864339_1865089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764844.1|1865161_1865398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304107.1|1865354_1866497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|1866950_1867523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242965.1|1869453_1871886_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017377953.1|1872454_1873651_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_144420700.1|1876690_1876840_+	phosphatase	NA	NA	NA	NA	NA
WP_048876022.1|1876977_1877829_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1878241_1879395_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1879485_1880589_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
>prophage 21
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1904419	1952166	3187449	transposase	Staphylococcus_phage(50.0%)	42	NA	NA
WP_080999995.1|1904419_1905790_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1907506_1908154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1908191_1908584_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_082304113.1|1910185_1910749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304115.1|1910729_1911092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1911208_1912183_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1912328_1913057_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1913176_1913758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304116.1|1913780_1914251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304118.1|1914279_1916622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1918666_1919617_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1919699_1920482_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1920580_1920874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1921397_1922042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1922075_1922720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1922768_1923623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1923760_1924273_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1924340_1924535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1924748_1925102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1926310_1927285_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1928032_1928734_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|1928808_1929468_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376681.1|1931137_1931800_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1931789_1933022_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1933153_1933771_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1933850_1934357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1934367_1934595_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|1935877_1936144_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764893.1|1936280_1937108_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082304420.1|1937140_1937494_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1937638_1937974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1937984_1938398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1939606_1939771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1939807_1940683_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|1940869_1941382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1943813_1945013_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_047927375.1|1945604_1947596_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1947669_1948647_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_082304119.1|1948782_1949565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1949726_1950050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1950117_1951221_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1951290_1952166_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	1968412	2017970	3187449	transposase,tRNA	Staphylococcus_phage(37.5%)	47	NA	NA
WP_027242999.1|1968412_1969507_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1970473_1971877_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1972046_1972610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1972745_1974221_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1974227_1974434_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1974491_1975562_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1975759_1977730_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1978090_1979650_+	APC family permease	NA	NA	NA	NA	NA
WP_017375758.1|1979943_1980150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304128.1|1980246_1980558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375760.1|1980548_1980701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1981446_1982106_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_082304421.1|1982201_1983563_+	histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1983704_1983932_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_082304130.1|1984983_1986105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304131.1|1986106_1986325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1986978_1987140_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1987239_1988067_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1988420_1989296_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1989339_1990314_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1990333_1990522_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242753.1|1991166_1991709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242754.1|1991989_1992343_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242755.1|1992335_1993481_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242756.1|1993891_1995139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242757.1|1995276_1995660_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242758.1|1995656_1996388_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242759.1|1996390_1997134_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_144420798.1|1997147_1998047_-	GTPase Era	NA	NA	NA	NA	NA
WP_027242761.1|1998052_1998727_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|1998889_1999111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|1999138_2000080_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|2000076_2001879_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|2002188_2002758_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|2002912_2004487_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_129556541.1|2004494_2004809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|2004933_2005179_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080963649.1|2005220_2006258_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|2006404_2006731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082328.1|2006740_2006878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|2006887_2007298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764846.1|2007440_2007764_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_048876034.1|2008024_2008717_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|2008713_2008857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2010200_2010428_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242772.1|2014849_2015896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|2017331_2017970_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
>prophage 23
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2024095	2099140	3187449	transposase	Bacillus_phage(18.18%)	58	NA	NA
WP_053093677.1|2024095_2024815_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2025430_2025814_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_082304134.1|2026458_2026932_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2027037_2028408_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2028523_2029255_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2029279_2030377_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2030412_2031831_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2032040_2032493_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2032504_2032732_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2032781_2033108_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2033311_2034001_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2034149_2034638_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|2034678_2035779_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2035824_2036907_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|2036899_2037460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2037450_2038755_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|2038808_2039831_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2039855_2040872_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_155764847.1|2041304_2044232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764848.1|2044253_2044430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2044826_2045450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2049549_2050524_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875961.1|2055184_2056588_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082304137.1|2058290_2058857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304139.1|2058874_2060674_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	2.4e-10
WP_082304142.1|2060965_2061580_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_082304143.1|2061576_2064270_-	DNA repair protein	NA	NA	NA	NA	NA
WP_027242789.1|2066743_2067565_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_155049741.1|2067636_2068080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764810.1|2068270_2069089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764772.1|2068982_2069675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764849.1|2069671_2070742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304146.1|2070987_2071860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075316659.1|2071885_2073163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2073185_2073866_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|2073894_2074128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2074180_2074408_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876044.1|2075486_2075987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|2076479_2076653_+	phosphatase	NA	NA	NA	NA	NA
WP_017375730.1|2077809_2079057_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_016211119.1|2081003_2081765_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|2081928_2082834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|2083057_2083873_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|2084058_2084448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|2084726_2085185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|2085455_2086064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2086594_2087470_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2087710_2088385_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2088413_2088902_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2089947_2090382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2090587_2091991_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|2092238_2093750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2094711_2095005_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2094962_2095541_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2095626_2096502_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2096494_2096851_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2096859_2097255_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|2098579_2099140_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2107848	2163416	3187449	transposase	Staphylococcus_phage(36.36%)	49	NA	NA
WP_017377694.1|2107848_2108577_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_082304162.1|2108617_2109226_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2109273_2109741_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2109795_2110770_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|2110799_2111417_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2111395_2111857_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2111900_2112836_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2112863_2113859_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2114102_2115065_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|2116493_2117222_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_082304164.1|2117272_2118028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304165.1|2117984_2118623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2119177_2120365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2120966_2121404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304168.1|2121599_2123864_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.3e-16
WP_017377865.1|2123938_2124211_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2124286_2124595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2127070_2127388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2127545_2128520_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|2128516_2128906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764854.1|2129235_2129736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2129704_2130433_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2131180_2131468_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2131527_2131692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2131688_2133092_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|2133124_2133886_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|2134171_2134888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2135665_2136571_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|2137057_2138350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|2138585_2141369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|2142974_2143442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304169.1|2143442_2144144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|2144405_2144588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|2144842_2145217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|2145326_2147318_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2147307_2148354_-	glutathione synthase	NA	NA	NA	NA	NA
WP_082304171.1|2148794_2149646_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	7.8e-12
WP_017376283.1|2149646_2150564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|2150959_2151133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2151735_2152707_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963609.1|2154894_2156061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|2156400_2156712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|2157189_2157495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|2157816_2158347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|2158793_2159723_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_017375625.1|2160422_2160650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304172.1|2160803_2161784_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	8.1e-29
WP_080999998.1|2162045_2162315_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|2162459_2163416_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2170180	2306528	3187449	transposase,protease,tRNA	Staphylococcus_phage(20.0%)	113	NA	NA
WP_017377787.1|2170180_2170408_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|2171458_2172316_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|2172312_2173074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2173158_2175888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2176021_2176897_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155764855.1|2177161_2178448_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2178565_2179279_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|2179447_2179939_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|2180078_2180570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2180772_2181663_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2182047_2182632_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2182712_2183651_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2183702_2184797_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|2184921_2186244_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_082304176.1|2186291_2191178_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2191272_2191575_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2191685_2193608_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_082304178.1|2194922_2196536_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2196642_2197536_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2197645_2198269_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_155764757.1|2198377_2198626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377001.1|2198975_2199674_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2199817_2200387_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_082304179.1|2200702_2201329_-	porin family protein	NA	NA	NA	NA	NA
WP_082304181.1|2201525_2201816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304183.1|2201763_2202273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2202368_2203208_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2203258_2203606_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2203796_2204684_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2204798_2205401_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|2205397_2206117_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2206185_2207898_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2208045_2209983_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2210095_2211145_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2211144_2211420_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2211500_2212049_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210338.1|2212168_2212306_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2212373_2212601_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420713.1|2214300_2215002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304184.1|2215231_2216155_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082304186.1|2216168_2216864_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_082304187.1|2216850_2217093_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_082304189.1|2217209_2217698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|2218000_2218828_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|2218978_2219350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|2219586_2221077_+	nuclease	NA	NA	NA	NA	NA
WP_017376515.1|2222625_2224092_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376514.1|2224088_2225138_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_016210305.1|2227536_2227941_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|2228002_2228728_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|2228813_2229707_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|2229747_2230368_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|2230428_2230635_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|2230656_2232801_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376505.1|2235988_2237272_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|2237512_2238487_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2238802_2238964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2238960_2240364_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2240477_2241245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2241603_2243007_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082304423.1|2243871_2244030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2246912_2247788_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_082304190.1|2249239_2249521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|2249739_2249919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2250078_2251098_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2251084_2251507_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2251508_2251982_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2252107_2252764_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2252760_2253435_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2253440_2254589_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2254585_2255047_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2255122_2256373_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_082304192.1|2256499_2258179_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2258289_2259171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2260258_2260852_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|2261213_2261729_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|2262668_2262953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764894.1|2263428_2263779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764856.1|2264226_2265126_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	2.6e-26
WP_027242983.1|2265282_2265921_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|2266002_2266401_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|2266553_2266871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|2266949_2267204_-	LapA family protein	NA	NA	NA	NA	NA
WP_082304193.1|2267357_2269019_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|2269079_2269763_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|2269762_2270848_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_036773644.1|2270889_2273526_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_155046577.1|2274487_2274649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|2275332_2276652_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|2276655_2277372_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_082304196.1|2277368_2278010_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|2278002_2278137_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377757.1|2278385_2278658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304198.1|2279059_2279335_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|2280411_2281815_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046576.1|2282365_2283310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375704.1|2283778_2284126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|2284161_2284824_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_027242979.1|2284867_2285470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304199.1|2285699_2286755_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.2	8.4e-48
WP_082304201.1|2286758_2289944_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375710.1|2290021_2290978_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242977.1|2291026_2291563_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375712.1|2291559_2292321_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242976.1|2292423_2295012_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_144420805.1|2295441_2296053_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242975.1|2296311_2297187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304202.1|2297320_2298010_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	7.0e-11
WP_051929647.1|2298040_2298322_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	39.2	9.1e-10
WP_027242974.1|2299575_2300232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304204.1|2300339_2302457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242972.1|2302845_2304138_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242971.1|2304464_2306528_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
>prophage 26
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2336745	2389333	3187449	transposase,tRNA	Synechococcus_phage(14.29%)	45	NA	NA
WP_048875859.1|2336745_2337540_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2337829_2338753_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2339020_2339314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2340517_2341441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2341576_2342419_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2342506_2343157_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|2343170_2344211_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_082304205.1|2344333_2345419_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2345445_2346555_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2346859_2347177_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2347173_2347533_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2347635_2350368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304207.1|2351857_2352091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304208.1|2352095_2352365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304424.1|2352364_2352538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420807.1|2352784_2353003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375895.1|2354784_2356014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304210.1|2356056_2356245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2357079_2357355_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2360058_2360238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2360234_2360606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2360616_2361699_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|2361695_2361917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2362901_2363120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|2364135_2364456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2365841_2367092_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2367080_2367962_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2367954_2369040_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2369036_2370296_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2370464_2371124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2371294_2371957_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2372303_2373251_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2373347_2373974_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2373979_2374561_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2374632_2375724_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2375813_2376527_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_144420808.1|2377680_2378358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2380035_2380293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2380692_2381667_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2381841_2382486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2382665_2383460_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774583.1|2384158_2384809_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377925.1|2386202_2386595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243053.1|2387096_2388122_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_087910651.1|2389156_2389333_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
>prophage 27
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2406955	2425437	3187449	transposase,protease	Staphylococcus_phage(28.57%)	16	NA	NA
WP_017377942.1|2406955_2407462_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_082304215.1|2407507_2410192_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_155764857.1|2410137_2410458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304218.1|2410479_2410812_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_155046571.1|2411976_2412132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2413206_2414373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2414517_2415270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2415625_2416600_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_082304219.1|2416732_2417443_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2417439_2418474_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2418577_2418919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2419429_2420590_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2420558_2421155_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2422123_2422294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2422290_2423265_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2424283_2425437_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 28
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2492825	2604025	3187449	transposase,tRNA	Staphylococcus_phage(17.65%)	85	NA	NA
WP_036771330.1|2492825_2493800_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2493823_2494261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2494295_2495699_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2496279_2496441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2497661_2498033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2498140_2499691_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376018.1|2500560_2501076_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2501079_2502072_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2502450_2503821_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2504029_2505169_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2505382_2506357_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036816881.1|2506380_2506599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|2506676_2506925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|2512578_2513259_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376633.1|2515212_2515482_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_082304245.1|2515665_2516643_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.3	6.6e-15
WP_082304246.1|2518938_2519925_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772145.1|2519935_2521738_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|2521755_2523057_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|2523072_2524356_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|2524488_2524881_+	RidA family protein	NA	NA	NA	NA	NA
WP_082304248.1|2524987_2526073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|2526288_2527305_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|2527307_2528315_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_016209558.1|2529489_2529852_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_082304249.1|2529848_2531564_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|2531663_2532338_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2532366_2532771_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2532795_2533755_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2533887_2534670_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2534771_2535731_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2535875_2536223_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_082304251.1|2537435_2537948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304252.1|2538780_2539791_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.3	2.1e-56
WP_144420814.1|2540225_2541143_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2541287_2541824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376607.1|2543977_2544967_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2545135_2545474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2545470_2546046_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2546094_2546310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2546496_2547336_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2551037_2551946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|2552076_2552733_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764861.1|2552841_2552982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764862.1|2552942_2553770_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082304255.1|2554088_2554376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764863.1|2554394_2554553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2555121_2556441_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2556508_2557375_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2557367_2558243_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2558301_2558520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2559920_2560250_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|2560484_2561189_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|2561169_2563398_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2563660_2564674_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2564782_2565004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377047.1|2566784_2567318_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2567438_2568557_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_155764864.1|2568549_2569068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304258.1|2568940_2569876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2569862_2570999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2571229_2571655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2574987_2575341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2575375_2576251_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2576407_2576812_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2576959_2578135_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2578394_2578898_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377060.1|2580646_2581600_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2581580_2582672_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2582974_2583217_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155764865.1|2584117_2584303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|2584975_2585158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2585733_2586006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2586158_2586413_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2586527_2587931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2588015_2588522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304259.1|2589094_2590909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2590975_2591506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2593049_2593766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2593808_2594246_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_155764866.1|2598521_2598845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304261.1|2598751_2599336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2599519_2600983_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2601342_2602722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2603476_2604025_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 29
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2635832	2678886	3187449	transposase	Staphylococcus_phage(25.0%)	42	NA	NA
WP_036773116.1|2635832_2636807_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2636803_2637241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2637415_2638819_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2638829_2639105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2639382_2639853_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2640155_2641526_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2641855_2642323_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2642335_2643346_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2643547_2644951_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155764868.1|2645014_2645206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242632.1|2645378_2646167_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2646153_2647182_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2647159_2647564_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377116.1|2649958_2650450_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2650484_2651327_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2651372_2651825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2652114_2652747_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155050374.1|2654030_2655140_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.6e-49
WP_144420723.1|2655457_2656843_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2656882_2657140_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155764869.1|2659555_2660383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275411.1|2660379_2660961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2660957_2661998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2662391_2662787_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2662783_2663572_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2663757_2664483_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375806.1|2666211_2666754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2666750_2667437_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2667440_2668052_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2668098_2669118_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_082304294.1|2669220_2670015_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	8.1e-104
WP_017375811.1|2670028_2670829_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2670907_2671957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2672132_2673413_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2673458_2674136_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2674221_2674503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2674594_2675449_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2675388_2675787_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_082304296.1|2676314_2676890_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155764896.1|2676909_2677257_+	EamA family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2677975_2678197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764870.1|2678193_2678886_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2731965	2767904	3187449	transposase	Staphylococcus_phage(20.0%)	31	NA	NA
WP_048876031.1|2731965_2733369_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082304348.1|2733697_2734324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2734473_2735448_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910663.1|2736888_2738091_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2738328_2738742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063625.1|2738847_2739225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2739243_2739813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2739815_2740154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2740146_2740680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2740698_2740989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2741075_2742707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2743260_2743764_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2743726_2744434_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2744498_2745359_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2745339_2746113_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2746143_2747382_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2747381_2748344_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2748387_2749140_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2751668_2751905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2751923_2752373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2752593_2754018_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_082304350.1|2754082_2755132_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2755422_2756154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2756184_2757075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304351.1|2758417_2761228_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2761520_2762546_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2762929_2763787_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2763956_2764685_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2764885_2766289_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2766434_2766932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2767001_2767904_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2791116	2871596	3187449	transposase,protease,tRNA	Staphylococcus_phage(33.33%)	96	NA	NA
WP_069971662.1|2791116_2792091_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2792374_2793577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2793873_2794131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2794088_2794529_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2794634_2795201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304356.1|2795345_2795600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304357.1|2795744_2796599_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774534.1|2796619_2797045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063584.1|2797136_2798096_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2798092_2798740_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2798768_2799620_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376956.1|2800953_2801469_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2801546_2802608_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2802629_2803718_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2803762_2805598_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2805640_2806111_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2806147_2806483_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2806495_2807212_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2807148_2808189_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2808161_2808641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2808727_2811208_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2811270_2811702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2811902_2812193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2812252_2813851_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2814015_2814351_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2814379_2816044_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2816043_2816685_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2816684_2817428_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2817486_2817723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2817873_2819241_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2819251_2819803_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2819883_2820987_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2820988_2822746_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2822968_2823592_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_047927118.1|2823646_2824039_-	DksA protein	NA	NA	NA	NA	NA
WP_047927116.1|2824206_2824821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2824878_2825664_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2826296_2827313_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_082304359.1|2827312_2827828_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2827869_2828343_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2828398_2829184_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_082304360.1|2829227_2829914_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.9e-09
WP_017376985.1|2830059_2830308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2830683_2831337_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|2831305_2831485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764897.1|2831882_2832710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764878.1|2832670_2833099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875859.1|2833407_2834202_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|2834334_2834562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|2834805_2835084_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242670.1|2835168_2835825_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_017378018.1|2835811_2837059_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017378019.1|2837173_2837572_-	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_016209739.1|2837620_2838598_-	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378020.1|2838619_2839240_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209730.1|2839249_2839639_-	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378021.1|2839664_2840021_-	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209752.1|2840164_2840278_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_082304362.1|2840334_2841627_-	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_017378023.1|2841658_2842093_-	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_017378024.1|2842095_2842278_-	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_016209764.1|2842283_2842784_-	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_016209757.1|2842794_2843148_-	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_017378025.1|2843157_2843691_-	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209763.1|2843703_2844096_-	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_026063699.1|2844124_2844430_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209761.1|2844442_2844985_-	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_016209734.1|2845000_2845312_-	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_017378028.1|2845329_2845698_-	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_017378029.1|2845819_2846077_-	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_016209750.1|2846076_2846277_-	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378030.1|2846276_2846690_-	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_017378031.1|2846703_2847438_-	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_016209755.1|2847450_2847783_-	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378032.1|2847788_2848064_-	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_017378033.1|2848080_2848905_-	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_016209744.1|2848919_2849216_-	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_016209735.1|2849212_2849830_-	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_017378034.1|2849845_2850484_-	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_155764879.1|2850606_2850918_-	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_016209759.1|2850924_2852115_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_017378035.1|2852142_2854254_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209732.1|2854269_2854743_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_016209765.1|2854847_2855222_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_017378036.1|2855383_2859592_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_017378038.1|2864003_2864372_-	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378039.1|2864414_2864921_-	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378040.1|2865168_2865867_-	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378041.1|2865870_2866302_-	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378042.1|2866462_2867002_-	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378043.1|2867011_2867380_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_051929544.1|2868153_2868573_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_082304363.1|2868607_2870053_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_017378046.1|2870006_2870639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304365.1|2870719_2871448_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_017377902.1|2871437_2871596_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2897435	2959124	3187449	transposase,protease,tRNA	Staphylococcus_phage(50.0%)	58	NA	NA
WP_036771330.1|2897435_2898410_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378082.1|2899231_2899585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378083.1|2899614_2900193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242676.1|2900310_2901072_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048875857.1|2901310_2902285_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378088.1|2902388_2902745_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_017378089.1|2902734_2903451_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017378090.1|2903458_2903944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378092.1|2905208_2905673_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_027242677.1|2905746_2906091_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_047927317.1|2906174_2908514_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_017378095.1|2908682_2910092_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.0	7.6e-28
WP_047927315.1|2910088_2910586_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	33.6	1.1e-13
WP_017378097.1|2910783_2911962_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_017378098.1|2912045_2912798_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_017378099.1|2912905_2913421_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_082304368.1|2913551_2913962_+	phasin family protein	NA	NA	NA	NA	NA
WP_027242678.1|2914101_2914449_+	phasin family protein	NA	NA	NA	NA	NA
WP_082304369.1|2914514_2915582_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017378104.1|2915575_2916094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378105.1|2916189_2918361_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016209298.1|2918428_2918695_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_017378106.1|2918758_2919703_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2919702_2920056_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2920104_2922780_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2922796_2924314_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2924390_2924843_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2925062_2926502_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378112.1|2928056_2930027_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2930030_2930336_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2930359_2930983_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2931002_2931491_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2931504_2932530_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2932534_2934928_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2934977_2936267_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2936273_2936774_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2936773_2938027_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2938028_2938706_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2938723_2939209_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2939199_2939568_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2940249_2940612_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2940625_2941387_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2941688_2943035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|2945423_2946443_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2946713_2947115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2947125_2947449_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2947472_2948483_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2948549_2949398_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2949514_2950426_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2951195_2952071_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2952129_2952510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2952656_2952893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2953189_2953660_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2953714_2954569_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2955040_2955259_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_027242681.1|2956666_2957149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2957385_2957814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2958149_2959124_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 33
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	2973989	3029620	3187449	transposase	Bacillus_phage(12.5%)	45	NA	NA
WP_048875854.1|2973989_2974865_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2974898_2976164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2976351_2977227_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2977425_2977617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764881.1|2977821_2978238_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764882.1|2978197_2978374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764883.1|2978318_2979119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275379.1|2979438_2979657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2979693_2981073_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2981100_2981559_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2981536_2982754_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2982946_2983183_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2983196_2983352_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2983432_2984395_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375948.1|2985880_2986549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2986959_2988774_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2989489_2989675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2989856_2990315_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|2991034_2991910_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|2992141_2992540_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2992543_2992786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2993675_2995427_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_082304372.1|2995437_2996238_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.5	4.0e-34
WP_047927156.1|2997329_2998253_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2998349_2998694_+	DMT family protein	NA	NA	NA	NA	NA
WP_082304374.1|3004388_3005351_-	glycerate dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	2.4e-17
WP_036772663.1|3005389_3006265_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3006524_3007784_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_082304375.1|3008006_3008333_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	6.9e-17
WP_048875850.1|3008527_3009478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764898.1|3009535_3011602_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3011607_3012603_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3013351_3014932_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3015079_3016489_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3016548_3017682_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3017820_3018645_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|3019168_3019381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3019394_3019532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377540.1|3019669_3019903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3020954_3021326_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3021636_3021924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3022076_3022925_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377550.1|3027700_3027991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3028258_3028519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304380.1|3028645_3029620_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	6.2e-29
>prophage 34
NZ_CP013821	Piscirickettsia salmonis strain PM25344B, complete genome	3187449	3062625	3124124	3187449	transposase,tRNA	Acinetobacter_phage(33.33%)	53	NA	NA
WP_053093682.1|3062625_3063369_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|3064536_3065133_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3065403_3065982_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3070504_3072010_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|3072037_3072319_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3072467_3072809_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_155764885.1|3074967_3075513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764886.1|3075573_3076248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764887.1|3076814_3077795_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377379.1|3077916_3078915_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3078918_3079677_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3079678_3080878_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_155764899.1|3080861_3081023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304395.1|3081023_3081536_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|3081557_3082334_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|3082337_3083336_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3083337_3083916_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|3083912_3085382_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3085425_3085713_-	trp operon repressor	NA	NA	NA	NA	NA
WP_082304396.1|3085913_3086792_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3086950_3087505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075286682.1|3087675_3088047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3088317_3088668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3088861_3089401_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3089485_3090022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|3090687_3090990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304397.1|3091438_3091705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771979.1|3092105_3092426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3092604_3093579_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3093845_3094019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3094124_3095528_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3095532_3096552_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3097168_3097498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|3097723_3098122_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3098990_3099941_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3099940_3102019_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3102160_3102676_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3102684_3103248_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3103228_3103975_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_082304399.1|3104702_3105449_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_155764888.1|3105632_3106433_+	EamA family transporter	NA	NA	NA	NA	NA
WP_082304401.1|3109691_3111071_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_155764889.1|3111111_3112407_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3112415_3113390_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3113483_3113987_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3114122_3115274_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3115270_3115750_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378415.1|3115896_3118788_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	9.9e-99
WP_017378416.1|3118792_3119692_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3119879_3120434_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3120473_3121448_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3122037_3122415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3123149_3124124_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP013823	Piscirickettsia salmonis strain PM25344B plasmid p2PS14, complete sequence	51601	23592	37388	51601	transposase,tail,capsid,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|23592_24567_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|24616_25156_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|25169_25754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|26138_26450_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|26446_26872_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|27050_27446_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|27442_27793_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|27792_28215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|28216_28540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|28596_28863_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|28866_30945_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|30937_31279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|31275_31947_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|31876_32662_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_082304472.1|32651_33209_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.7	3.5e-21
WP_027242568.1|33205_35896_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|35954_36383_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|36410_37388_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP013824	Piscirickettsia salmonis strain PM25344B plasmid p3PS14, complete sequence	181103	1459	127548	181103	portal,integrase,transposase	Streptococcus_phage(42.0%)	120	13691:13750	106352:107087
WP_036771347.1|1459_2437_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|2451_2613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|2830_3085_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_048876199.1|3074_3365_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.6	1.3e-11
WP_036771347.1|3351_4329_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|5334_5547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|5705_6683_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_082304481.1|6697_7144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|7401_8379_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155764906.1|8731_9892_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155764907.1|10687_11077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|10992_11970_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_082304483.1|11999_12341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304484.1|12318_12522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304485.1|12803_13148_-	hypothetical protein	NA	NA	NA	NA	NA
13691:13750	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|14961_15984_+	hypothetical protein	NA	NA	NA	NA	NA
13691:13750	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_036774350.1|16466_17195_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|18434_18968_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|19148_19490_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|19670_19937_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|20009_21875_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|22042_22327_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|22670_23399_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243207.1|23480_24032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|24704_24932_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|26483_26912_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|26847_27234_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|27263_27992_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|28003_28153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|28399_29128_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|30505_31468_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|31491_31821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|31887_32928_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|32941_33133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|33337_33907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|33949_34249_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|34245_34710_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|34983_35712_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|35885_36659_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|37372_38308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|38582_39311_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|39476_39716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|39779_43121_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|43278_44007_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|44300_44696_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|44748_45477_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|45960_46689_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|46859_47429_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_155764917.1|47433_48117_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_080963627.1|49016_49235_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774644.1|50214_51276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|51784_52531_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|52531_52936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|53242_54217_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|54756_55023_-|transposase	transposase	transposase	NA	NA	NA	NA
53334:54254	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_155764908.1|55318_57166_-	DUF1561 family protein	NA	NA	NA	NA	NA
53334:54254	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_082304490.1|57753_59481_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|60180_60516_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017375836.1|60710_60914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|65980_67384_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|67648_67900_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|68300_69275_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|70262_70718_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|70812_71274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082304492.1|73334_75008_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_082304493.1|74907_75408_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_017377509.1|75437_76166_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|76307_77240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|77269_77998_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|78000_78273_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|79123_79852_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|79907_80528_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|81676_82405_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420839.1|82600_83527_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|84196_84367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|84511_84805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|86669_87125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|87368_87767_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|87763_88027_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243210.1|88441_89176_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_075275471.1|92399_93374_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|94010_94178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|94146_94875_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|95383_95737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|96664_97393_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155764909.1|98020_100198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082304496.1|100163_101321_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|101629_102520_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|103758_103935_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_082304497.1|104051_104651_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	38.1	6.9e-31
WP_048876212.1|104714_105593_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243193.1|105623_106166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|106437_107142_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_036772541.1|107153_107882_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|107911_108301_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|108323_109052_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|109054_109663_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_036772538.1|109780_110008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|110034_110259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|110251_110590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|110603_111008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|111052_111271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764910.1|112239_112374_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_082304498.1|112363_113353_+	replication initiation protein	NA	A0A1V0E006	Clostridioides_phage	33.6	1.1e-09
WP_017377655.1|113694_113940_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|113936_114323_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_082304499.1|114410_115139_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	2.7e-37
WP_082304500.1|115241_115739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|116084_116771_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|117720_118083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|118085_119825_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|120226_120379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|120406_121090_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|121171_122149_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|122224_122395_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|122435_123164_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|123709_123976_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|124271_126170_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|126599_127328_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080999960.1|127395_127548_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013824	Piscirickettsia salmonis strain PM25344B plasmid p3PS14, complete sequence	181103	166380	171311	181103	portal,transposase,terminase	Streptococcus_phage(42.86%)	7	NA	NA
WP_027242929.1|166380_166764_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|166850_167333_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|167335_168667_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|168871_169306_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_155764918.1|169392_169779_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|169816_170551_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|170597_171311_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 1
NZ_CP013825	Piscirickettsia salmonis strain PM25344B plasmid p4PS14, complete sequence	33542	21614	32267	33542	tail,capsid,terminase,transposase,head	unidentified_phage(30.0%)	14	NA	NA
WP_027242943.1|21614_22031_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|22027_22585_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|22930_23446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|24249_24465_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|24538_25513_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|25893_26475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|26510_26903_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|26999_27974_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|27993_28179_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|28181_28664_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|28750_29134_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|29346_30213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|30838_31813_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|31910_32267_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
