The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	0	69796	3192856	transposase,tRNA	uncultured_Mediterranean_phage(26.67%)	58	NA	NA
WP_017376407.1|341_695_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|715_2584_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|2605_3550_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|3783_4062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|4424_5063_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|5037_6462_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|6662_7340_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|7460_8735_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|8802_9558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|9609_10527_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|10661_10832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|10951_11731_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|11783_12071_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|12130_12481_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|12674_12827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|12754_13228_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|13240_13876_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|14387_15263_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|16869_18228_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|18451_18640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|18653_19787_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|19987_23860_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|23894_24620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|25009_25738_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|26140_26869_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|26932_27760_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|27941_28310_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|28306_29125_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|29225_30041_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|30324_32385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|32381_32807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|32992_34486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|34618_35434_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|35529_35946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|36328_36868_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|37784_37946_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|38657_39719_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|41209_41563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|41771_43484_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|43930_45784_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|45886_46219_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|46249_46846_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|46842_47967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|48078_48726_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|48777_50691_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|50895_51933_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|51991_55318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|56024_56993_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|57122_57611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|58052_58286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|58595_58784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|59272_59758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|60028_60298_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|60332_61658_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|61713_62361_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|62554_64513_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|64656_67587_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|68392_69796_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	74865	83708	3192856	transposase	Acinetobacter_phage(50.0%)	12	NA	NA
WP_048876031.1|74865_76269_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|76265_76712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|76717_76924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|76953_77613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|77631_78507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|78642_79632_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|79608_80370_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_155046602.1|80402_81182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|81458_82094_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|82090_82255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|82453_83428_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|83486_83708_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	94297	95011	3192856		Cyanophage(100.0%)	1	NA	NA
WP_017378273.1|94297_95011_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.0	7.4e-40
>prophage 4
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	138445	139744	3192856		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017378233.1|138445_139744_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
>prophage 5
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	143191	195575	3192856	transposase,tRNA	Vibrio_phage(13.33%)	47	NA	NA
WP_017378229.1|143191_145084_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.8	9.7e-87
WP_017378228.1|145090_146011_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|150174_150318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|150927_151746_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|151853_152315_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|152331_153255_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|153278_154328_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|154465_155059_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|155081_155552_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|155661_156912_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|157600_158065_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|158503_159976_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|160092_160545_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|160669_160825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|160969_161173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|161363_161762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|161947_162553_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|162561_162858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|162862_163399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|163543_164113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|164192_165167_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|165163_165661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|166068_166485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|166552_167956_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|167952_168573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|168844_169819_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|169983_170607_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|170603_172544_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|172699_173353_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|173521_174697_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|175050_176376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|176468_177257_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|177358_178231_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|178417_179680_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|179753_180284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|180305_181811_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|181823_182489_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|182582_184343_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|184620_185496_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376455.1|185832_186294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376456.1|186327_188898_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376457.1|189005_189491_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376458.1|189665_190706_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376459.1|190683_191166_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376460.1|191162_193757_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|194063_194327_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|194699_195575_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	206274	274302	3192856	transposase,tRNA,protease	Burkholderia_phage(16.67%)	63	NA	NA
WP_027242811.1|206274_207489_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|207488_208382_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|208579_209878_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|209967_211245_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|211258_213658_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|213654_214413_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|214589_214979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|217101_217389_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|217754_218546_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|219204_219696_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|219684_220413_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|220431_221289_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|221294_222548_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|222581_224450_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|224436_225675_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|225659_227507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|227491_228697_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|228708_230898_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|231466_232096_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|232118_232538_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_027242816.1|232530_232935_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|232934_233777_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|233832_234813_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|234793_236791_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|236808_237984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|238265_239669_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|239817_240180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|240351_240570_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|241115_243143_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|243224_244475_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|244774_245110_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|245421_245670_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|245705_246215_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|246214_246994_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|247011_247359_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|247468_247744_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|247905_248262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|248660_248996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|249200_249977_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|249933_250806_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|251090_251378_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|251461_252181_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|252311_252920_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|253725_254700_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|254779_255157_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027242786.1|255255_256347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|258019_258517_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|258661_259060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|259145_260051_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|260269_260590_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|260671_261445_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|262021_262855_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|262884_263739_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|264115_265126_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|265270_265528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|265641_266898_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|267153_267333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|267826_268069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|268094_269453_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|269734_270094_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|270525_272160_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|272166_273003_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|273024_274302_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
>prophage 7
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	277660	279654	3192856		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_017377574.1|277660_278434_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|278604_279654_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
>prophage 8
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	290070	291045	3192856	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771332.1|290070_291045_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
>prophage 9
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	323322	330181	3192856		Hokovirus(33.33%)	5	NA	NA
WP_027242826.1|323322_323874_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	3.7e-07
WP_027242827.1|324173_325358_+	MFS transporter	NA	NA	NA	NA	NA
WP_026063602.1|325512_327111_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	7.4e-56
WP_017377147.1|327568_328192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377146.1|328237_330181_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.0	1.7e-14
>prophage 10
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	340703	341426	3192856		Bacillus_phage(100.0%)	1	NA	NA
WP_017377133.1|340703_341426_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
>prophage 11
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	349401	494156	3192856	integrase,transposase,tRNA,protease	Staphylococcus_phage(18.92%)	136	369429:369488	475857:476961
WP_017377125.1|349401_350157_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.0	2.0e-11
WP_080963632.1|350137_351538_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_027242831.1|351561_352779_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.5	4.0e-94
WP_016209778.1|352809_353184_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_017377121.1|353202_353754_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_027242832.1|354101_354539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876002.1|354924_355908_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|356707_357861_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|357982_358675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|358683_359871_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|360020_360647_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|360692_361922_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|362116_362563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|362754_364113_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|364778_364952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|365081_365999_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|366340_367000_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|367080_367584_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|367556_367844_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|368136_369258_-	calcium:proton antiporter	NA	NA	NA	NA	NA
369429:369488	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_036771330.1|369520_370495_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376496.1|370761_371883_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_144420790.1|371979_372195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772303.1|372281_373052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155601400.1|374192_374405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|374304_374523_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048876006.1|376386_376980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046592.1|376955_377102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929832.1|377304_377565_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017375982.1|377763_378384_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|378457_379741_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_027243165.1|380081_381392_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|381539_382928_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243163.1|383063_384392_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375989.1|384462_384963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|385482_386457_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|386532_386850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|386853_387222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|387955_388924_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|389133_390546_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|390733_391447_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|391467_391881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|391981_393055_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|393191_394091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|394346_394598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|394646_395282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|395406_396264_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_053856766.1|396451_397855_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|398030_398534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|398610_399912_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|400080_401181_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|401531_401774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|401767_402085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|403307_403535_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|404145_404616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|404838_405138_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|405134_405380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|405672_406629_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|406913_407117_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|407247_408276_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|408639_408885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|409247_410222_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|411693_413400_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|413445_414297_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|414499_416956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|417475_417877_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|418463_419438_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|419478_420807_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|421070_421640_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|421655_421967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|421976_422945_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|423057_423411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|423414_424479_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|424479_426219_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|426225_426648_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|426631_427261_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|427496_427595_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|427627_429499_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|429646_430621_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|430700_430844_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|431017_432361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|432859_433138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|433405_434362_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|434688_435072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420680.1|435087_436008_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|436323_437199_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|437200_437365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|437544_437730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|437773_438748_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|438744_440046_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|440063_440600_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376785.1|441062_441968_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|443374_443536_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|444070_444280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|445395_446709_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|446944_448090_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243097.1|448155_448341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|448376_449009_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|449185_449842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|449830_452116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|452389_452749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|453030_453666_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|454853_455678_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|455733_456945_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|457728_458436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|458498_458678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312151.1|458739_459072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|459169_459913_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|459926_460970_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|461108_462878_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|463102_464236_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|465085_467905_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|468279_469005_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|471599_472160_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|472364_472697_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|472756_473044_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|473696_474722_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|474849_475824_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|476018_476972_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
475857:476961	attR	AGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCGATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAGTATTGTATTACCTAAGCGCTGAACATAAAAATCAAATAAATTTAAAAAAATTAATTACTGACCTACTCGATTTAATATCTGTATACGTGCGCACTCAATGATTTTTTGAGGATTCACCTTACCAATAAACTCATTACAATCGGTCTGCTGAATATCATTTTTATTAAATACACCAGTAATAGACGTATTTAAAATAATAAACAAGTTCTTTAATCCTGGATGCTCGCGGCATGCTTTAATAAAGGCATAACCATCGATTTCTGGCATCTCAACATCTGCAATAACCATTAAGTATTTTTGAGTAATATCACCTCCTGCCCCAGGCAACACATTGATCAAGTAATCTAAAGCCTCTCGACCATTTCGCATGAGAATACTTTTTACACCTATGGTATCTAAGGCTTTTTTAACCTGCTTACGTGCAATCAGGGAGTCATCTACAACTAGCGCTGTATAGTGAGGTGCTTGCTCTATCACAACATTTTCAAGCGTATTAGTGCTGACCTTAATATCATATTGAGCAGGATGAATTTCATAAATCACTTTTTCAACATCAATGACTTGTATCAGTGATGTAGCTCCTTCTTCATTAATTTTTAAAACACTAGTAATATATTTATCTTTACCGGTTGCCTCGGGTGCAGCAATTACATTTTCCCATGTTGCATTGATAATGTGATGAACTTCATGAACAAGAAACCCTTGCACAGAATGATTATATTCAGTCACGATCAAAATGCCGCTTAAAGGATCAATCGTTTTCTTAGCAAAAATTGCCTGACAAGTATCAATCACCGCTAGAGACTGATTACGAATATGAACAACTCCAAGCACGGCCGGATGACTTTCCGGTAGCACTGCCAACTCCGGTAAATGCAATACTTCTCTCACTTTAAAGACATTAATCGCATATTGACGCCCATAAATGCTAAATACTAACGCTTCAAAGCGATTCCTGCCCACTAATTTTGTTCGTGAATCAATATTCTCTAATAAA	NA	NA	NA	NA
WP_144420684.1|477141_477390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|477572_478097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|478551_479379_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|479447_479633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|479833_480292_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|480432_480660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|480824_482210_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|482505_482820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|482928_484554_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|484966_485956_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|486277_486463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|486852_488808_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|488879_489002_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|489044_490019_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|490241_490703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|491087_491885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|492350_494156_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
>prophage 12
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	505154	632747	3192856	transposase,tRNA	Acinetobacter_phage(11.76%)	107	NA	NA
WP_017377206.1|505154_506612_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|506648_507113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|507140_507719_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|507989_509807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|509783_510833_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|511032_511410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|512599_512887_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|512946_513243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|513387_514044_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|514283_514664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|515315_516719_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|516715_516997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|517391_517856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|518036_518630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|518815_519790_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|520193_521018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|521092_522241_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|522256_523885_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|524228_525422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|531536_532037_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|532450_532591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|532713_534174_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|534251_534734_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|534892_536158_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|536242_537502_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|537573_537846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|538183_538519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|538879_539128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|539398_539809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|539953_540490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|540500_540686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|541121_542093_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|542074_543046_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|543159_543933_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|544203_544533_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|544788_545307_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|545359_545587_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|546568_547444_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|547635_548013_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|548572_549622_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|549935_551321_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|551327_552866_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|552908_553634_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|553804_555037_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|555236_556058_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|556107_556917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|557072_560939_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|561104_561980_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|562044_562323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|562467_563043_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|563091_563250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|563998_564715_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|565843_566260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|567174_568104_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|568075_568234_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|568382_568697_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|569606_570590_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|570740_571088_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|571087_571687_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|572061_572400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|572218_572608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|572611_573556_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|573543_573687_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|574048_574381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|577273_578275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|578347_578812_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|579184_579604_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376672.1|580994_584051_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|584132_585587_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|586021_587038_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|587146_587545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|587584_589408_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_027242912.1|589404_592707_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|592811_593687_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|593724_594639_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|594703_595333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|595377_595812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|595792_596533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|596546_597944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|597946_600895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|600894_602616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|602630_603035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|603035_605915_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|605917_606640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|607001_608894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|608925_611466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|611497_612661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|612666_613290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|613304_614804_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|614820_615327_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|616582_616654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|616836_617019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|618220_618493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|618508_619942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|620086_621352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|621637_623389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|623401_624565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|624568_624865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|624904_625132_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|627000_627975_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|628033_628297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|628306_629620_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|629824_629998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|630065_630209_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|630227_630425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|630442_630949_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|631871_632747_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	644253	647906	3192856		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_017377966.1|644253_644940_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|645063_646248_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|646463_647906_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
>prophage 14
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	662502	776001	3192856	transposase,tRNA	Staphylococcus_phage(23.08%)	97	NA	NA
WP_048876022.1|662502_663354_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|663766_664920_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|665010_666114_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|666453_666954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|667650_668004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|668304_670032_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|670135_670861_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|670853_672092_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|672229_673267_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|673321_674224_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|674333_675587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|675644_679136_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|679252_679930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|680057_680606_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|682476_682638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|683829_684396_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|684398_685523_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|685607_686426_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|686556_688536_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|688595_689249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|689933_691304_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|693019_693667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|693704_694097_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|694349_695096_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|695694_696600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|696715_697690_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|697835_698564_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|698683_699265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|699287_702128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|704170_705121_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|705203_705986_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|706084_706378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|706900_707545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|707578_708223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|708271_709126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|709263_709776_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|709843_710038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|710251_710605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376683.1|713534_714236_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|714310_714970_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|715107_716364_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|716638_717301_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|717290_718523_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|718654_719272_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|719349_719856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|719866_720094_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|721376_721643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|721872_722991_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|723135_723471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|723481_723895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|725103_725268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|725304_726180_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|726366_726879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|729310_730510_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|730763_731045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|731100_733092_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|733165_734143_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|734278_735061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|735217_735541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764143.1|735608_736433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927818.1|736429_736711_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|736780_737656_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|737652_737997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|738006_738468_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|738481_739873_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|739914_742902_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|742971_743805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|743859_745047_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|745034_745739_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|745784_746570_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|746597_747335_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|747439_749635_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|749709_750393_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|750403_750835_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|750880_751279_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|751655_752363_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|752427_752724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|752765_753242_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|753295_753817_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|753898_754993_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|755959_757363_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|757532_758096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|758231_759707_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|759713_759920_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|759977_761048_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|761245_763216_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|763576_765136_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|765732_766089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|766929_767589_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|767684_769046_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|769187_769415_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|770466_771807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|772457_772619_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075278705.1|772718_773546_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|773899_774775_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|774818_775793_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|775812_776001_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	783531	787358	3192856		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_027242761.1|783531_784206_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|784368_784590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|784617_785559_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|785555_787358_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
>prophage 16
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	793503	859863	3192856	transposase	Burkholderia_virus(22.22%)	49	NA	NA
WP_062365727.1|793503_794196_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|794192_794336_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|795679_795907_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|797213_799244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|799310_800336_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|800328_801375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|801515_802511_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|802808_803447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|804160_805348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|805513_806467_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|806489_808508_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|808596_808920_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|809168_809345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|809572_810292_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|810907_811291_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|811935_812409_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|812514_813885_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|814000_814732_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|814756_815854_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|815889_817308_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|817517_817970_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|817981_818209_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|818258_818585_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|818788_819478_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|819626_820115_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|820155_821259_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|821301_822384_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|822376_822937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|822927_824232_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|824285_825308_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|825332_826349_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_146619549.1|826781_829949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|830300_830924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|831706_833257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|833551_834307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|835015_835990_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|838898_839570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|840648_842052_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|843639_847041_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|847037_849731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|850034_851534_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|852200_853022_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|853093_853579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|853727_855131_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|855127_856198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|856443_858618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|858640_859321_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|859349_859550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|859635_859863_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	863255	864503	3192856		Phage_21(100.0%)	1	NA	NA
WP_017375730.1|863255_864503_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
>prophage 18
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	870899	921978	3192856	transposase	Acinetobacter_phage(27.27%)	46	NA	NA
WP_075275340.1|870899_871508_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|872038_872914_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|873154_873829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|873857_874346_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|875391_875826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|876031_877435_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|877682_879194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|880154_880448_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|880405_880984_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|881069_881945_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|881937_882294_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|882302_882698_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|884022_884583_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|885705_887595_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|887629_888835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|888837_890136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|890116_891340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|891389_892190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|892186_892585_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|892581_892890_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|893283_894012_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|894052_894697_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|894709_895177_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|895231_896206_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|896235_896853_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|896831_897293_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|897336_898272_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|898299_899295_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|899518_900481_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|901908_902637_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|902687_904322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|904592_905780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|906381_906819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|909352_909625_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|909700_910009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|912484_912802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|912958_913933_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|913929_914319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|914399_915146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|915114_915843_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|916587_916875_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|916934_917099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|917095_918499_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|918531_919293_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|919578_920295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278706.1|921072_921978_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	934200	989002	3192856	transposase,tRNA,protease	Staphylococcus_phage(20.0%)	49	NA	NA
WP_017376284.1|934200_935052_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|935052_935970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|936365_936539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|937141_938113_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963609.1|940300_941467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|941806_942118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|942595_942901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|943222_943753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|944199_945129_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|945285_945711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|945827_946055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|946208_947183_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|947449_947719_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|947863_948820_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|948980_949907_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|950202_950964_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|951165_951777_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|951797_952997_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|953091_953232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|953244_953649_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|953879_954449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|954515_955556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|955582_955810_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|956860_957718_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|957714_958476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|958560_961290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|961423_962299_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|962563_963904_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|963966_964680_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|964848_965340_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|965479_965971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|966173_967064_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|967448_968033_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|968113_969052_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|969103_970198_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|970322_971645_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|971692_976579_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|976673_976976_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|977086_979009_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|979030_980326_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|980322_981933_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|982039_982933_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|983042_983666_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|984372_985071_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|985214_985784_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|986099_986726_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|986922_987669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|987764_988604_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|988654_989002_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
>prophage 20
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	997769	1050390	3192856	transposase	Staphylococcus_phage(41.67%)	45	NA	NA
WP_017377787.1|997769_997997_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376987.1|999696_1000380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774751.1|1000627_1001551_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047927028.1|1001564_1002488_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243112.1|1002435_1003092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|1003394_1004222_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|1004372_1004744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|1004972_1006463_+	nuclease	NA	NA	NA	NA	NA
WP_017376516.1|1006530_1007868_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_017376515.1|1008010_1009477_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376514.1|1009473_1010523_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_027243115.1|1010646_1012755_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|1012917_1013322_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|1013383_1014109_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|1014194_1015088_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|1015128_1015749_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|1015809_1016016_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|1016037_1018182_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|1020377_1021301_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|1021367_1022651_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|1022891_1023866_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|1024181_1024343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1024339_1025743_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1025856_1026624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1026982_1028386_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|1029206_1029407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|1029647_1031093_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|1032288_1033164_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|1034615_1034897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|1035115_1035295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|1035454_1036474_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|1036460_1036883_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|1036884_1037358_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|1037483_1038140_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|1038136_1038811_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|1038816_1039965_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|1039961_1040423_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|1040498_1041749_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|1041875_1043555_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|1043666_1044548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|1045523_1046117_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|1046478_1046994_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1047933_1048218_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|1048767_1049043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1049415_1050390_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 21
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1055025	1058789	3192856		Streptococcus_phage(50.0%)	2	NA	NA
WP_036773645.1|1055025_1056111_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_036773644.1|1056152_1058789_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
>prophage 22
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1070942	1071998	3192856		Halovirus(100.0%)	1	NA	NA
WP_017375707.1|1070942_1071998_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
>prophage 23
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1075264	1080255	3192856		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_017375710.1|1075264_1076221_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242977.1|1076269_1076806_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375712.1|1076802_1077564_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242976.1|1077666_1080255_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
>prophage 24
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1089704	1091768	3192856	tRNA	Catovirus(100.0%)	1	NA	NA
WP_027242971.1|1089704_1091768_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
>prophage 25
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1098749	1099424	3192856		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017376751.1|1098749_1099424_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	8.9e-35
>prophage 26
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1118377	1168686	3192856	transposase,tRNA	Organic_Lake_phycodnavirus(16.67%)	45	NA	NA
WP_017377990.1|1118377_1119421_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	27.6	3.1e-18
WP_017377989.1|1119433_1119904_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377988.1|1120036_1121227_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_144420806.1|1121585_1121837_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_048875859.1|1121978_1122773_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|1123062_1123986_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|1124253_1124547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|1125749_1126673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|1126808_1127651_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|1127738_1128389_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|1128402_1129443_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|1129565_1130651_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|1130677_1131787_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|1132091_1132409_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|1132405_1132765_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|1132867_1135600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|1137089_1137767_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|1138013_1138232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|1138376_1139585_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1140012_1141470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1142305_1142581_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|1145284_1145464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|1145460_1145832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1145842_1146925_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|1146921_1147143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1148128_1148347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1148837_1149104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|1149362_1149683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|1151068_1152319_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|1152307_1153189_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|1153181_1154267_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|1154263_1155523_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|1155691_1156351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|1156521_1157184_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|1157530_1158478_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|1158574_1159201_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|1159206_1159788_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|1159859_1160951_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|1161040_1161754_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|1161847_1162672_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|1162905_1163583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|1165260_1165518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1165918_1166893_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|1167067_1167712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|1167891_1168686_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1172321	1211506	3192856	transposase,protease	Acinetobacter_phage(28.57%)	36	NA	NA
WP_027243053.1|1172321_1173347_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_087910651.1|1174381_1174558_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|1174853_1175288_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|1175481_1176951_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|1176944_1178321_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|1178333_1178726_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|1178722_1179826_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|1180004_1181297_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|1181307_1182255_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|1182266_1183079_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|1183081_1183861_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|1183875_1184934_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|1184930_1185941_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|1185947_1186145_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|1186205_1189112_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|1189153_1190005_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|1190087_1190633_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|1190730_1191591_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|1191682_1192099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|1192180_1192687_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|1192732_1195684_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|1195705_1196038_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|1196155_1196665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|1197198_1197354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|1198428_1199595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|1199739_1200492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1200847_1201822_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|1201954_1202665_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|1202661_1203696_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|1203799_1204141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|1204651_1205812_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|1205780_1206377_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|1207345_1207516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1207512_1208487_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|1209506_1210660_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_017376389.1|1210885_1211506_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
>prophage 28
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1214869	1215112	3192856		Erythrobacter_phage(100.0%)	1	NA	NA
WP_016210413.1|1214869_1215112_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
>prophage 29
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1226411	1227095	3192856		Harp_seal_herpesvirus(100.0%)	1	NA	NA
WP_016209511.1|1226411_1227095_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
>prophage 30
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1232747	1236518	3192856		Planktothrix_phage(33.33%)	5	NA	NA
WP_016209539.1|1232747_1233548_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_027242848.1|1233687_1234668_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209499.1|1234673_1235231_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242849.1|1235262_1235790_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|1235786_1236518_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
>prophage 31
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1240288	1243479	3192856		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_017376362.1|1240288_1241128_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376361.1|1241278_1241923_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376360.1|1241940_1242327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|1242546_1243479_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
>prophage 32
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1255805	1389199	3192856	transposase,tRNA,plate	Acinetobacter_phage(13.64%)	112	NA	NA
WP_027242858.1|1255805_1257113_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|1257117_1257828_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|1257840_1261011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1261077_1262214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|1263076_1263934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|1264075_1264876_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|1264974_1265550_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|1265632_1266304_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|1266349_1267249_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|1267283_1267667_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|1267816_1268647_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|1268571_1269282_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|1269278_1270304_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|1270434_1272939_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|1272945_1274214_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|1274215_1275199_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|1275211_1276033_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|1276077_1276470_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|1276544_1277351_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|1277538_1277967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1278025_1279000_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|1279023_1279461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1279495_1280899_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|1281479_1281641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|1282861_1283233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|1283340_1284891_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|1284923_1285763_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|1285759_1286275_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|1286278_1287271_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|1287649_1289020_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|1289228_1290368_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|1290581_1291556_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_017375775.1|1291603_1291798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052676.1|1291836_1292124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|1297779_1298460_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|1298524_1299811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|1300412_1300682_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|1300865_1301837_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|1301904_1302879_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|1302976_1304053_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|1304133_1305126_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|1305130_1306933_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|1306950_1308252_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|1308267_1309551_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|1309683_1310076_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|1310182_1311268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|1311483_1312500_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|1312502_1313510_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|1313513_1314668_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|1314682_1315045_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|1315041_1316757_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|1316856_1317531_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1317559_1317964_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|1317988_1318948_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|1319080_1319863_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|1319964_1320924_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|1321068_1321416_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376611.1|1322628_1323165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376610.1|1323972_1324983_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_144420814.1|1325417_1326335_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|1326479_1327016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|1327275_1328178_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|1329167_1330157_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|1330325_1330664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1330660_1331236_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|1331284_1331500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1331686_1332526_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|1336222_1337131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|1337261_1337918_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|1338026_1338953_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|1339271_1339832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|1340301_1341621_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|1341688_1342555_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|1342547_1343423_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|1343481_1343700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|1345100_1345430_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|1345664_1346369_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|1346349_1348578_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|1348849_1349863_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|1349971_1350193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|1350197_1351835_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|1351973_1352507_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|1352627_1353746_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|1353738_1355061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|1355047_1356184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|1356414_1356840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|1360169_1360523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1360557_1361433_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|1361589_1361994_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|1362141_1363317_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|1363576_1364080_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|1364119_1365604_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|1365827_1366781_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|1366761_1367853_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|1368155_1368398_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155046568.1|1369298_1369457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|1369465_1370041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|1370157_1370340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|1370915_1371188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|1371340_1371595_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|1371709_1373113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|1373197_1373704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|1374268_1376089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|1376155_1376686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|1378232_1378949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|1378991_1379429_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|1379466_1380846_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|1381240_1383235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|1383699_1384512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|1384695_1386159_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|1386518_1387898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|1388650_1389199_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 33
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1421278	1464638	3192856	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|1421278_1422253_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|1422249_1422687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|1422861_1424265_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|1424275_1424551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|1424828_1425299_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|1425601_1426972_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|1427301_1427769_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|1427781_1428792_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|1428993_1430397_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|1430823_1431612_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|1431598_1432627_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|1432604_1433009_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|1433236_1435204_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|1435399_1435891_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|1435925_1436768_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|1436813_1437266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|1437555_1438188_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|1438188_1439439_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|1439472_1440570_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|1440899_1442285_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|1442324_1442582_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|1444997_1446401_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|1446397_1447438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|1447830_1448226_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|1448222_1449011_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|1449196_1449922_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|1450166_1451354_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|1451646_1452189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|1452185_1452872_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|1452875_1453487_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|1453533_1454553_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|1454655_1455450_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|1455463_1456264_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|1456342_1457392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|1457567_1458848_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|1458893_1459571_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|1459656_1459938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|1460029_1460884_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|1460823_1461222_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|1461749_1462691_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|1463409_1463631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|1463627_1464638_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1472967	1530689	3192856	transposase	Staphylococcus_phage(71.43%)	51	NA	NA
WP_048875873.1|1472967_1474371_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|1474367_1474505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875872.1|1474677_1475961_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875871.1|1476165_1476369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376862.1|1476543_1477548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376863.1|1477905_1479141_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376864.1|1479307_1480258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|1480766_1481741_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_087910670.1|1482696_1482882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|1482975_1483440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1483827_1484802_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|1485229_1485493_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|1485934_1486909_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876253.1|1486905_1487562_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036772347.1|1487723_1488140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|1488142_1488484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|1488514_1489048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|1489229_1489457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|1489499_1489976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420818.1|1489987_1490176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|1490377_1493704_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_017376870.1|1493706_1494603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|1494879_1497183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|1497224_1498844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242646.1|1499295_1500798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|1500859_1503859_-	ATPase AAA	NA	NA	NA	NA	NA
WP_048875870.1|1503895_1504321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376878.1|1504327_1504981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|1504973_1506050_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242650.1|1506052_1506541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|1509030_1509270_-	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_017376886.1|1509274_1510405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376887.1|1510407_1511154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|1511146_1511650_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_027242651.1|1511702_1512113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|1512227_1513268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242653.1|1513283_1514210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|1514227_1515451_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_017376891.1|1515447_1516350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|1516519_1517290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|1517594_1518491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376894.1|1518714_1518948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|1519164_1519758_+	DedA family protein	NA	NA	NA	NA	NA
WP_027242656.1|1519775_1520594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242657.1|1520939_1521680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242658.1|1521755_1523219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1524561_1525965_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|1526084_1526723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|1527070_1528045_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|1528353_1529379_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|1529486_1530689_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
>prophage 35
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1535857	1536361	3192856		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_017377353.1|1535857_1536361_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
>prophage 36
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1545190	1546615	3192856		Synechococcus_phage(100.0%)	1	NA	NA
WP_017377343.1|1545190_1546615_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
>prophage 37
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1554117	1589207	3192856	transposase	Escherichia_phage(16.67%)	39	NA	NA
WP_048875864.1|1554117_1555143_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|1555526_1556384_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|1556553_1557282_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|1557482_1558886_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|1559031_1559529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|1559598_1560501_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376921.1|1560758_1561091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772950.1|1561152_1561689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376923.1|1561787_1562954_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_017376924.1|1563259_1566058_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376925.1|1566116_1567337_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376927.1|1567842_1567980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376929.1|1568406_1568694_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|1568850_1569180_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376931.1|1569214_1570852_-	response regulator	NA	NA	NA	NA	NA
WP_017376932.1|1570953_1572003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376933.1|1572075_1572720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|1572716_1573970_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376935.1|1573987_1575259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376936.1|1575283_1575874_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376937.1|1576018_1576243_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|1576223_1576553_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_026063582.1|1576779_1577343_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_017376939.1|1577379_1577841_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_017376940.1|1577918_1579604_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_026063583.1|1579653_1580481_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|1580480_1581029_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_017376942.1|1581158_1581551_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017376943.1|1581801_1582059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|1582055_1582667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|1582871_1583087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|1583103_1583241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|1583709_1584684_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|1584967_1586170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|1586466_1586724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|1586681_1587122_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|1587227_1587794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|1587938_1588193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|1588337_1589207_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1592226	1593504	3192856		Stx2-converting_phage(100.0%)	1	NA	NA
WP_017376955.1|1592226_1593504_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
>prophage 39
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1601318	1627669	3192856	transposase,tRNA,protease	Staphylococcus_phage(40.0%)	29	NA	NA
WP_017376964.1|1601318_1603799_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|1603861_1604293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|1604493_1604784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|1604843_1606442_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|1606606_1606942_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|1606970_1608635_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|1608634_1609276_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|1609275_1610019_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|1610077_1610314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|1610464_1611832_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|1611842_1612394_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|1612474_1613578_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|1613579_1615337_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|1615559_1616183_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|1616237_1616657_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|1616797_1617412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|1617469_1618255_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|1618886_1619903_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|1619905_1620418_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|1620459_1620933_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|1620988_1621774_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|1621817_1622558_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|1622647_1622896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|1623271_1623925_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|1623893_1624073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|1624470_1625685_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875859.1|1625993_1626788_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1626920_1627148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|1627390_1627669_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 40
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1643506	1656314	3192856		Klosneuvirus(25.0%)	6	NA	NA
WP_016209759.1|1643506_1644697_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_017378035.1|1644724_1646836_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209732.1|1646851_1647325_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_016209765.1|1647429_1647804_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_017378036.1|1647965_1652174_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_017378037.1|1652237_1656314_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
>prophage 41
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1671579	1674741	3192856		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_017378059.1|1671579_1672722_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.5	2.7e-31
WP_017378060.1|1672806_1674741_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.6	6.3e-150
>prophage 42
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1681737	1744623	3192856	transposase,tRNA,protease	Staphylococcus_phage(33.33%)	65	NA	NA
WP_017378070.1|1681737_1682211_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.9e-28
WP_036771446.1|1682401_1683295_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_017378072.1|1683304_1684123_-	hypothetical protein	NA	M1HWP4	Paramecium_bursaria_Chlorella_virus	28.5	1.3e-16
WP_017378073.1|1684216_1685158_-	glutaminase A	NA	NA	NA	NA	NA
WP_017378074.1|1685288_1686242_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_027242674.1|1686245_1686683_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_027242675.1|1686702_1687602_+	DUF1853 family protein	NA	NA	NA	NA	NA
WP_075275368.1|1688209_1688563_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_026063702.1|1688629_1689427_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_017378078.1|1689474_1689834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1690008_1690983_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378082.1|1691804_1692158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378083.1|1692187_1692766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242676.1|1692883_1693645_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048875857.1|1693883_1694858_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378088.1|1694961_1695318_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_017378089.1|1695307_1696024_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017378090.1|1696031_1696517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929647.1|1696625_1696907_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	39.2	9.1e-10
WP_017378092.1|1697780_1698245_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_027242677.1|1698318_1698663_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_047927317.1|1698746_1701086_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_017378095.1|1701254_1702664_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.0	7.6e-28
WP_047927315.1|1702660_1703158_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	33.6	1.1e-13
WP_017378097.1|1703354_1704533_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_017378098.1|1704616_1705369_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_017378099.1|1705476_1705992_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_017378100.1|1706122_1706533_+	phasin family protein	NA	NA	NA	NA	NA
WP_027242678.1|1706672_1707020_+	phasin family protein	NA	NA	NA	NA	NA
WP_017378103.1|1707085_1708153_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017378104.1|1708146_1708665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378105.1|1708760_1710932_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016209298.1|1710999_1711266_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_017378106.1|1711329_1712274_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|1712273_1712627_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|1712675_1715351_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|1715367_1716885_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|1716961_1717414_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|1717632_1719072_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|1719071_1720610_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|1720624_1722595_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|1722598_1722904_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|1722927_1723551_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|1723570_1724059_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|1724072_1725098_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|1725102_1727496_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|1727545_1728835_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|1728841_1729342_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|1729341_1730595_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|1730596_1731274_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|1731291_1731777_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|1731767_1732136_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|1732814_1733177_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|1733190_1733952_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|1734253_1735600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|1735696_1736239_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|1736354_1737188_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|1737209_1737803_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|1737978_1738998_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|1739268_1739670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|1739680_1740004_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|1740027_1741038_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|1741104_1741953_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|1742069_1742981_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|1743747_1744623_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 43
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1750702	1800881	3192856	transposase	Erwinia_phage(16.67%)	43	NA	NA
WP_036773116.1|1750702_1751677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|1751735_1752788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|1753106_1754072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|1754374_1755199_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|1755400_1756477_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|1756561_1757548_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|1757566_1758211_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|1758222_1759332_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|1759398_1760061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|1760320_1762204_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|1762517_1764017_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|1764107_1764890_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|1765017_1765938_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|1765961_1766420_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|1766541_1767417_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|1767450_1768716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1768903_1769779_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|1769977_1770169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|1770373_1771669_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|1771988_1772207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|1772243_1773623_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|1773650_1774109_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|1774086_1775304_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|1775496_1775733_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|1775746_1775902_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|1775982_1776945_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|1777104_1778421_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|1778430_1779099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|1779509_1781324_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|1782039_1782225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|1782406_1782865_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1783583_1784459_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|1784690_1785089_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|1785092_1785335_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|1786224_1787976_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|1787986_1788787_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|1788889_1789378_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|1789877_1790801_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|1790897_1791242_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|1796936_1797899_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|1797937_1798813_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|1799072_1800332_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|1800554_1800881_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
>prophage 44
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1821201	1822176	3192856	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771330.1|1821201_1822176_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 45
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1828733	1829690	3192856		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017377563.1|1828733_1829690_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
>prophage 46
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1843387	1845632	3192856	tRNA	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage(50.0%)	2	NA	NA
WP_017377407.1|1843387_1843909_-	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377406.1|1844234_1845632_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
>prophage 47
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1855170	1915815	3192856	transposase,tRNA	Acinetobacter_phage(33.33%)	57	NA	NA
WP_075278722.1|1855170_1856046_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|1856570_1857167_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|1857437_1858016_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|1862538_1864044_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|1864071_1864353_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|1864501_1864843_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|1864963_1866868_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|1867000_1868572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278723.1|1868589_1869801_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|1869922_1870921_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|1870924_1871683_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|1871684_1872884_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|1872867_1873539_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|1873560_1874337_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|1874340_1875339_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|1875340_1875919_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|1875915_1877385_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|1877428_1877716_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|1877916_1878837_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|1878952_1879507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|1879622_1880048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|1880318_1880669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|1880862_1881402_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|1881486_1882023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|1882682_1882985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|1883433_1884003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|1884071_1884416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|1884594_1885569_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|1885835_1886009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1886114_1887518_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|1887522_1888542_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|1889158_1889488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|1889713_1890112_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|1890979_1891930_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|1891929_1894008_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|1894149_1894665_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|1894673_1895237_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|1895217_1895964_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|1896102_1896555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|1896690_1897527_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|1897523_1898420_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|1898452_1899520_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|1899538_1899907_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|1899932_1901384_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|1901390_1902770_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|1902810_1904124_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|1904113_1905088_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|1905181_1905685_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|1905819_1906971_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|1906967_1907447_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|1907593_1909915_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|1909859_1910486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|1910490_1911390_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|1911570_1912125_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1912164_1913139_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|1913728_1914106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1914840_1915815_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 48
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1926008	1927316	3192856		Moraxella_phage(100.0%)	1	NA	NA
WP_027242742.1|1926008_1927316_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
>prophage 49
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1935405	1938099	3192856		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_027242743.1|1935405_1938099_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
>prophage 50
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1948727	1949861	3192856		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_017378449.1|1948727_1949861_-	hypothetical protein	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	3.1e-40
>prophage 51
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1972884	1977565	3192856		Bacillus_virus(50.0%)	3	NA	NA
WP_017378470.1|1972884_1975296_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.1e-110
WP_027242745.1|1975326_1976424_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_017378473.1|1976458_1977565_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.0	7.5e-47
>prophage 52
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	1982207	2101167	3192856	transposase,tRNA,protease	Escherichia_phage(18.18%)	109	NA	NA
WP_017378478.1|1982207_1983587_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|1983701_1985594_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|1985641_1986268_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|1986287_1987172_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|1987204_1988095_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|1988209_1988608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|1988612_1989428_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|1989479_1989884_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|1989938_1990409_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|1990420_1990948_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|1990964_1992506_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|1992531_1993392_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|1993422_1994814_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|1994838_1995267_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|1995360_1996725_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|1996781_1998617_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|1998730_1999459_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|1999985_2001527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|2001793_2002450_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|2003147_2003807_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|2003951_2004209_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|2004321_2005074_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|2005132_2005846_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|2006037_2006670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2008404_2009808_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|2009804_2010029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2010108_2011083_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|2011102_2011420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|2011497_2011710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|2011956_2012376_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|2012473_2012920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|2013264_2014263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|2014295_2014649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|2014693_2014966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|2015362_2016781_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|2017007_2017949_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|2017983_2019963_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|2019959_2020565_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|2020566_2020908_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|2020908_2021745_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|2021910_2022228_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|2022305_2023727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|2023723_2024419_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|2025605_2026451_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|2026460_2026799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|2027367_2028771_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|2028803_2029748_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|2029952_2030126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|2030733_2031783_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2031937_2032156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2032475_2033879_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|2033889_2034447_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|2034443_2035319_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|2035543_2035834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|2038457_2039231_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|2039649_2040006_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|2040037_2040490_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243065.1|2040642_2043705_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_017376261.1|2043701_2044766_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376260.1|2045129_2046083_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376259.1|2046115_2047279_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376258.1|2047284_2047884_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376257.1|2048071_2048572_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376256.1|2048589_2049678_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376255.1|2049816_2051061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|2051057_2051900_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376253.1|2051879_2052689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420746.1|2052875_2053091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376251.1|2053091_2054054_+	TonB family protein	NA	NA	NA	NA	NA
WP_017376250.1|2054109_2054661_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376249.1|2054790_2055213_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376248.1|2055205_2055967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376247.1|2056021_2056720_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_026063518.1|2056706_2057555_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376244.1|2058172_2058697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376243.1|2058829_2060044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376242.1|2060358_2061420_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376241.1|2061433_2063161_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027243064.1|2063194_2063926_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027243063.1|2063925_2064714_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243062.1|2064818_2065442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376237.1|2066773_2067526_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027242703.1|2073205_2073829_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376193.1|2073868_2074354_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017376192.1|2074400_2075546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653742.1|2075547_2077818_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_036771610.1|2077819_2078680_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_017376188.1|2078676_2079549_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_017376187.1|2079545_2080553_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376186.1|2080572_2080980_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_065653741.1|2081008_2082397_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_027242702.1|2082393_2083566_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_017376183.1|2083597_2084449_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242701.1|2084458_2085622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242700.1|2085618_2086626_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242699.1|2086622_2087759_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017376177.1|2087755_2088682_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_017376176.1|2088776_2090177_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_144420747.1|2090464_2091853_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_036771589.1|2091934_2092762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771607.1|2092980_2093985_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|2094038_2094269_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771588.1|2094276_2095155_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_017376171.1|2095291_2096266_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376170.1|2096623_2097724_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376169.1|2097789_2098500_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036771603.1|2098549_2099791_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016209598.1|2099857_2100442_+	YggT family protein	NA	NA	NA	NA	NA
WP_144420748.1|2100531_2101167_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A0N9R3I3	Chrysochromulina_ericina_virus	28.9	6.9e-05
>prophage 53
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2109307	2113686	3192856		Burkholderia_virus(50.0%)	3	NA	NA
WP_017376155.1|2109307_2110210_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.7	4.5e-18
WP_058893787.1|2110233_2111118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376152.1|2111676_2113686_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	8.6e-110
>prophage 54
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2116939	2124470	3192856		Staphylococcus_phage(50.0%)	4	NA	NA
WP_017376147.1|2116939_2118460_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	3.2e-32
WP_047927418.1|2119450_2120770_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017376145.1|2120873_2121257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278724.1|2121404_2124470_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.8	7.1e-55
>prophage 55
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2135986	2136244	3192856		Rhizobium_phage(100.0%)	1	NA	NA
WP_017376129.1|2135986_2136244_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	42.1	1.2e-11
>prophage 56
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2142092	2144285	3192856		Bacillus_phage(100.0%)	1	NA	NA
WP_017376121.1|2142092_2144285_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.9	1.7e-106
>prophage 57
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2170717	2306144	3192856	transposase,tRNA,protease,tail	Acinetobacter_phage(10.53%)	115	NA	NA
WP_017377604.1|2170717_2172700_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|2172909_2174253_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|2174519_2177189_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|2177212_2179129_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|2179298_2180720_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|2180864_2181839_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|2181848_2182148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|2182265_2182487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|2182650_2184312_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|2184384_2184675_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|2184901_2185357_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|2185421_2185886_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|2185977_2187324_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|2187323_2188229_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|2188290_2189277_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2189269_2189512_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|2189630_2191175_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|2191221_2192508_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|2192550_2193954_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|2193958_2196496_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|2196892_2197141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|2197072_2197534_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|2198028_2198724_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|2198825_2200388_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|2200715_2202509_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|2202595_2202868_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|2202873_2203500_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|2203486_2204917_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|2205238_2206294_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|2206262_2206940_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|2206929_2207778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|2207923_2208217_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|2208328_2209141_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|2209439_2210294_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|2210447_2211497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|2211542_2212199_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|2212216_2213497_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|2213770_2215132_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|2215192_2215744_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|2221174_2222446_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|2222502_2223486_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|2223482_2224268_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|2224575_2225025_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2225118_2226522_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|2226959_2228441_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|2228496_2229606_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|2231178_2231391_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|2231431_2232127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075316668.1|2232390_2234577_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|2234779_2235346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|2235503_2236064_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|2236183_2237587_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|2237583_2237940_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|2238195_2239020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|2239717_2240242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2240527_2241502_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|2241601_2242153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2242265_2242919_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|2243170_2244628_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|2244741_2245221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2245458_2246064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|2246343_2247459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2247397_2248084_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|2248077_2249055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2249089_2250253_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|2250592_2250817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2251199_2251487_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|2251661_2252417_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2252449_2252881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|2252856_2253333_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|2253339_2254917_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|2254919_2255684_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|2255737_2256274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2256270_2257002_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|2257226_2257988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2258313_2259189_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|2260591_2260747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2260940_2262650_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|2263303_2263612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|2263629_2265822_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|2266629_2266878_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|2266990_2267224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|2267458_2267989_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|2267993_2268707_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|2269334_2270060_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|2270068_2272132_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|2272311_2272791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2273283_2274651_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|2275042_2275840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2275951_2277241_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|2277421_2278408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|2278524_2278704_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|2278715_2279147_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|2279359_2279719_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|2279888_2281514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2282237_2283665_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|2283958_2285140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|2287742_2289041_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|2289396_2290290_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|2290286_2290592_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|2290617_2291397_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|2291426_2291657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2291808_2292054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|2292240_2293032_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|2293731_2294454_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|2294450_2295332_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|2295355_2296846_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|2296935_2297823_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|2298495_2298987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2298991_2299219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2299311_2300286_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|2300262_2301501_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243188.1|2301983_2302529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375937.1|2302880_2303699_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_036772717.1|2303774_2306144_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
>prophage 58
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2309467	2365770	3192856	transposase	Staphylococcus_phage(50.0%)	51	NA	NA
WP_053856767.1|2309467_2310871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2310976_2311162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2311860_2313264_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|2313354_2313858_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2313897_2314872_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|2314868_2315438_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|2315924_2316617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|2317224_2318217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|2318206_2319979_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|2319979_2320168_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|2320205_2321180_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|2321238_2321433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2321499_2321727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2321856_2322732_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2322959_2323109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|2323100_2323367_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|2323511_2324411_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2324497_2324755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2325367_2326594_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|2326683_2327223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|2327344_2327983_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|2328016_2328505_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|2328751_2329054_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|2329034_2329523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2330093_2331392_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|2331508_2331799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2331837_2334492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|2335205_2335460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|2335769_2336498_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|2337268_2338453_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|2338471_2339416_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|2339721_2340507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|2340620_2340989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|2341217_2342795_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|2343578_2348003_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|2348139_2349663_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|2349867_2350095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|2350239_2350497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2351064_2352036_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|2351960_2352269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|2352332_2352554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2352673_2353648_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|2353701_2354673_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2354752_2355727_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|2356087_2358757_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|2358927_2359809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|2359819_2360476_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|2360542_2361247_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|2361477_2362881_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378310.1|2362911_2363841_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027242738.1|2364075_2365770_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
>prophage 59
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2401375	2404081	3192856	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017378343.1|2401375_2402950_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_048875857.1|2403106_2404081_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 60
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2414383	2414932	3192856		Klosneuvirus(100.0%)	1	NA	NA
WP_017378355.1|2414383_2414932_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.9	5.9e-29
>prophage 61
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2418206	2542250	3192856	transposase,tRNA	Staphylococcus_phage(24.14%)	106	NA	NA
WP_017378360.1|2418206_2419775_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	6.7e-09
WP_048875895.1|2419866_2421030_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|2421083_2422085_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|2422166_2422736_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|2422949_2423921_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|2423932_2425528_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|2425548_2426580_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|2426911_2428015_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|2428126_2429311_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|2429388_2431377_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|2432536_2433910_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|2433927_2434914_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|2434916_2436071_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|2436067_2436763_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|2436905_2438396_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|2438416_2439466_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|2439532_2440927_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|2441859_2443791_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|2443795_2444326_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|2444360_2444555_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|2444597_2444957_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|2445088_2446084_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|2446096_2448478_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|2448483_2448771_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|2449037_2449244_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|2450852_2451626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|2451627_2452569_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|2452702_2454280_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|2454473_2454872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|2455872_2456079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|2456883_2457528_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|2457595_2458852_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|2459107_2459287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2459509_2459737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|2461012_2461771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|2461988_2462552_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|2462655_2463204_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|2463800_2464953_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|2465298_2465595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2465854_2466766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2467000_2467540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|2468702_2468840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2469086_2469815_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|2469861_2470470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|2471744_2472005_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|2472178_2473717_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|2473895_2474822_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|2474926_2475859_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|2476355_2479169_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|2479161_2479671_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|2479674_2480118_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|2480213_2481515_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|2481777_2482146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|2482137_2482860_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_144420610.1|2483894_2485274_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_144420611.1|2485306_2485507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2486041_2487016_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|2487426_2487756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|2488141_2488507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|2488630_2489491_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2489477_2490257_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|2490332_2491016_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|2491176_2491782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|2491998_2492502_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|2492703_2492958_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|2493459_2493927_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|2494493_2495684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2496518_2497922_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|2498228_2498849_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|2499028_2500003_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|2500168_2500435_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|2500431_2500932_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|2501052_2501928_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|2503587_2504118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|2504117_2504642_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|2504804_2505920_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|2506156_2507317_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|2507768_2509772_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|2509840_2510848_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|2510921_2512106_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|2512115_2513570_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|2513600_2514638_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|2514960_2515251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2516605_2517580_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046691.1|2517779_2518376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2518899_2519151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|2519355_2520519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|2520541_2521231_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|2521378_2522029_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|2522129_2522789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2524850_2525612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2526030_2526291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2526376_2527039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2527155_2528283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2528658_2528820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|2530951_2531323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2531602_2532844_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|2532981_2533212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|2533345_2534230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|2534258_2534885_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|2534915_2536115_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|2536353_2537451_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|2537604_2539143_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|2539463_2539799_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|2540611_2540905_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|2541275_2542250_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 62
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2546930	2547563	3192856		Indivirus(100.0%)	1	NA	NA
WP_016210817.1|2546930_2547563_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
>prophage 63
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2552077	2660504	3192856	transposase,tRNA	Bacillus_phage(16.13%)	112	NA	NA
WP_017377787.1|2552077_2552305_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|2552561_2553536_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048875941.1|2553959_2554271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2554267_2555350_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|2555383_2556172_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|2556302_2556998_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|2557502_2558009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|2558102_2558660_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|2558957_2560307_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2560393_2560651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2560718_2561429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|2561573_2561753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2562276_2563536_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|2563668_2564142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|2564150_2565533_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|2565525_2566140_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|2566219_2566936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|2567110_2569435_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|2569601_2570576_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376573.1|2571505_2573248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|2573419_2574511_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|2574543_2575182_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|2575220_2575493_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|2575591_2575834_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|2575851_2576154_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|2576237_2576780_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|2576940_2577567_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|2577572_2578412_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|2578401_2579052_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|2579055_2579889_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|2579978_2581106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2581372_2581525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2581632_2581827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|2582019_2582670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|2582924_2584016_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|2584012_2585377_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|2585501_2586698_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|2586754_2587318_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|2588250_2588919_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|2589065_2590367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|2591857_2592262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|2592495_2593578_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|2593562_2594183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2594247_2595123_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|2595200_2595776_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|2596584_2596878_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|2596994_2597144_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2598472_2599447_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|2599545_2599701_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|2599619_2599880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|2600056_2600584_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|2600838_2601063_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|2601207_2602029_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|2601986_2602280_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|2603756_2604044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2604536_2605307_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2605376_2606789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2607155_2608526_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|2608522_2608687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|2608746_2609034_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|2610065_2610656_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|2610782_2612168_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|2612265_2612463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|2612555_2613389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2613926_2614280_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|2614292_2614529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|2614528_2614735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|2614896_2615616_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|2615704_2617489_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|2617795_2617951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|2617877_2618132_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2618277_2619099_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|2619281_2619506_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2619611_2621015_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|2621579_2621768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|2621897_2622164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|2622549_2624190_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|2624302_2625652_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|2625648_2626518_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|2627442_2628756_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|2628752_2629523_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|2629519_2629747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046617.1|2630451_2630592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046616.1|2630736_2631900_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
WP_069971647.1|2631868_2632465_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2633433_2633661_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|2634628_2635033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2635036_2636032_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|2636017_2637220_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|2637146_2637761_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|2638457_2638619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|2638898_2639444_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|2639477_2640143_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|2640202_2641159_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|2641437_2642115_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|2642157_2642739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2642883_2643555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|2644157_2644745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2645713_2645941_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|2645913_2646309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|2646737_2647553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|2647643_2648630_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|2648799_2649321_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|2649354_2649606_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|2649616_2650894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|2651585_2652113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|2652229_2654542_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|2654670_2655486_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|2655742_2656207_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|2657623_2657851_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|2657985_2659449_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|2659451_2660504_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
>prophage 64
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2665206	2872121	3192856	integrase,transposase,tRNA,protease	Staphylococcus_phage(20.0%)	169	2849874:2849933	2866031:2866527
WP_048875919.1|2665206_2665524_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|2665541_2665754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2666707_2666935_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|2668092_2668854_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|2671044_2672019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|2672143_2673580_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|2673659_2675120_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|2675240_2675528_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|2675725_2676769_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|2676784_2677684_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|2677680_2678199_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|2678268_2678886_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|2678895_2680383_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|2680392_2684073_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|2684146_2684956_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|2684955_2685636_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|2686260_2687235_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2687277_2688273_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2688325_2689300_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|2689612_2690497_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|2690627_2691449_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2691450_2692488_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|2692491_2695149_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|2695226_2696036_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|2696442_2697210_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|2697374_2698253_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|2698256_2698994_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|2698997_2699555_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|2699562_2700309_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_080963646.1|2700223_2701123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2701211_2702087_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|2702183_2703761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242905.1|2703969_2704158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|2704205_2706116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|2706652_2707192_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|2707188_2708217_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|2708206_2709271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069468.1|2709258_2711472_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|2711473_2712541_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|2712825_2715243_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|2715323_2715857_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|2715967_2717017_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2717034_2717481_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|2717480_2718254_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|2718272_2719427_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|2719640_2720210_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|2720233_2723740_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|2723817_2724777_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|2724751_2726212_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|2726247_2727777_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|2727810_2729214_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2731125_2732940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2733024_2734428_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2734573_2735977_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2736461_2737436_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|2737904_2738795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|2739455_2740292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|2740580_2743253_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|2743501_2744692_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|2745024_2745219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|2745155_2746808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2747408_2748635_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|2749030_2749576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|2749535_2749913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2749909_2751313_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|2751531_2751957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|2752008_2753496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|2753805_2754345_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2754634_2754862_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|2756107_2756683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|2756796_2758200_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|2758196_2758487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|2758854_2759268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|2759956_2761744_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|2761910_2762531_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|2762877_2763018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|2763037_2765014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|2765386_2766844_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|2766912_2768493_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|2769133_2773030_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|2773036_2773360_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|2773433_2773907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|2773938_2774934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|2775185_2776823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|2777182_2778130_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|2778448_2778793_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|2778886_2779558_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|2779598_2780426_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|2780512_2781040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|2781925_2782345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|2782454_2783036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|2783390_2784671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|2784791_2785655_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|2785743_2786538_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|2786775_2787762_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|2787767_2789294_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|2789389_2790634_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|2790687_2792067_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|2792184_2792970_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|2793312_2793957_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|2793991_2795797_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2795820_2796396_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|2797445_2798420_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155082198.1|2798709_2798892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2800955_2801633_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|2803131_2803353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2804233_2804395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2804331_2804832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2804927_2805356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2805615_2806065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|2806117_2806552_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2806528_2807494_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|2807712_2807973_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|2808067_2808802_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|2808830_2808983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2809187_2810132_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|2810117_2810546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2810690_2810942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|2811329_2812238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|2812701_2813667_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|2813711_2814287_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|2814317_2815592_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|2816240_2816957_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|2817035_2817773_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|2817893_2819249_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|2819428_2820100_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|2820215_2821091_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|2821691_2822996_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2823108_2823714_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|2823795_2825097_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|2825164_2827597_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|2827700_2827973_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|2828055_2829954_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|2829985_2830870_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|2830878_2831274_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|2831697_2833845_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|2833816_2835166_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|2835162_2837283_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|2837279_2838983_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|2839117_2840260_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|2840316_2841345_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|2841471_2842986_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|2843092_2843293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|2843437_2843773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|2843917_2844154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|2844424_2845303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|2845939_2846884_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|2847157_2848561_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2848565_2849351_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|2849741_2850584_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
2849874:2849933	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|2850580_2850877_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|2852358_2852970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|2853038_2853845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2854148_2855123_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|2855294_2857187_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|2857759_2860075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2860489_2861893_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2862333_2862813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|2862880_2864137_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|2864283_2864808_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|2865212_2865353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2865550_2866255_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|2867109_2867421_-	hypothetical protein	NA	NA	NA	NA	NA
2866031:2866527	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|2867484_2867664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2868226_2868409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2868472_2868700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|2868907_2869672_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|2869898_2870192_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|2870717_2872121_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 65
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	2876792	3019431	3192856	transposase,tRNA,protease	Staphylococcus_phage(17.86%)	118	NA	NA
WP_036774028.1|2876792_2878526_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|2878597_2880304_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|2880295_2881354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2881607_2882456_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|2883050_2883497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|2884186_2885599_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|2885990_2887433_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|2887564_2887633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|2887831_2889163_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2889267_2890242_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|2890291_2890996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2891436_2892249_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|2892307_2894818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2895163_2896339_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|2897686_2897911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|2897939_2899103_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|2901345_2902491_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|2903083_2904019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|2905516_2905828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2905824_2906907_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|2907222_2907429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|2907526_2908057_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|2908344_2909523_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|2909671_2913436_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|2913494_2914997_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|2915548_2916184_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|2916681_2917929_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|2918151_2919588_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2919763_2920981_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|2921442_2922222_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2923228_2924203_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|2925248_2925560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2925556_2926639_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|2926949_2927156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|2928876_2930238_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|2930348_2930720_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|2930942_2931593_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|2931635_2932718_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|2933444_2934419_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|2935289_2935517_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|2937697_2939251_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|2940039_2940276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2940395_2941439_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2941685_2942087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|2942260_2943160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2943554_2944766_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|2944776_2945001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|2945322_2945487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2945579_2946983_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|2947149_2947458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|2947742_2947913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|2948541_2949591_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|2949659_2950682_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|2950727_2951642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2952610_2952838_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|2952794_2953664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|2955101_2955818_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|2956262_2958134_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|2958225_2959971_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|2960050_2960500_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|2960552_2960768_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|2961014_2962031_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|2962079_2962709_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|2963049_2964261_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|2964293_2964644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2964609_2965290_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2965566_2965986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|2966131_2966968_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2967011_2967986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|2968005_2968641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|2968884_2969886_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|2969984_2971193_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|2971182_2972913_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|2973096_2974233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|2974977_2975613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|2975727_2977062_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|2977190_2977832_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|2978137_2978560_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|2978837_2979800_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|2979838_2981014_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|2981102_2982803_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|2982802_2984341_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|2984380_2986033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|2986106_2986862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2987048_2987924_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|2988188_2988383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2988527_2989001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|2989270_2989444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2989648_2990962_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|2990958_2991603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2992121_2993309_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|2993441_2994131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|2994204_2995554_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|2995657_2997838_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|2997907_2998783_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|2998829_2999126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|2999249_2999657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|2999636_3000215_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|3000637_3001300_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|3001330_3001699_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|3001709_3003026_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|3003272_3003884_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|3003959_3004139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|3004309_3004603_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|3004843_3005146_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|3005200_3007474_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|3007533_3007779_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|3007903_3008659_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|3008767_3009742_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|3009949_3010711_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|3010694_3011651_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|3011913_3014412_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|3014415_3015156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|3015605_3016400_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|3016562_3017351_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|3017347_3018559_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|3018551_3018908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|3019002_3019431_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
>prophage 66
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	3022920	3081682	3192856	transposase,tRNA	unidentified_phage(18.18%)	56	NA	NA
WP_017376088.1|3022920_3024198_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|3024209_3024941_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|3024912_3026169_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|3026278_3027682_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|3027834_3028005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|3029410_3030241_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|3030468_3030618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|3030812_3031634_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|3031630_3032524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|3032569_3033091_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|3033168_3033654_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|3033787_3034444_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|3034440_3034749_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|3035097_3036069_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|3036373_3037165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|3037154_3038018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|3038044_3038464_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|3038516_3039473_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|3039955_3042628_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|3042708_3043335_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|3043491_3045090_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|3045179_3046601_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|3046631_3047153_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|3047149_3047755_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|3047831_3048842_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|3048954_3049659_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|3049693_3050125_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|3050127_3051222_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|3051281_3052634_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|3052669_3053311_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|3053383_3054283_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|3054285_3054933_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|3054983_3055787_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|3055968_3056184_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|3056187_3056421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|3056482_3058075_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|3058277_3059207_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|3059208_3059976_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|3060341_3061112_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|3061170_3062145_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|3062252_3062615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|3062784_3064494_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|3064734_3066138_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|3066189_3066447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|3067195_3068503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|3068962_3069340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|3069484_3069886_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|3070450_3071230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|3071297_3071438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|3071638_3071836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|3071973_3072573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|3072755_3074228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|3074630_3076376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|3076811_3077672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|3078189_3080133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|3080278_3081682_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 67
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	3087925	3133608	3192856	transposase,protease	Burkholderia_virus(25.0%)	37	NA	NA
WP_036773465.1|3087925_3089965_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|3089980_3091036_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|3091046_3091577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|3093734_3094655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|3094799_3094940_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|3095828_3096212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|3096221_3096581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|3097515_3097662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|3097900_3099157_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|3099412_3099592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|3099911_3100565_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|3100769_3101096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|3101867_3103271_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|3103441_3104812_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|3104858_3105758_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|3105738_3108543_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|3108622_3109219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|3109632_3110388_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|3110477_3110705_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|3111821_3112463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|3112732_3114058_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|3114054_3116112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|3116089_3116662_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|3116744_3117077_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|3117141_3118176_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|3118163_3119285_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|3119378_3120362_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|3120518_3122186_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|3122472_3123324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|3123732_3126201_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|3126214_3127189_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|3127175_3128444_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|3128477_3130226_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|3130405_3130609_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|3130827_3131505_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|3131784_3132042_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_017377788.1|3132489_3133608_+	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
>prophage 68
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	3155770	3160793	3192856		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_017377423.1|3155770_3157453_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_026063633.1|3157604_3157880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963565.1|3158024_3158522_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377424.1|3158915_3159899_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_017377425.1|3159891_3160113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377426.1|3160151_3160793_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
>prophage 69
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	3173185	3174160	3192856	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771332.1|3173185_3174160_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
>prophage 70
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	3178297	3179272	3192856	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036773116.1|3178297_3179272_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 71
NZ_CP013806	Piscirickettsia salmonis strain PM31429B, complete genome	3192856	3183703	3188612	3192856	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_017376399.1|3183703_3186475_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|3186543_3186987_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|3187139_3188612_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
>prophage 1
NZ_CP013807	Piscirickettsia salmonis strain PM31429B plasmid p1PS12, complete sequence	181234	1105	54774	181234	terminase,portal,transposase	Salmonella_phage(30.43%)	57	NA	NA
WP_036774350.1|1105_1834_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|2316_3339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876196.1|5152_6301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|6330_7308_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|7223_7613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|8408_9923_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|9909_10887_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|11044_11257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|12257_13235_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|13150_13540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|14335_15850_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|15836_16814_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|16971_17184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|18184_19162_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243212.1|19656_19944_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|19933_20188_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|20405_20567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|20581_21559_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|22039_23017_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|23482_24463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|24694_25204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|25243_25606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|25919_26894_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|26987_27716_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243190.1|27896_31241_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|31244_31430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|32808_33522_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|33568_34303_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|34340_34727_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|34813_35248_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|35452_36784_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_081377963.1|36786_37269_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	4.7e-14
WP_027242929.1|37355_37739_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_017375952.1|37934_38138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242930.1|38327_39710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242931.1|39855_40263_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|40271_40499_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_026063496.1|40631_40997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081078123.1|41875_42238_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|42267_42420_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|42557_42791_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|43092_44136_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|44243_44651_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|44954_45950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|46220_46646_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_155048090.1|46596_47115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375966.1|47259_47826_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_048876207.1|47826_49302_+	response regulator	NA	NA	NA	NA	NA
WP_144420845.1|49807_50038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|50165_50618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|50614_50833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|51139_51349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375972.1|51793_52102_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242938.1|52103_52472_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048876229.1|52885_53857_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|53775_53976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771279.1|54045_54774_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 2
NZ_CP013807	Piscirickettsia salmonis strain PM31429B plasmid p1PS12, complete sequence	181234	60431	120560	181234	transposase	Streptococcus_phage(52.17%)	59	NA	NA
WP_048876208.1|60431_61259_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_048876229.1|62123_63095_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|63664_64393_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|64468_64741_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|64744_65005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046631.1|67636_68287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|68361_69339_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|69466_70195_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|70377_71664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|71684_71849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082884401.1|72265_72388_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|72485_73214_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772437.1|73635_75534_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|75829_76096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|76641_77370_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|77410_77581_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|77656_78634_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|78715_79399_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|79426_79579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|79980_81720_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|81722_82085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|83034_83721_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|84066_84687_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|84665_85394_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|85481_85868_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|85864_86110_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275474.1|86451_87564_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|88532_88751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|88795_89200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|89213_89552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|89544_89769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|90140_90749_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|90751_91480_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_051929563.1|91502_91892_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_036772541.1|91921_92650_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|92661_93366_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_144420840.1|93748_94180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|94210_95089_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|95042_95750_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|95866_96043_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|97281_98172_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243190.1|98480_101825_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|102407_103136_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377521.1|104063_104417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|104925_105654_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_155046640.1|105622_105790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275471.1|106425_107400_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_017377525.1|107940_108738_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_017377526.1|109318_110179_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243210.1|110508_111243_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_047927763.1|111656_111920_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|111916_112315_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|112558_113014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|114914_115172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|115316_115487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|116156_117083_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|117278_118007_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|119155_119776_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|119831_120560_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 3
NZ_CP013807	Piscirickettsia salmonis strain PM31429B plasmid p1PS12, complete sequence	181234	150542	160957	181234	transposase	Streptococcus_phage(62.5%)	10	NA	NA
WP_036772541.1|150542_151271_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|151422_152106_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|152110_152680_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|152850_153579_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|154062_154791_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|154843_155239_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|155532_156261_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|156418_159760_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|159823_160063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|160228_160957_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 4
NZ_CP013807	Piscirickettsia salmonis strain PM31429B plasmid p1PS12, complete sequence	181234	174607	181105	181234	portal,transposase	Burkholderia_virus(16.67%)	8	NA	NA
WP_082300723.1|174607_174835_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|175567_176059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|176140_176869_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|177212_177359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|177664_179530_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|179602_179869_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|180049_180391_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|180571_181105_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
>prophage 1
NZ_CP013808	Piscirickettsia salmonis strain PM31429B plasmid p2PS12, complete sequence	50691	0	2996	50691	capsid,tail,transposase,head	Shigella_phage(33.33%)	4	NA	NA
WP_017375778.1|138_450_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|834_1419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|1432_1972_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|2021_2996_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 2
NZ_CP013808	Piscirickettsia salmonis strain PM31429B plasmid p2PS12, complete sequence	50691	6446	10086	50691	transposase	unidentified_phage(50.0%)	5	NA	NA
WP_036771330.1|6446_7421_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|7708_8026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|8009_8711_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|8734_8968_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|9111_10086_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
>prophage 3
NZ_CP013808	Piscirickettsia salmonis strain PM31429B plasmid p2PS12, complete sequence	50691	19121	23078	50691	transposase	Brucella_phage(33.33%)	5	NA	NA
WP_017377663.1|19121_19451_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
WP_017377662.1|19461_19776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275453.1|19863_20838_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	2.9e-26
WP_048876255.1|21080_22082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|22100_23078_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 4
NZ_CP013808	Piscirickettsia salmonis strain PM31429B plasmid p2PS12, complete sequence	50691	26548	50229	50691	transposase,tail	unidentified_phage(23.08%)	25	NA	NA
WP_048876253.1|26548_27205_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|27201_28176_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_032126138.1|28617_28881_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|29308_30283_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_087910671.1|30670_31135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|31228_31414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|32369_33344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036816420.1|33747_34380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929651.1|34383_35436_-	ParA family protein	NA	NA	NA	NA	NA
WP_036771347.1|35597_36575_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375933.1|36974_37967_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	5.0e-10
WP_036771355.1|37983_39420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|39891_40869_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|40896_41325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|41383_44074_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|44070_44628_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|44617_45403_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|45332_46004_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|46000_46342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|46334_48413_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|48416_48683_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|48739_49063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|49064_49487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|49486_49837_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|49833_50229_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
>prophage 1
NZ_CP013809	Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence	57428	0	9028	57428	transposase	Shewanella_sp._phage(25.0%)	10	NA	NA
WP_155764742.1|128_284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1276_1534_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1533_2541_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046643.1|2588_2741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046642.1|2973_3465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|3492_5355_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_144420830.1|5460_5766_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242583.1|6122_6434_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_027242582.1|6430_6832_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242581.1|6841_9028_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
>prophage 2
NZ_CP013809	Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence	57428	41860	47788	57428		Choristoneura_rosaceana_entomopoxvirus(25.0%)	6	NA	NA
WP_053063426.1|41860_42646_+	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927059.1|42621_43323_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036775038.1|43308_44049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242605.1|44343_45639_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.8e-12
WP_036774869.1|46082_46931_-	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_047927060.1|46927_47788_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
>prophage 3
NZ_CP013809	Piscirickettsia salmonis strain PM31429B plasmid p3PS12, complete sequence	57428	53493	54084	57428	integrase	Caulobacter_virus(100.0%)	1	51774:51804	56096:56126
51774:51804	attL	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_027242600.1|53493_54084_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_027242600.1|53493_54084_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
56096:56126	attR	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
>prophage 1
NZ_CP013810	Piscirickettsia salmonis strain PM31429B plasmid p4PS12, complete sequence	33559	0	16250	33559	terminase,capsid,transposase,integrase	unidentified_phage(27.27%)	18	1:60	22836:23592
1:60	attL	GTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTAT	NA	NA	NA	NA
WP_027242946.1|1101_1683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|1718_2111_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242948.1|3205_3391_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|3393_3876_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|3962_4346_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|4558_5425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|6050_7025_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|7122_7479_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|7462_7717_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|7861_8227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|8759_9734_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|9910_10264_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|10256_10517_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|10747_11338_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|11403_11760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|11873_12848_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016211499.1|14273_15257_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027242956.1|15272_16250_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	32.7	7.8e-16
22836:23592	attR	GTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP013810	Piscirickettsia salmonis strain PM31429B plasmid p4PS12, complete sequence	33559	20508	31352	33559	transposase,tail	unidentified_phage(50.0%)	12	NA	NA
WP_036771332.1|20508_21483_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
WP_144420852.1|22050_22191_-	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|22581_23556_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155046645.1|23575_23737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|23736_24390_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_048876242.1|24401_24779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|25263_26238_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027242942.1|26257_26935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365785.1|26934_27990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876241.1|28134_30111_-	host specificity protein J	NA	C7BGD4	Burkholderia_phage	37.8	3.7e-89
WP_027242943.1|30381_30798_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|30794_31352_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
