The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	3091	61662	3186151	tRNA,transposase	Escherichia_phage(28.57%)	57	NA	NA
WP_017378478.1|3091_4471_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|4585_6478_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|6525_7152_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|7171_8056_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|8088_8979_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|9093_9492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|9496_10312_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|10363_10768_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|10822_11293_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|11304_11832_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|11848_13390_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|13415_14276_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|14306_15698_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|15722_16151_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|16244_17609_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|17665_19501_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|19614_20343_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|20869_22411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|22677_23334_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|24031_24691_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|24835_25093_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|25205_25958_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|26016_26730_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|26921_27554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|29288_30692_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376720.1|30688_30949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|30992_31967_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|31986_32304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|32381_32594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|32840_33260_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|33357_33804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|34148_35147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|35179_35533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|35577_35850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|36246_37665_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|37891_38833_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|38867_40847_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|40843_41449_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|41450_41792_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|41792_42629_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|42794_43112_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|43189_44611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|44607_45303_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|46777_47623_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|47632_47971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|48539_49943_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|49975_50920_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|51124_51298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|51905_52955_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|53109_53328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|53647_55051_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|55061_55619_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|55615_56491_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|56715_57006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|59629_60403_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|60821_61178_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|61209_61662_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	191890	322698	3186151	tRNA,transposase,protease,tail	Acinetobacter_phage(11.11%)	112	NA	NA
WP_017377604.1|191890_193873_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|194082_195426_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|195692_198362_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|198385_200302_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|200471_201893_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|202037_203012_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|203021_203321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|203438_203660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|203823_205485_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|205557_205848_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|206074_206530_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|206594_207059_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|207150_208497_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|208496_209402_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|209463_210450_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|210442_210685_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|210803_212348_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|212394_213681_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|213723_215127_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|215131_217669_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|218065_218314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|218245_218707_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|219201_219897_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|219998_221561_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|221888_223682_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|223768_224041_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|224046_224673_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|224659_226090_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|226411_227467_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|227435_228113_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|228102_228951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|229096_229390_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|229501_230314_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|230612_231467_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|231620_232670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|232715_233372_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|233389_234670_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|234943_236305_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|236365_236917_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|242347_243619_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|243675_244659_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|244655_245441_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|245748_246198_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|246291_247695_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|248132_249614_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|249669_250779_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|252351_252564_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|252604_253300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275260.1|253563_255774_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|255976_256543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|256700_257261_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|257380_258784_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|258780_259137_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|259392_260217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|260914_261439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|261724_262699_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|262798_263350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|263462_264116_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|264367_265825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|265938_266418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|266655_267261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|267540_268656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|268594_269281_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|269274_270252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|270286_271450_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|271789_272014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|272396_272684_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|272858_273614_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|273646_274078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|274053_274530_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|274536_276114_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|276116_276881_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|276934_277471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|277467_278199_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|278423_279185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|279510_280386_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|281788_281944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|282137_283847_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|284500_284809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|284826_287019_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|287826_288075_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|288187_288421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|288655_289186_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|289190_289904_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|290531_291257_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|291265_293329_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|293508_293988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|294480_295848_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|296239_297037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|297148_298438_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|298618_299605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|299721_299901_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|299912_300344_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|300556_300916_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|301085_302711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|303434_304862_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|305155_306337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|308939_310238_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|310593_311487_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|311483_311789_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|311814_312594_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|312623_312854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|313005_313251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|313437_314229_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|314928_315651_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|315647_316529_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|316552_318043_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|318132_319020_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|319692_320184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|320188_320416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|320508_321483_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|321459_322698_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	330664	384078	3186151	transposase	Staphylococcus_phage(57.14%)	49	NA	NA
WP_053856767.1|330664_332068_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|332173_332359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|333057_334461_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|334551_335055_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|335094_336069_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|336065_336635_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|337121_337814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|338421_339414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|339403_341176_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|341176_341365_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|341402_342377_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|342435_342630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|342696_342924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|343053_343929_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|344156_344306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|344297_344564_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|344708_345608_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|345694_345952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|346564_347791_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|347880_348420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|348541_349180_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|349213_349702_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|349948_350251_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|350231_350720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|351290_352589_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|352705_352996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|353034_355689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|356402_356657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|356966_357695_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|358465_359650_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|359668_360613_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|360918_361704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|361817_362186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|362414_363992_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|364775_369200_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|369336_370860_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|371064_371292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|371436_371694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|372261_373233_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|373157_373466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|373529_373751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|373870_374845_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|374898_375870_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|375949_376924_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|377284_379954_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|380124_381006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|381016_381673_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|381739_382444_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|382674_384078_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	441075	563459	3186151	tRNA,transposase	Staphylococcus_phage(25.0%)	105	NA	NA
WP_048875895.1|441075_442239_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|442292_443294_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|443375_443945_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|444158_445130_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|445141_446737_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|446757_447789_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|448120_449224_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|449335_450520_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|450597_452586_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|453745_455119_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|455136_456123_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|456125_457280_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|457276_457972_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|458114_459605_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|459625_460675_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|460741_462136_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|463068_465000_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|465004_465535_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|465569_465764_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|465806_466166_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|466297_467293_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|467305_469687_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|469692_469980_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|470246_470453_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|472061_472835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|472836_473778_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|473911_475489_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|475682_476081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|477081_477288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|478092_478737_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|478804_480061_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|480316_480496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|480718_480946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|482221_482980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|483197_483761_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|483864_484413_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|485009_486162_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|486507_486804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|487063_487975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|488209_488749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|489911_490049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|490295_491024_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|491070_491679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|492953_493214_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|493387_494926_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|495104_496031_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|496135_497068_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|497564_500378_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|500370_500880_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|500883_501327_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|501422_502724_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|502986_503355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|503346_504069_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_155052690.1|505151_506483_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_144420611.1|506515_506716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|507250_508225_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|508635_508965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|509350_509716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|509839_510700_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|510686_511466_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|511541_512225_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|512385_512991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|513207_513711_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|513912_514167_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|514668_515136_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|515702_516893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|517727_519131_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|519437_520058_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|520237_521212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|521377_521644_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|521640_522141_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|522261_523137_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|524796_525327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|525326_525851_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|526013_527129_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|527365_528526_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|528977_530981_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|531049_532057_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|532130_533315_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|533324_534779_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|534809_535847_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|536169_536460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|537814_538789_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046691.1|538988_539585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|540108_540360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|540564_541728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|541750_542440_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|542587_543238_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|543338_543998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|546059_546821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|547239_547500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|547585_548248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|548364_549492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|549867_550029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|552160_552532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|552811_554053_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|554190_554421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|554554_555439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|555467_556094_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|556124_557324_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|557562_558660_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|558813_560352_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|560672_561008_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|561820_562114_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|562484_563459_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 5
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	573574	679073	3186151	tRNA,transposase	Bacillus_phage(16.67%)	108	NA	NA
WP_017377787.1|573574_573802_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|574058_575033_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|575456_576860_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|576893_577682_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|577812_578508_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|579012_579519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|579612_580170_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|580467_581817_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|581903_582161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|582228_582939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|583083_583263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|583786_585046_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|585178_585652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|585660_587043_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|587035_587650_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|587729_588446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|588620_590945_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|591111_592086_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|593249_594758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|594929_596021_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|596053_596692_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|596730_597003_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|597101_597344_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|597361_597664_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|597747_598290_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|598450_599077_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|599082_599922_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|599911_600562_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|600565_601399_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|601488_602616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|602882_603035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|603142_603337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|603529_604180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|604434_605526_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|605522_606887_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|607011_608208_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|608264_608828_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|609760_610429_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|610575_611877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|613367_613772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|614005_615088_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|615072_615693_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|615757_616633_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|616710_617286_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|618094_618388_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|618504_618654_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|619982_620957_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|621055_621211_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|621129_621390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|621566_622094_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|622348_622573_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|622717_623539_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|623496_623790_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|625266_625554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|626046_626817_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|626886_628299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|628665_630036_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|630032_630197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|630256_630544_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|631575_632166_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|632292_633678_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|633775_633973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|634065_634899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|635436_635790_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|635802_636039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|636038_636245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|636406_637126_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|637214_638999_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|639305_639461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|639387_639642_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|639787_640609_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|640791_641016_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|641121_642525_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|643089_643278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|643407_643674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|644059_645700_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|645812_647162_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|647158_648028_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|648952_650266_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|650262_651033_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|651029_651257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|651961_653122_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|653090_653687_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|654655_654883_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|655850_656255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|656258_657254_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|657239_658442_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|658368_658983_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|659679_659841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|660120_660666_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|660699_661365_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|661424_662381_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|662659_663337_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|663379_663961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|664105_664777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|665379_665967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|666935_667163_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|667135_667531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|667959_668775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|668865_669852_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|670021_670543_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|670576_670828_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|670838_672116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|672807_673335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|673451_675764_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|675892_676708_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|676964_677429_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|678845_679073_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 6
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	686428	758658	3186151	tRNA,transposase	Staphylococcus_phage(44.44%)	54	NA	NA
WP_048875919.1|686428_686746_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|686763_686976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|687929_688157_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|689314_690076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|692266_693241_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|693365_694802_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|694881_696342_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|696462_696750_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|696947_697991_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|698006_698906_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|698902_699421_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|699490_700108_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|700117_701605_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|701614_705295_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|705368_706178_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|706177_706858_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|707482_708457_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|708499_709495_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|709547_710522_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|710834_711719_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|711849_712671_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|712672_713710_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|713713_716371_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|716448_717258_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|717664_718432_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|718596_719475_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|719478_720216_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|720219_720777_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|720784_721531_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_080963646.1|721445_722345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|722433_723309_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|723405_724983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|725427_727338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|727874_728414_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|728410_729439_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|729428_730493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069468.1|730480_732694_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|732695_733763_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|734047_736465_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|736545_737079_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|737189_738239_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|738256_738703_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|738702_739476_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|739494_740649_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|740862_741432_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|741455_744962_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|745039_745999_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|745973_747434_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|747469_748999_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|749032_750436_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|752347_754162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|754246_755650_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876031.1|755795_757199_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|757683_758658_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 7
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	771131	831355	3186151	transposase	Acinetobacter_phage(18.18%)	51	NA	NA
WP_048876012.1|771131_772535_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|772753_773179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|773230_774718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|775027_775567_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|775856_776084_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|777329_777905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|778018_779422_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|779418_779709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|780076_780490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|781178_782966_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|783132_783753_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|784099_784240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|784259_786236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|786608_788066_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|788134_789715_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|790355_794252_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|794258_794582_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|794655_795129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|795160_796156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420625.1|796458_798045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|798404_799352_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|799670_800015_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|800108_800780_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|800820_801648_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|801734_802262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|803147_803567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|803676_804258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|804612_805893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|806013_806877_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|806965_807760_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|807997_808984_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|808989_810516_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|810611_811856_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|811909_813289_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|813406_814192_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|814534_815179_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|815213_817019_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|817042_817618_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|818667_819642_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|822178_822856_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|824354_824576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|825456_825618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|825554_826055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|826150_826579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|826838_827288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|827340_827775_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|827751_828717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|828935_829196_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|829290_830025_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|830053_830206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|830410_831355_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	845018	903679	3186151	integrase,transposase,protease	Bacillus_phage(26.67%)	48	871097:871156	887254:887750
WP_017377305.1|845018_846320_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|846387_848820_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|848923_849196_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|849278_851177_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|851208_852093_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|852101_852497_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|852920_855068_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|855039_856389_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|856385_858506_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|858502_860206_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|860340_861483_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|861539_862568_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|862694_864209_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|864315_864516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|864660_864996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|865140_865377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|865647_866526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|867162_868107_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|868380_869784_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|869788_870574_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|870964_871807_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
871097:871156	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|871803_872100_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|873581_874193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|874261_875068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|875371_876346_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|876517_878410_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|878982_881298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|881712_883116_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|883556_884036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|884103_885360_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|885506_886031_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|886435_886576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|886773_887478_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|888332_888644_-	hypothetical protein	NA	NA	NA	NA	NA
887254:887750	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|888707_888887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|889449_889632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|889695_889923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|890130_890895_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|891121_891415_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|891940_893344_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|893813_894791_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|894887_896348_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|896374_897028_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|897152_897719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|898015_899749_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|899820_901527_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|901518_902577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|902830_903679_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
>prophage 9
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	909054	1045435	3186151	tRNA,transposase,protease	Staphylococcus_phage(15.38%)	115	NA	NA
WP_144420634.1|909054_910386_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|910490_911465_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|911514_912219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|912659_913472_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|913530_916041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|916386_917562_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|918909_919134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|919162_920326_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|922568_923714_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|924306_925242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|926739_927051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|927047_928130_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|928445_928652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|928749_929280_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|929567_930746_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|930894_934659_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|934717_936220_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|936771_937407_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|937918_939166_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|939388_940825_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|941000_942218_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|942679_943459_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|944465_945440_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|946485_946797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|946793_947876_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|948186_948393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|950113_951475_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|951585_951957_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|952179_952830_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|952872_953955_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|954681_955656_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|956526_956754_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|958934_960488_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|961276_961513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|961632_962676_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|962922_963324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|963497_964397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|964791_966003_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|966013_966238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|966559_966724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|966816_968220_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|968386_968695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|968979_969150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|969778_970828_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|970896_971919_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|971964_972879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|973847_974075_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|974031_974901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|976338_977055_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|977499_979371_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|979462_981208_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|981287_981737_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|981789_982005_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|982251_983268_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|983316_983946_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|984286_985498_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|985530_985881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|985846_986527_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|986803_987223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|987368_988205_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|988248_989223_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|989242_989878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|990121_991123_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|991221_992430_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|992419_994150_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|994333_995470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|996214_996850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|996964_998299_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|998427_999069_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|999374_999797_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|1000074_1001037_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|1001075_1002251_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|1002339_1004040_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|1004039_1005578_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|1005617_1007270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|1007343_1008099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|1008285_1009161_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|1009425_1009620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|1009764_1010238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|1010507_1010681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1010885_1012199_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|1012195_1012840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|1013358_1014546_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|1014678_1015368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|1015441_1016791_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|1016894_1019075_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|1019144_1020020_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|1020066_1020363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|1020486_1020894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|1020873_1021452_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|1021874_1022537_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|1022567_1022936_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|1022946_1024263_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|1024509_1025121_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|1025196_1025376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|1025546_1025840_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|1026080_1026383_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|1026437_1028711_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|1028770_1029016_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|1029140_1029896_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|1030004_1030979_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|1031186_1031948_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|1031931_1032888_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|1033150_1035649_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|1035652_1036393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|1036842_1037637_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|1037799_1038588_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|1038584_1039796_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|1039788_1040145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|1040239_1040668_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|1040819_1041929_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|1041925_1042654_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|1042711_1043599_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|1043683_1044058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|1044157_1045435_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
>prophage 10
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1050647	1112273	3186151	tRNA,transposase,protease	unidentified_phage(18.18%)	57	NA	NA
WP_075275292.1|1050647_1051478_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|1051705_1051855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|1052049_1052871_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|1052867_1053761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|1053806_1054328_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|1054405_1054891_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|1055024_1055681_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|1055677_1055986_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|1056334_1057306_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|1057610_1058402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|1058391_1059255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|1059281_1059701_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|1059753_1060710_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|1061192_1063865_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|1063945_1064572_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|1064728_1066327_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|1066416_1067838_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|1067868_1068390_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|1068386_1068992_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|1069068_1070079_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|1070191_1070896_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|1070930_1071362_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|1071364_1072459_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|1072518_1073871_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|1073906_1074548_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|1074620_1075520_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|1075522_1076170_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|1076220_1077024_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|1077205_1077421_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|1077424_1077658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|1077719_1079312_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|1079514_1080444_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|1080445_1081213_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|1081578_1082349_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|1082407_1083382_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|1083489_1083852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|1084021_1085731_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|1085971_1087375_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|1087426_1087684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|1088432_1089740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|1090199_1090577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|1090721_1091123_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|1091687_1092467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|1092534_1092675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|1092875_1093073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|1093210_1093810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|1093992_1095465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|1095867_1097613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|1098048_1098909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|1099426_1101370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1101515_1102919_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|1103038_1103668_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|1103906_1104626_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|1104739_1108279_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|1108345_1109176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|1109162_1111202_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|1111217_1112273_+|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 11
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1119137	1153279	3186151	transposase	Burkholderia_virus(33.33%)	28	NA	NA
WP_144420650.1|1119137_1120394_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|1120649_1120829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|1121148_1121802_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|1122006_1122333_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|1123104_1124508_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|1124678_1126049_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|1126095_1126995_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|1126975_1129780_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|1129859_1130456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|1130869_1131625_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|1131714_1131942_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|1133058_1133700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|1133969_1135295_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|1135291_1137349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|1137326_1137899_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|1137981_1138314_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|1138378_1139413_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|1139400_1140522_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|1140615_1141599_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|1141755_1143423_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|1143709_1144561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|1144969_1147438_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|1147451_1148426_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|1148412_1149681_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|1149714_1151463_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|1151642_1151846_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|1152064_1152742_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|1153021_1153279_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 12
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1193755	1242141	3186151	tRNA,transposase	uncultured_Mediterranean_phage(28.57%)	40	NA	NA
WP_051929562.1|1193755_1194460_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|1194710_1195685_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|1196572_1199299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1199822_1200797_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|1200994_1202476_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|1202935_1203598_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|1203839_1205072_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|1205228_1208000_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|1208068_1208512_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|1208664_1210137_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|1210248_1211310_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|1211306_1212341_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|1212343_1213384_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|1213568_1214684_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|1214722_1215076_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|1215096_1216965_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|1216986_1217931_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|1218164_1218443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|1218805_1219444_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|1219418_1220843_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|1221043_1221721_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|1221841_1223116_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|1223183_1223939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|1223990_1224908_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|1225042_1225213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|1225332_1226112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1226164_1226452_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|1226511_1226862_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|1227055_1227208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|1227135_1227609_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|1227621_1228257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|1228768_1229644_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|1231250_1232609_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|1232832_1233021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|1233034_1234168_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|1234368_1238241_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|1238275_1239001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1239390_1240119_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|1240521_1241250_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|1241313_1242141_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1253038	1299668	3186151	transposase	uncultured_Caudovirales_phage(12.5%)	38	NA	NA
WP_144420657.1|1253038_1254100_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|1255590_1255944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|1256152_1257865_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|1258311_1260165_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|1260267_1260600_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|1260630_1261227_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|1261223_1262348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|1262459_1263107_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|1263158_1265072_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|1265276_1266314_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|1266372_1269699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|1270405_1271374_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|1271503_1271992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|1272433_1272667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|1272976_1273165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|1273653_1274139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|1274409_1274679_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|1274713_1276039_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|1276094_1276742_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|1276935_1278894_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|1279037_1281968_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|1282773_1284177_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|1285617_1286403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|1286493_1288143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|1288287_1289133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1289246_1290650_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1291115_1292123_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|1292122_1292380_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378292.1|1292677_1292884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|1292913_1293573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|1293591_1294467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|1294602_1295592_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1295568_1296330_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|1296362_1297142_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|1297418_1298054_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1298050_1298215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1298413_1299388_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|1299446_1299668_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1361901	1402307	3186151	tRNA,transposase	Tupanvirus(22.22%)	38	NA	NA
WP_017378228.1|1361901_1362822_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|1366985_1367129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|1367738_1368557_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|1368664_1369126_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|1369142_1370066_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|1370089_1371139_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|1371276_1371870_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|1371892_1372363_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|1372472_1373723_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|1374411_1374876_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|1375314_1376787_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|1376903_1377356_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|1377480_1377636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|1377780_1377984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|1378174_1378573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|1378758_1379364_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|1379372_1379669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1379673_1380210_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|1380354_1380924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1381003_1381978_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|1381974_1382472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|1382879_1383296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1383363_1384767_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|1384763_1385384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1385655_1386630_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|1386794_1387418_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|1387414_1389355_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|1389510_1390164_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|1390332_1391508_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|1391861_1393187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|1393279_1394068_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|1394169_1395042_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|1395228_1396491_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|1396564_1397095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|1397116_1398622_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|1398634_1399300_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|1399393_1401154_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|1401431_1402307_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1568537	1584108	3186151	transposase	unidentified_phage(25.0%)	15	NA	NA
WP_048876002.1|1568537_1569521_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1570320_1571474_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1571595_1572288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1572296_1573484_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1573633_1574260_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1574305_1575535_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1575729_1576176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1576367_1577726_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1578391_1578565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1578694_1579612_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1579953_1580613_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1580693_1581197_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1581169_1581457_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1581749_1582871_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1583133_1584108_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 17
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1599095	1652361	3186151	integrase,transposase,protease	Staphylococcus_phage(33.33%)	54	1600163:1600222	1658729:1659269
WP_036771330.1|1599095_1600070_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1600145_1600463_-	hypothetical protein	NA	NA	NA	NA	NA
1600163:1600222	attL	ACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTT	NA	NA	NA	NA
WP_075275321.1|1600466_1600835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1601568_1602537_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1602746_1604159_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1604346_1605060_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1605080_1605494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1605594_1606668_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1606804_1607704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1607959_1608211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1608259_1608895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1609019_1609877_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_053856766.1|1610064_1611468_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1611643_1612147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1612223_1613525_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1613693_1614794_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1615144_1615387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1615380_1615698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1616920_1617148_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|1617758_1618229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1618451_1618751_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1618747_1618993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|1619285_1620242_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|1620526_1620730_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1620860_1621889_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1622252_1622498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1622860_1623835_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1625306_1627013_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1627058_1627910_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1628112_1630569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1631088_1631490_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1632076_1633051_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1633091_1634420_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1634683_1635253_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1635268_1635580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1635589_1636558_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1636670_1637024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1637027_1638092_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1638092_1639832_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1639838_1640261_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1640244_1640874_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1641109_1641208_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1641240_1643112_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1643259_1644234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|1644313_1644457_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1644630_1645974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|1646472_1646751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1647018_1647975_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1648301_1648685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420680.1|1648700_1649621_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1649936_1650812_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1650813_1650978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1651157_1651343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1651386_1652361_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
1658729:1659269	attR	AACGCTTGTCAGTAATCATGAAGCACCACAAAGCCCTAGCGACCATGCAGCTCATTAAGTTCTAACAGGAGCAGTCCGTCTATAATCAGGTTTTAAGCCTATTTTTAGCTGCTTTATCGATTATTGGCACCTGCACTTCGAATACTGGGAGTAATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAATATTGTATTACCTAAGCGCAGATTTAGTTATTTAACTATTAAAATGAAAATCGGGATAACGCACTGTAGCCCGCTTTCTTTATTTAGACCGACACAGTTGAGGCCTTCGACGTTTTCGGCCTGGCTGCTGCTGACTATTACGATGATCTTCCCTGCGTTTTCCTTGCATGCTGCCTCCCAAGCGCTGCCCTCCCTGATGTTCGATTTCTGGTTTTTTAGGCGCTTTTGATCTGCGATCTAAACTAGAAACAGGTACATCATGCACTGGCTCAAATCCATCAACGAGTTTACGGGCTAATAACTGTCCGATTAAATGTTCAATATCAGATAATTGTTTGAT	NA	NA	NA	NA
>prophage 18
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1674721	1793217	3186151	tRNA,transposase	Tupanvirus(11.11%)	100	NA	NA
WP_017376809.1|1674721_1676491_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1676715_1677849_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1678698_1681518_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1681892_1682618_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1685212_1685773_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|1685977_1686310_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1686369_1686657_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1687309_1688335_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1688462_1689437_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1689631_1690585_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_017376824.1|1690754_1690913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1691185_1691710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1692164_1692992_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1693060_1693246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1693446_1693905_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1694045_1694273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1694437_1695823_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1696118_1696433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1696541_1698167_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1698579_1699569_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1699890_1700076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1700465_1702421_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1702492_1702615_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1702657_1703632_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|1703854_1704316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|1704700_1705498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|1705963_1707769_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_027243044.1|1707856_1709203_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075275422.1|1711840_1712272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772316.1|1712423_1713167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377201.1|1714814_1715285_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_017377202.1|1715846_1716449_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_027243048.1|1717218_1718706_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377206.1|1718767_1720225_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|1720261_1720726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1720753_1721332_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|1721602_1723420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1723396_1724446_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1724645_1725023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1726212_1726500_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1726559_1726856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1727000_1727657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1727896_1728277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1728928_1730332_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1730328_1730610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1731004_1731469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1731649_1732243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1732428_1733403_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1733806_1734631_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1734705_1735854_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1735869_1737498_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1737841_1739035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1745149_1745650_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1746063_1746204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1746326_1747787_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1747864_1748347_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1748505_1749771_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1749855_1751115_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1751186_1751459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1751796_1752132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1752492_1752741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1753011_1753422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1753566_1754103_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1754113_1754299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1754734_1755706_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1755687_1756659_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1756772_1757546_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1757816_1758146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|1758401_1758920_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1758972_1759200_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|1760181_1761057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1761248_1761626_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1762185_1763235_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1763548_1764934_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1764940_1766479_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1766521_1767247_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1767417_1768650_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1768849_1769671_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1769720_1770530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1770685_1774552_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1774717_1775593_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1775657_1775936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1776080_1776656_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1776704_1776863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1777611_1778328_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1779456_1779873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1780787_1781717_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1781688_1781847_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1781995_1782310_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1783219_1784203_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1784353_1784701_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1784700_1785300_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1785674_1786013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|1785831_1786221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|1786224_1787169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|1787156_1787300_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|1787661_1787994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|1790886_1791888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|1791960_1792425_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|1792797_1793217_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	1806424	2009522	3186151	tRNA,transposase	Staphylococcus_phage(23.81%)	179	NA	NA
WP_036772026.1|1806424_1807300_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1807337_1808252_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1808316_1808946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1808990_1809425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1809405_1810146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1810159_1811557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1811559_1814508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1814507_1816229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1816243_1816648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1816648_1819528_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1819530_1820253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|1820614_1822507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1822538_1825079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1825110_1826274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|1826279_1826903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1826917_1828417_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1828433_1828940_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1830195_1830267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1830449_1830632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1831833_1832106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1832121_1833555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1833699_1834965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1835250_1837002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1837014_1838178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|1838181_1838478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1838517_1838745_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1840613_1841588_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1841646_1841910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1841919_1843233_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1843437_1843611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1843678_1843822_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1843840_1844038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1844055_1844562_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1845484_1846360_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242571.1|1846425_1846674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378158.1|1846839_1849920_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017378159.1|1849937_1850990_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378160.1|1851513_1852164_+	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1852497_1853142_+	porin family protein	NA	NA	NA	NA	NA
WP_017378162.1|1853480_1854020_+	porin family protein	NA	NA	NA	NA	NA
WP_144420698.1|1854534_1854696_+	phosphatase	NA	NA	NA	NA	NA
WP_075275334.1|1854844_1855138_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377970.1|1855912_1856104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|1856152_1856392_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_144420699.1|1856727_1857057_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_026063694.1|1857146_1857731_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_017377966.1|1857866_1858553_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|1858676_1859861_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|1860076_1861519_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242961.1|1861658_1862609_+	DMT family transporter	NA	NA	NA	NA	NA
WP_048876021.1|1862707_1863481_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_017377960.1|1863484_1864234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1864306_1865776_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027242964.1|1866090_1866663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773041.1|1866771_1868271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242965.1|1868592_1871025_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017377953.1|1871593_1872790_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_017377952.1|1872837_1875204_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_144420700.1|1875828_1875978_+	phosphatase	NA	NA	NA	NA	NA
WP_048876022.1|1876115_1876967_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1877379_1878533_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1878623_1879727_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1880066_1880567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1881263_1881617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1881917_1883645_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1883748_1884474_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1884466_1885705_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1885842_1886880_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1886934_1887837_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1887946_1889200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1889257_1892749_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1892865_1893543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1893670_1894219_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|1896089_1896251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1897442_1898009_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1898011_1899136_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1899220_1900039_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1900169_1902149_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1902208_1902862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1903546_1904917_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1906632_1907280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1907317_1907710_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1907962_1908709_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1909307_1910213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1910328_1911303_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1911448_1912177_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1912296_1912878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1912900_1915741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1917783_1918734_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1918816_1919599_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1919697_1919991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1920513_1921158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1921191_1921836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1921884_1922739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1922876_1923389_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1923456_1923651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1923864_1924218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1925426_1926401_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1927148_1927850_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|1927924_1928584_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1928721_1929978_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1930252_1930915_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1930904_1932137_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1932268_1932886_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1932963_1933470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1933480_1933708_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|1934990_1935257_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1935486_1936605_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1936749_1937085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1937095_1937509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1938717_1938882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1938918_1939794_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|1939980_1940493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1942924_1944124_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|1944377_1944659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|1944714_1946706_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|1946779_1947757_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|1947892_1948675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|1948831_1949155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|1949222_1950326_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1950395_1951271_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1951267_1951612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1951621_1952083_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1952096_1953488_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1953529_1956517_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1956586_1957420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1957474_1958662_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1958649_1959354_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1959399_1960185_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1960212_1960950_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1961054_1963250_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1963324_1964008_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1964018_1964450_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1964495_1964894_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1965270_1965978_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1966042_1966339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|1966380_1966857_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1966910_1967432_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1967513_1968608_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1969574_1970978_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1971147_1971711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1971846_1973322_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1973328_1973535_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1973592_1974663_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1974860_1976831_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1977191_1978751_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1979347_1979704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1980544_1981204_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1981299_1982661_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1982802_1983030_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1984081_1985422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1986072_1986234_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1986333_1987161_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1987514_1988390_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1988433_1989408_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1989427_1989616_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242753.1|1990260_1990803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242754.1|1991083_1991437_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242755.1|1991429_1992575_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242756.1|1992985_1994233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242757.1|1994370_1994754_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242758.1|1994750_1995482_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242759.1|1995484_1996228_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_144420798.1|1996241_1997141_-	GTPase Era	NA	NA	NA	NA	NA
WP_027242761.1|1997146_1997821_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|1997983_1998205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|1998232_1999174_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|1999170_2000973_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|2001282_2001852_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|2002006_2003581_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155052681.1|2003588_2003942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|2004027_2004273_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080963649.1|2004314_2005352_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|2005498_2005825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|2005981_2006392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876033.1|2006534_2006849_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_048876034.1|2007118_2007811_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|2007807_2007951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2009294_2009522_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 20
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2016423	2151748	3186151	transposase	Staphylococcus_phage(23.81%)	111	NA	NA
WP_048876036.1|2016423_2017062_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|2017775_2018963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|2019128_2020082_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|2020104_2022123_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|2022211_2022535_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|2022783_2022960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|2023187_2023907_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|2024522_2024906_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|2025550_2026024_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|2026129_2027500_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|2027615_2028347_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|2028371_2029469_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|2029504_2030923_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|2031132_2031585_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|2031596_2031824_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|2031873_2032200_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|2032403_2033093_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|2033241_2033730_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|2033770_2034871_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|2034916_2035999_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|2035991_2036552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|2036542_2037847_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|2037900_2038923_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|2038947_2039964_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|2040396_2043519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|2043915_2044539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|2045321_2046872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|2047166_2047922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2048630_2049605_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|2052513_2053185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2054263_2055667_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|2057254_2060656_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|2060652_2063346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|2063649_2065149_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|2065815_2066637_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|2066708_2067194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2067342_2068746_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|2068742_2069813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|2070058_2072233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|2072255_2072936_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|2072964_2073198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2073250_2073478_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876044.1|2074556_2075057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|2075546_2075720_+	phosphatase	NA	NA	NA	NA	NA
WP_144420800.1|2076017_2076719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375730.1|2076870_2078118_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_017375729.1|2078496_2079108_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375728.1|2079193_2080060_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|2080063_2080825_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|2080988_2081894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|2082116_2082932_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|2083117_2083507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|2083785_2084244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|2084514_2085123_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|2085653_2086529_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|2086769_2087444_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|2087472_2087961_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|2089006_2089441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2089646_2091050_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|2091297_2092809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|2093769_2094063_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|2094020_2094599_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|2094684_2095560_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|2095552_2095909_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|2095917_2096313_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|2097637_2098198_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|2099320_2101210_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|2101244_2102450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|2102452_2103751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|2103731_2104955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|2105004_2105805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|2105801_2106200_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|2106196_2106505_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|2106898_2107627_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|2107667_2108312_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|2108324_2108792_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2108846_2109821_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|2109850_2110468_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|2110446_2110908_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|2110951_2111887_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|2111914_2112910_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|2113153_2114116_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|2115543_2116272_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|2116322_2117957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|2118227_2119415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|2120016_2120454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|2122987_2123260_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|2123335_2123644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|2126119_2126437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2126593_2127568_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|2127564_2127954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|2128034_2128781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2128749_2129478_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|2130222_2130510_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|2130569_2130734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|2130730_2132134_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|2132166_2132928_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|2133213_2133930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|2134707_2135613_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|2136099_2137392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|2137627_2140378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|2142016_2142484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|2142484_2143186_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|2143447_2143630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|2143883_2144258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|2144367_2146359_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|2146348_2147395_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|2147835_2148687_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|2148687_2149605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|2150000_2150174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|2150776_2151748_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2159843	2211632	3186151	tRNA,transposase,protease	Burkholderia_virus(22.22%)	47	NA	NA
WP_036771330.1|2159843_2160818_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|2161084_2161354_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|2161498_2162455_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|2162615_2163542_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|2163837_2164599_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|2164800_2165412_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|2165432_2166632_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|2166726_2166867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|2166879_2167284_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|2167514_2168084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|2168150_2169191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2169217_2169445_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|2170495_2171353_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_017377019.1|2171349_2172195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|2172195_2174925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|2175058_2175934_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242874.1|2176198_2177173_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|2177601_2178315_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|2178483_2178975_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|2179114_2179606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|2179808_2180699_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|2181083_2181668_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|2181748_2182687_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|2182738_2183833_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|2183957_2185280_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|2185327_2190214_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|2190308_2190611_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|2190721_2192644_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|2192665_2193961_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|2193957_2195568_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|2195674_2196568_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|2196677_2197301_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|2198007_2198706_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|2198849_2199419_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|2199734_2200361_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|2200557_2201304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|2201399_2202239_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|2202289_2202637_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|2202827_2203715_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|2203829_2204432_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|2204428_2205148_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|2205216_2206929_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|2207076_2209014_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|2209126_2210176_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|2210175_2210451_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|2210531_2211080_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|2211404_2211632_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 22
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2236526	2280807	3186151	transposase	Staphylococcus_phage(50.0%)	41	NA	NA
WP_036771330.1|2236526_2237501_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|2237816_2237978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2237974_2239378_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|2239491_2240259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2240617_2242021_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|2242841_2243042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|2243282_2244728_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|2245923_2246799_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|2248250_2248532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|2248750_2248930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|2249089_2250109_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|2250095_2250518_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|2250519_2250993_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|2251118_2251775_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|2251771_2252446_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|2252451_2253600_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|2253596_2254058_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|2254133_2255384_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|2255510_2257190_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|2257301_2258183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|2259270_2259864_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|2260225_2260741_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|2261680_2261965_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|2262514_2262790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2263162_2264137_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|2264293_2264932_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|2265013_2265412_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|2265564_2265882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|2265960_2266215_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|2266367_2268029_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|2268089_2268773_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|2268772_2269858_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377751.1|2269899_2272536_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_155051395.1|2273515_2273659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|2274340_2275660_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|2275663_2276380_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|2276376_2277018_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|2277010_2277145_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|2277393_2277849_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|2277940_2278285_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|2279403_2280807_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2335725	2382433	3186151	tRNA,transposase	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|2335725_2336520_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|2336809_2337733_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|2338000_2338294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|2339496_2340420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|2340555_2341398_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|2341485_2342136_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|2342149_2343190_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|2343312_2344398_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|2344424_2345534_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|2345838_2346156_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|2346152_2346512_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|2346614_2349347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|2350836_2351514_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|2351760_2351979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|2352123_2353332_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|2353759_2355217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|2356052_2356328_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|2359031_2359211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|2359207_2359579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2359589_2360672_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|2360668_2360890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|2361875_2362094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|2362584_2362851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|2363109_2363430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|2364815_2366066_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|2366054_2366936_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|2366928_2368014_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|2368010_2369270_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|2369438_2370098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|2370268_2370931_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|2371277_2372225_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|2372321_2372948_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|2372953_2373535_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|2373606_2374698_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|2374787_2375501_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|2375594_2376419_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|2376652_2377330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|2379007_2379265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2379665_2380640_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|2380814_2381459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|2381638_2382433_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2388128	2424407	3186151	transposase,protease	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|2388128_2388305_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|2388600_2389035_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|2389228_2390698_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|2390691_2392068_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|2392080_2392473_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|2392469_2393573_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|2393751_2395044_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|2395054_2396002_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|2396013_2396826_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|2396828_2397608_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|2397622_2398681_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|2398677_2399688_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|2399694_2399892_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|2399952_2402859_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|2402900_2403752_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|2403834_2404380_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|2404477_2405338_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|2405429_2405846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|2405927_2406434_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|2406479_2409431_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|2409452_2409785_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|2409902_2410412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|2410945_2411101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|2412175_2413342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|2413486_2414239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2414594_2415569_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|2415701_2416412_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|2416408_2417443_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|2417546_2417888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|2418398_2419559_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|2419527_2420124_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|2421092_2421263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2421259_2422234_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|2423253_2424407_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 25
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2469553	2535164	3186151	plate,tRNA,transposase	Staphylococcus_phage(18.18%)	57	NA	NA
WP_027242858.1|2469553_2470861_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|2470865_2471576_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|2471588_2474759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|2474825_2475962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|2476824_2477682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|2477823_2478624_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|2478722_2479298_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|2479380_2480052_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|2480097_2480997_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|2481031_2481415_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|2481564_2482395_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|2482319_2483030_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|2483026_2484052_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|2484182_2486687_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|2486693_2487962_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|2487963_2488947_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|2488959_2489781_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|2489825_2490218_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|2490292_2491099_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|2491286_2491715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2491773_2492748_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|2492771_2493209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2493243_2494647_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|2495227_2495389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|2496609_2496981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|2497088_2498639_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|2498671_2499511_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|2499507_2500023_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|2500026_2501019_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|2501397_2502768_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|2502976_2504116_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|2504329_2505304_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_017375775.1|2505351_2505546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052676.1|2505584_2505872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|2511527_2512208_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|2512272_2513559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|2514160_2514430_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|2514613_2515585_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|2515652_2516627_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|2516724_2517801_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|2517881_2518874_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|2518878_2520681_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|2520698_2522000_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|2522015_2523299_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|2523431_2523824_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|2523930_2525016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|2525231_2526248_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|2526250_2527258_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|2527261_2528416_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|2528430_2528793_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|2528789_2530505_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|2530604_2531279_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|2531307_2531712_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|2531736_2532696_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|2532828_2533611_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|2533712_2534672_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|2534816_2535164_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2539165	2602937	3186151	transposase	Planktothrix_phage(10.0%)	52	NA	NA
WP_144420814.1|2539165_2540083_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|2540227_2540764_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|2541023_2541926_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|2542915_2543905_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|2544073_2544412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|2544408_2544984_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|2545032_2545248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|2545434_2546274_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|2549970_2550879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|2551009_2551666_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|2551774_2552701_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2553019_2553580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2554049_2555369_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2555436_2556303_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2556295_2557171_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2557229_2557448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2558848_2559178_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377043.1|2560096_2562325_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2562587_2563601_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2563709_2563931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2563935_2565573_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2565711_2566245_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2566365_2567484_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|2567476_2568799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2568785_2569922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2570152_2570578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2573907_2574261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2574295_2575171_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2575327_2575732_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2575879_2577055_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2577314_2577818_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|2577857_2579342_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|2579565_2580519_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2580499_2581591_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2581893_2582136_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155046568.1|2583036_2583195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2583203_2583779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|2583895_2584078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2584653_2584926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2585078_2585333_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2585447_2586851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2586935_2587442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2588006_2589827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2589893_2590424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2591970_2592687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2592729_2593167_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2593204_2594584_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2594978_2596973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2597437_2598250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2598433_2599897_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2600256_2601636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2602388_2602937_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 27
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2634728	2678088	3186151	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|2634728_2635703_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2635699_2636137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2636311_2637715_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2637725_2638001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2638278_2638749_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2639051_2640422_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2640751_2641219_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2641231_2642242_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2642443_2643847_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2644273_2645062_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2645048_2646077_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2646054_2646459_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2646686_2648654_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2648849_2649341_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2649375_2650218_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2650263_2650716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2651005_2651638_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2651638_2652889_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2652922_2654020_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2654349_2655735_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2655774_2656032_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2658447_2659851_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2659847_2660888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2661280_2661676_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2661672_2662461_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2662646_2663372_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2663616_2664804_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2665096_2665639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2665635_2666322_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2666325_2666937_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2666983_2668003_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2668105_2668900_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2668913_2669714_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2669792_2670842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2671017_2672298_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2672343_2673021_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2673106_2673388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2673479_2674334_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2674273_2674672_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2675199_2676141_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2676859_2677081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|2677077_2678088_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2730781	2766721	3186151	transposase	Staphylococcus_phage(16.67%)	31	NA	NA
WP_048876031.1|2730781_2732185_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|2732304_2732943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2733290_2734265_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2734573_2735599_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|2735706_2736909_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2737146_2737560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2738061_2738631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2738633_2738972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2738964_2739498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2739516_2739807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2739893_2741525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2742077_2742581_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2742543_2743251_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2743315_2744176_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2744156_2744930_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2744960_2746199_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2746198_2747161_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2747204_2747957_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2750485_2750722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2750740_2751190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2751410_2752835_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_052106221.1|2752899_2753949_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2754239_2754971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2755001_2755892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2757234_2760045_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2760337_2761363_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2761746_2762604_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2762773_2763502_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2763702_2765106_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2765251_2765749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2765818_2766721_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2789929	2830145	3186151	tRNA,transposase,protease	Staphylococcus_phage(42.86%)	44	NA	NA
WP_069971662.1|2789929_2790904_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2791187_2792390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2792686_2792944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2792901_2793342_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2793447_2794014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2794158_2794413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2794557_2795427_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063584.1|2795948_2796908_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2796904_2797552_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2797580_2798432_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2798446_2799724_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2799764_2800280_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2800357_2801419_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2801440_2802529_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2802573_2804409_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2804451_2804922_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2804958_2805294_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2805306_2806023_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2805959_2807000_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2806972_2807452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2807538_2810019_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2810081_2810513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2810713_2811004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2811063_2812662_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2812826_2813162_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2813190_2814855_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2814854_2815496_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2815495_2816239_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2816297_2816534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2816684_2818052_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2818062_2818614_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2818694_2819798_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2819799_2821557_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2821779_2822403_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2822457_2822877_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2823017_2823632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2823689_2824475_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2825106_2826123_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2826125_2826638_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2826679_2827153_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2827208_2827994_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2828037_2828778_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2828867_2829116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2829491_2830145_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	2917550	3028388	3186151	tRNA,transposase,protease	Staphylococcus_phage(13.33%)	101	NA	NA
WP_017378106.1|2917550_2918495_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2918494_2918848_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2918896_2921572_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2921588_2923106_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2923182_2923635_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2923853_2925293_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2925292_2926831_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2926845_2928816_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2928819_2929125_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2929148_2929772_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2929791_2930280_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2930293_2931319_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2931323_2933717_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2933766_2935056_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2935062_2935563_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2935562_2936816_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2936817_2937495_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2937512_2937998_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2937988_2938357_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2939035_2939398_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2939411_2940173_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2940474_2941821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2941917_2942460_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2942575_2943409_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2943430_2944024_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2944199_2945219_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2945489_2945891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2945901_2946225_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2946248_2947259_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2947325_2948174_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2948290_2949202_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2949968_2950844_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2950902_2951283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2951429_2951666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2951962_2952433_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2952487_2953342_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2953813_2954032_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2954134_2955385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2955440_2955923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2956159_2956588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2956923_2957898_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2957956_2959009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2959327_2960293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2960595_2961420_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2961621_2962698_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2962782_2963769_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2963787_2964432_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2964443_2965553_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2965619_2966282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2966541_2968425_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2968738_2970238_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2970328_2971111_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2971238_2972159_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2972182_2972641_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2972762_2973638_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2973671_2974937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2975124_2976000_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2976198_2976390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2976594_2977890_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2978209_2978428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2978464_2979844_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2979871_2980330_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2980307_2981525_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2981717_2981954_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2981967_2982123_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2982203_2983166_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2983325_2984642_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2984651_2985320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2985730_2987545_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2988260_2988446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2988627_2989086_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|2989804_2990680_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|2990911_2991310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2991313_2991556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2992445_2994197_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2994207_2995008_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2995110_2995599_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2996098_2997022_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2997118_2997463_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|3003157_3004120_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|3004158_3005034_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|3005293_3006553_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|3006775_3007102_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|3007296_3008247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|3008304_3010371_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|3010376_3011372_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|3012120_3013701_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|3013848_3015258_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|3015317_3016451_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|3016589_3017414_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|3017937_3018150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|3018163_3018301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052673.1|3018438_3018663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|3019723_3020095_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|3020405_3020693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|3020844_3021693_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|3021815_3022787_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|3022889_3023930_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|3026468_3026759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|3027026_3027287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3027413_3028388_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 31
NZ_CP013801	Piscirickettsia salmonis strain PM22180B, complete genome	3186151	3061382	3122850	3186151	tRNA,transposase	Acinetobacter_phage(33.33%)	56	NA	NA
WP_053093682.1|3061382_3062126_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|3063292_3063889_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|3064159_3064738_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|3069260_3070766_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|3070793_3071075_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|3071223_3071565_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|3071685_3073590_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|3073722_3075294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856771.1|3075311_3076541_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|3076662_3077661_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|3077664_3078423_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|3078424_3079624_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|3079607_3080279_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|3080300_3081077_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|3081080_3082079_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|3082080_3082659_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|3082655_3084125_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|3084168_3084456_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|3084656_3085577_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|3085692_3086247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|3086362_3086788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|3087058_3087409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|3087602_3088142_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|3088226_3088763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|3089422_3089725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|3090173_3090743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|3090811_3091156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|3091334_3092309_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|3092575_3092749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3092854_3094258_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|3094262_3095282_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|3095898_3096228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|3096453_3096852_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|3097719_3098670_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|3098669_3100748_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|3100889_3101405_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|3101413_3101977_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|3101957_3102704_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|3102842_3103295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|3103430_3104267_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|3104263_3105160_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|3105192_3106260_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_080963575.1|3106960_3108412_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|3108418_3109798_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|3109838_3111152_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|3111141_3112116_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|3112209_3112713_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|3112847_3113999_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|3113995_3114475_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|3114621_3116943_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|3116887_3117514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|3117518_3118418_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|3118605_3119160_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|3119199_3120174_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|3120763_3121141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3121875_3122850_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP013803	Piscirickettsia salmonis strain PM22180B plasmid p2PS13, complete sequence	51575	23580	37376	51575	capsid,tail,transposase,head	Moraxella_phage(18.18%)	18	NA	NA
WP_036771639.1|23580_24555_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_075275454.1|24604_25144_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_027242598.1|25157_25742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375778.1|26126_26438_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_017375779.1|26434_26860_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375780.1|27038_27434_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375781.1|27430_27781_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375782.1|27780_28203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375783.1|28204_28528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|28584_28851_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_036771950.1|28854_30933_+|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375786.1|30925_31267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375787.1|31263_31935_+|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_144420832.1|31864_32650_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375789.1|32639_33197_+|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_027242568.1|33193_35884_+	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375652.1|35942_36371_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|36398_37376_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 1
NZ_CP013804	Piscirickettsia salmonis strain PM22180B plasmid p3PS13, complete sequence	181038	0	60490	181038	portal,transposase,integrase	Streptococcus_phage(34.48%)	59	13678:13737	53321:54241
WP_036771347.1|0_978_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|1458_2436_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|2450_2612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|2829_3084_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_048876199.1|3073_3364_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	52.6	1.3e-11
WP_036771347.1|3350_4328_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075275459.1|5328_5601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|5697_6675_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075275460.1|6689_7274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|7392_8370_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075275461.1|8477_9569_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_155764727.1|9837_10029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927782.1|10673_11063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|10978_11956_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_075275463.1|12049_13135_-	hypothetical protein	NA	NA	NA	NA	NA
13678:13737	attL	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTA	NA	NA	NA	NA
WP_027243215.1|14948_15971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774350.1|16453_17182_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_048876194.1|18421_18955_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_080963665.1|19135_19477_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_080963664.1|19657_19924_+|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_027243206.1|19996_21862_-	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_047927778.1|22029_22314_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|22657_23386_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155046637.1|23467_23959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|24691_24919_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876191.1|26470_26899_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_081000015.1|26834_27221_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|27250_27979_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|27990_28140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|28386_29115_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036774388.1|30492_31455_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_027242592.1|31478_31808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|31874_32915_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_144420833.1|32928_33120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774378.1|33324_33894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774316.1|33936_34236_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155046638.1|34232_34697_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774373.1|34970_35699_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_048876188.1|35872_36646_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_027243202.1|37359_38295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|38569_39298_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243201.1|39463_39703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929623.1|39766_43108_+	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_036772541.1|43265_43994_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_144420834.1|44287_44683_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036815648.1|44735_45464_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772541.1|45947_46676_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_027243197.1|46846_47416_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_087910667.1|47420_48104_-	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_036772541.1|48255_48984_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_080963627.1|49002_49221_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275467.1|50200_51262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|51771_52518_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_027243200.1|52518_52923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|53229_54204_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036771293.1|54743_55010_-|transposase	transposase	transposase	NA	NA	NA	NA
53321:54241	attR	TTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_036772437.1|55305_57204_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_048876182.1|57559_59455_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017375632.1|60154_60490_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
>prophage 2
NZ_CP013804	Piscirickettsia salmonis strain PM22180B plasmid p3PS13, complete sequence	181038	65952	127498	181038	portal,transposase,integrase	Streptococcus_phage(52.17%)	58	53144:53203	106312:107047
53144:53203	attL	CGCCCTCCGTCATCTGAAGTGCAACACCGAGTAGAGAGTTCATATCCATACAGATAAACT	NA	NA	NA	NA
WP_080999971.1|65952_67356_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000017.1|67620_67872_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_048875857.1|68272_69247_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_048876221.1|70234_70690_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_016212398.1|70784_71246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773695.1|73306_75379_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_017377509.1|75408_76137_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_144420837.1|76278_77211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377511.1|77240_77969_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|77971_78244_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|79094_79823_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|79878_80499_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|81647_82376_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420839.1|82571_83498_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377667.1|84167_84338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|84482_84740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815609.1|86640_87096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816769.1|87339_87738_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_047927763.1|87734_87998_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243210.1|88411_89146_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_017377525.1|91025_91823_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075275471.1|92363_93338_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155046640.1|93973_94141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|94109_94838_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_017377521.1|95346_95700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|96627_97356_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243190.1|97938_101283_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_048876213.1|101591_102482_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275473.1|103720_103897_+	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_027243191.1|104013_104721_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_048876212.1|104674_105553_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_144420840.1|105583_106015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876211.1|106397_107102_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
106312:107047	attR	CGCCCTCCGTCATCTGAAGTGCAACACCGAGTAGAGAGTTCATATCCATACAGATAAACTCTCTAGTTTGCCTTATGAGGGTAGAGATGATTTATCGGCACTTAAATGAAAAAGATCGTTTTTATATCGAACAACGGTTATCAGAGGGAGACTCGCTCAGATCAATTGCTAGAGCACTTGGCTTTTCTCCTAGCACGATTAGCCGTGAGATTAAACGGCACACCCCAATCGATTTTAAAGGTCTTTATTGTCACCGGCTTACTTCTCGCTGCGCACAAGAAAAACGAGCTAACGCTAAGCAAGGACAAGCTTTTCAACAAATTTCAGAAGAGGAAAAAATGTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATAC	NA	NA	NA	NA
WP_036772541.1|107113_107842_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929563.1|107871_108261_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_017375910.1|108283_109012_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036815979.1|109014_109623_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_144420841.1|109994_110219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|110211_110550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|110563_110968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375840.1|111012_111231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275474.1|112199_113312_+	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017377655.1|113653_113899_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_017377656.1|113895_114282_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_036772434.1|114369_115098_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_080963659.1|115076_115697_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377658.1|116042_116729_+	Fic family protein	NA	NA	NA	NA	NA
WP_082304501.1|117678_118041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|118043_119783_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046629.1|120184_120337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929558.1|120364_121048_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_036771347.1|121129_122107_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_081000019.1|122182_122353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|122393_123122_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_036771293.1|123667_123934_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772437.1|124229_126128_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_017377694.1|126549_127278_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_082884401.1|127375_127498_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013804	Piscirickettsia salmonis strain PM22180B plasmid p3PS13, complete sequence	181038	166316	171247	181038	terminase,portal,transposase	Streptococcus_phage(42.86%)	7	NA	NA
WP_027242929.1|166316_166700_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|166786_167269_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|167271_168603_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|168807_169242_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|169328_169715_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|169752_170487_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|170533_171247_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
>prophage 1
NZ_CP013805	Piscirickettsia salmonis strain PM22180B plasmid p4PS13, complete sequence	33533	21605	32258	33533	terminase,tail,transposase,head,capsid	unidentified_phage(30.0%)	14	NA	NA
WP_027242943.1|21605_22022_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|22018_22576_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
WP_027242945.1|22921_23437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|24240_24456_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|24529_25504_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|25884_26466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|26501_26894_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|26990_27965_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|27984_28170_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|28172_28655_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|28741_29125_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|29337_30204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|30829_31804_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|31901_32258_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
