The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	37745	69420	3186791	tRNA,transposase	Staphylococcus_phage(50.0%)	28	NA	NA
WP_036773116.1|37745_38720_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|38772_39768_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|39810_40785_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376319.1|41409_42090_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_017376318.1|42089_42899_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027242903.1|42972_46653_-	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_026063524.1|46662_48150_-	ribonuclease G	NA	NA	NA	NA	NA
WP_017376313.1|48159_48777_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_017376312.1|48846_49365_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376311.1|49361_50261_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210526.1|50276_51320_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376309.1|51517_51805_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_017376308.1|51925_53386_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_027242902.1|53465_54902_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_036771325.1|55026_56001_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420621.1|58191_58953_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|60110_60338_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377706.1|61291_61504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|61521_61839_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773856.1|61865_62537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377709.1|62894_63098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927332.1|64176_64959_-	lipoprotein	NA	NA	NA	NA	NA
WP_017377712.1|65088_65400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242900.1|65743_66070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377714.1|66094_66550_-	arginine repressor	NA	NA	NA	NA	NA
WP_017377715.1|66539_67592_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377716.1|67594_69058_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377787.1|69192_69420_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 2
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	81102	130168	3186791	tRNA,transposase	Bacillus_phage(35.71%)	54	NA	NA
WP_017377787.1|81102_81330_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_047927746.1|82298_82886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|83488_84160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875918.1|84304_84886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420767.1|84928_85606_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875917.1|85884_86289_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_155764145.1|86228_86840_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	5.1e-13
WP_017377736.1|86899_87565_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017377737.1|87598_88144_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_155046615.1|88423_88585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774946.1|89281_89896_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_144420620.1|89822_91025_+	MFS transporter	NA	NA	NA	NA	NA
WP_155048063.1|91010_92006_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875916.1|92009_92414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|93381_93609_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971647.1|94577_95174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875914.1|95142_96303_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_017375625.1|97007_97235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875913.1|97231_98002_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017377194.1|97998_99312_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_027243130.1|100235_101105_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377197.1|101101_102451_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_017377198.1|102563_104204_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_027243131.1|104589_104856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377200.1|104985_105174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|105738_107142_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963580.1|107247_107472_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|107654_108476_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377842.1|108621_108876_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_155601396.1|108802_108958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377841.1|109264_111049_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_017377840.1|111137_111857_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_027243134.1|112018_112225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243135.1|112224_112461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|112473_112827_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243136.1|113364_114198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377835.1|114290_114488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063682.1|114585_115971_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377833.1|116097_116688_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_017377223.1|117718_118006_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|118065_118230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|118226_119597_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|119963_121376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|121445_122216_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_027243138.1|122708_122996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377700.1|124472_124766_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_144420618.1|124723_125545_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_026063680.1|125689_125914_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_155046618.1|126168_126696_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_080999968.1|126872_127133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420617.1|127051_127207_+	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|127305_128280_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999967.1|129608_129758_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377700.1|129874_130168_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
>prophage 3
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	140054	189159	3186791	tRNA,transposase	Staphylococcus_phage(21.43%)	50	NA	NA
WP_017376588.1|140054_141251_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_017376587.1|141375_142740_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376586.1|142736_143828_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376585.1|144082_144733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|144925_145120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|145227_145380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376583.1|145646_146774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063543.1|146863_147697_-	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376581.1|147700_148351_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_017376580.1|148340_149180_-	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_016210074.1|149185_149812_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376579.1|149972_150515_+	septation protein A	NA	NA	NA	NA	NA
WP_017376578.1|150598_150901_+	YciI family protein	NA	NA	NA	NA	NA
WP_144420763.1|150918_151161_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376576.1|151259_151532_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_017376575.1|151570_152209_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376574.1|152241_153333_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376573.1|153504_155247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|156175_157150_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376571.1|157316_159641_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_017376570.1|159815_160532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063542.1|160611_161226_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376568.1|161218_162601_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_017376567.1|162609_163083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|163215_164475_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_144420761.1|164998_165178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|165322_166033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046619.1|166100_166358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999966.1|166444_167794_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242585.1|168091_168649_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376558.1|168742_169249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376557.1|169753_170449_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_144420615.1|170579_171368_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_048876031.1|171401_172805_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875857.1|173227_174202_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017377787.1|174458_174686_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377821.1|175773_176304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377820.1|176300_177833_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|177829_178780_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|179200_179833_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|180075_180273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|180622_181051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|181128_182124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856754.1|182268_182520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|182624_183269_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|183504_184002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|184513_185488_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377700.1|185858_186152_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_017375632.1|186964_187300_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377815.1|187620_189159_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
>prophage 4
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	209182	257675	3186791	tRNA,transposase	Staphylococcus_phage(45.45%)	43	NA	NA
WP_036771639.1|209182_210157_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376009.1|211511_211802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376008.1|212124_213162_-	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376007.1|213192_214647_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376006.1|214656_215841_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376005.1|215914_216922_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376004.1|216990_218994_-	transketolase	NA	NA	NA	NA	NA
WP_017376003.1|219445_220606_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376001.1|220842_221958_+	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376000.1|222120_222645_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017375999.1|222644_223175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|224834_225710_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420759.1|225830_226331_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376501.1|226327_226594_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_048875903.1|226759_227734_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_075275269.1|227913_228534_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|228840_230244_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075286673.1|231078_231807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075286674.1|231938_232268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377263.1|232834_233302_-	DoxX family protein	NA	NA	NA	NA	NA
WP_017377264.1|233803_234058_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377265.1|234259_234763_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_036771941.1|234979_235585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210168.1|235745_236429_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|236504_237284_-	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_017377269.1|237270_238131_-	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377270.1|238254_238620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377271.1|239005_239335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|239745_240720_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_144420611.1|241254_241455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420610.1|241487_242867_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	3.3e-36
WP_017377275.1|243901_244624_+	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_017377276.1|244615_244984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243089.1|245246_246548_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377277.1|246643_247087_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_017377278.1|247090_247600_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377279.1|247592_250406_-|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_048875900.1|250902_251835_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377282.1|251939_252866_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_017377283.1|253044_254583_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|254756_255017_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377686.1|256291_256900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|256946_257675_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 5
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	322679	375718	3186791	transposase	Staphylococcus_phage(50.0%)	46	NA	NA
WP_048875857.1|322679_323654_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378343.1|323810_325385_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_017378342.1|325609_325888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378341.1|325957_326833_-	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_016210208.1|326842_328003_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_017378340.1|328117_329266_-	dihydrolipoyllysine-residue succinyltransferase	NA	NA	NA	NA	NA
WP_017378339.1|329276_332078_-	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_017378338.1|332184_332883_-	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_017378337.1|332895_334659_-	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_016210223.1|334662_335010_-	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_017378336.1|335003_335378_-	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_017378335.1|336325_337609_+	citrate synthase	NA	NA	NA	NA	NA
WP_017378334.1|338018_339314_+	MFS transporter	NA	NA	NA	NA	NA
WP_017378333.1|339669_340215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046622.1|340808_341324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420607.1|341335_342715_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_017378329.1|342962_343397_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_017378328.1|343393_344746_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_027242734.1|344745_345861_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_075286675.1|345861_346818_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_017378325.1|346866_348537_-	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_017378324.1|348556_348892_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_036772382.1|348919_350359_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_155764747.1|350355_351147_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_155764748.1|351140_351416_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017378320.1|351543_353040_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017378319.1|353335_354337_+	glucokinase	NA	NA	NA	NA	NA
WP_080963617.1|354442_355054_-	penicillin-binding protein activator LpoB	NA	NA	NA	NA	NA
WP_144420755.1|355174_355552_-	DUF1425 domain-containing protein	NA	NA	NA	NA	NA
WP_027242736.1|355602_357009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378315.1|357002_358070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378314.1|358176_359778_-	APC family permease	NA	NA	NA	NA	NA
WP_027242737.1|360026_360944_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242738.1|361012_362707_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
WP_017378310.1|362941_363871_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876031.1|363901_365305_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378308.1|365535_366240_+	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_017378307.1|366306_366963_+	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_036774478.1|366973_367855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242739.1|368025_370695_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036771639.1|371055_372030_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_036771744.1|372109_373081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|373134_374109_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772729.1|374228_374450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420754.1|374513_374822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|374746_375718_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	390281	444542	3186791	transposase	Staphylococcus_phage(37.5%)	51	NA	NA
WP_026063658.1|390281_391010_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_155764750.1|391319_391523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|392287_394942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378171.1|394980_395271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|395387_396686_+	MFS transporter	NA	NA	NA	NA	NA
WP_036772686.1|397256_397745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420604.1|397725_398028_+	VUT family protein	NA	NA	NA	NA	NA
WP_075275265.1|398274_398763_+	VUT family protein	NA	NA	NA	NA	NA
WP_027243073.1|398796_399435_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243074.1|399556_400096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|400185_401412_-	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_155046619.1|402024_402282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420603.1|402368_403268_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420602.1|403412_403679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046623.1|403670_403820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|404047_404923_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|405052_405280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815640.1|405346_405541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|405599_406574_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963634.1|406611_406800_+	DUF4286 family protein	NA	NA	NA	NA	NA
WP_017376778.1|406800_408573_-	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_144420601.1|408562_409555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376776.1|410162_410855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376774.1|411341_411911_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_036771639.1|411907_412882_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_080999963.1|412921_413425_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856766.1|413515_414919_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|415617_415803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|415908_417312_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420599.1|417316_417889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375939.1|417922_419350_-	amino acid permease	NA	NA	NA	NA	NA
WP_036772717.1|420635_423005_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
WP_017375937.1|423080_423899_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_027243188.1|424250_424796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971669.1|425278_426517_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|426493_427468_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017375625.1|427560_427788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376551.1|427792_428284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243039.1|428956_429844_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_027243038.1|429933_431424_-	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_017376549.1|431447_432329_-	ROK family protein	NA	NA	NA	NA	NA
WP_017376548.1|432325_433048_-	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376547.1|433747_434539_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|434725_434971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420598.1|435122_435353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376543.1|435382_436162_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_047927468.1|436187_436493_-	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_144420752.1|436489_437383_-	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_027243035.1|437738_439037_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376538.1|441639_442821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|443114_444542_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	452127	519070	3186791	tRNA,tail,transposase	Bodo_saltans_virus(14.29%)	55	NA	NA
WP_062312049.1|452127_453495_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243033.1|453987_454467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875888.1|454646_456710_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_144420751.1|456718_457444_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375919.1|458071_458785_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017375920.1|458789_459320_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375921.1|459554_459788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971668.1|459900_460149_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_144420596.1|460956_463149_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_017375924.1|463166_463475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|464128_465838_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017378284.1|466031_466187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|467589_468465_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243077.1|468790_469552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|469776_470508_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_017376852.1|470504_471041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376851.1|471094_471859_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376850.1|471861_473439_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376849.1|473445_473922_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|473897_474329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376847.1|474361_475117_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|475291_475579_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_027243078.1|475961_476186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|476525_477689_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243079.1|477723_478701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|478694_479381_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_017376843.1|479319_480435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243080.1|480714_481362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420595.1|481557_482037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|483859_484513_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_027243083.1|484625_485177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|485276_486251_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243084.1|486536_487061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376838.1|487757_488582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875886.1|488837_489194_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_053856766.1|489190_490594_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243085.1|490713_491274_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_017376236.1|491431_491998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243087.1|494866_495562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376234.1|495602_495815_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376229.1|497387_498497_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376228.1|498552_500034_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_048876031.1|500471_501875_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376227.1|501968_502418_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_027243088.1|502725_503511_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376226.1|503507_504491_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_017376225.1|504547_505819_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036772069.1|511249_511801_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017377639.1|511861_513223_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_017377638.1|513496_514777_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377637.1|514794_515451_+	DedA family protein	NA	NA	NA	NA	NA
WP_017377636.1|515496_516546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377635.1|516699_517554_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_036772063.1|517852_518665_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|518776_519070_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
>prophage 8
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	629268	744782	3186791	tRNA,protease,transposase	Escherichia_phage(19.05%)	106	NA	NA
WP_017376170.1|629268_630369_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376171.1|630726_631701_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771588.1|631837_632716_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_016209597.1|632723_632954_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771607.1|633007_634012_-	OmpA family protein	NA	NA	NA	NA	NA
WP_036771589.1|634230_635058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420747.1|635139_636528_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_017376176.1|636815_638216_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_017376177.1|638310_639237_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_027242699.1|639233_640370_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_027242700.1|640366_641374_-	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242701.1|641370_642534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376183.1|642543_643395_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242702.1|643426_644599_-	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_065653741.1|644595_645984_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_017376186.1|646012_646420_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_017376187.1|646439_647447_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376188.1|647443_648316_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_036771610.1|648312_649173_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_065653742.1|649174_651445_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_017376192.1|651446_652592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376193.1|652638_653124_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_027242703.1|653163_653787_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376237.1|659466_660219_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046626.1|660821_660989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243062.1|661550_662174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243063.1|662278_663067_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243064.1|663066_663798_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376241.1|663831_665559_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|665572_666634_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376243.1|666948_668163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376244.1|668295_668820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063518.1|669437_670286_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376247.1|670272_670971_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_017376248.1|671025_671787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376249.1|671779_672202_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376250.1|672331_672883_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376251.1|672938_673901_-	TonB family protein	NA	NA	NA	NA	NA
WP_144420746.1|673901_674117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|675091_675934_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376255.1|675930_677175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376256.1|677313_678402_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376257.1|678419_678920_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376258.1|679107_679707_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376259.1|679712_680876_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376260.1|680908_681862_+	glutathione synthase	NA	NA	NA	NA	NA
WP_017376261.1|682225_683290_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027243065.1|683286_686349_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_144420745.1|686501_686954_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243066.1|686985_687342_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772645.1|687760_688534_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017376269.1|691157_691448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|691672_692548_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|692544_693102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876031.1|693112_694516_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|694835_695054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|695208_696258_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|696865_697039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075286680.1|697243_697540_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764751.1|697512_698187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|698219_699623_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376738.1|700191_700530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420744.1|700539_701385_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_047927112.1|702081_702408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|702571_703267_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_027242560.1|703263_704685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963573.1|704762_705080_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242561.1|705245_706082_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|706082_706424_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242562.1|706425_707031_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_026063560.1|707027_709007_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017376729.1|709041_709983_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_017376728.1|710209_711628_+	MFS transporter	NA	NA	NA	NA	NA
WP_051929591.1|712024_712297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|712341_712695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|712727_713726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816796.1|714070_714517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|714614_715034_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376724.1|715280_715493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815787.1|715570_715888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|715907_716882_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_155046628.1|716961_717186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|717182_718586_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242752.1|720320_720953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376303.1|721144_721858_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_075275376.1|721916_722669_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376300.1|722781_723039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048876081.1|723183_723843_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017378498.1|724540_725197_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_027242751.1|725463_727005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773290.1|727531_728260_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242750.1|728373_730209_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_027242749.1|730265_731630_-	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_017378489.1|731723_732152_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209339.1|732176_733568_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_027242748.1|733598_734459_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_017378487.1|734484_736026_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_017378485.1|736580_737051_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209328.1|737105_737510_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378484.1|737561_738377_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_017378483.1|738381_738780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242747.1|738894_739785_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378481.1|739817_740702_-	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_017378480.1|740721_741348_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378479.1|741395_743288_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378478.1|743402_744782_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	779678	838960	3186791	tRNA,transposase	Staphylococcus_phage(28.57%)	53	NA	NA
WP_036772169.1|779678_780554_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378444.1|780912_782268_+	chloride channel protein	NA	NA	NA	NA	NA
WP_017378443.1|782359_782866_-	GrpB family protein	NA	NA	NA	NA	NA
WP_017378442.1|782862_783231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378441.1|784632_786417_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_017378440.1|786897_788025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378439.1|788097_788853_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_027242743.1|788889_791583_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
WP_036771562.1|791614_792166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063736.1|792273_793287_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017378435.1|793407_793632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378434.1|793987_794749_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_144420740.1|794891_795686_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875841.1|795830_796583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378433.1|796894_798421_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_065653750.1|798559_799633_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_027242742.1|799672_800980_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
WP_017378429.1|800954_802124_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_027242741.1|802178_802904_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_027242740.1|803369_805475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378426.1|805689_806154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420739.1|806173_806683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420738.1|807067_808009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856772.1|808290_809742_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051387.1|809855_810011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773655.1|810208_810613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|811173_812148_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_069971663.1|812882_813125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|813343_814318_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036773242.1|814357_814912_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_017378416.1|815092_815992_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080963576.1|815996_816623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242705.1|816567_818889_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_016210342.1|819035_819515_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_017378414.1|819511_820663_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_017378413.1|820797_821301_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_026063734.1|821394_822369_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_036773239.1|822358_823672_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_017378410.1|823712_825092_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_080963575.1|825098_826550_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|826575_826944_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_017378407.1|826962_828030_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_027242707.1|828062_828959_-	DMT family transporter	NA	NA	NA	NA	NA
WP_047927132.1|828955_829792_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_017378404.1|829927_830380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378403.1|830518_831265_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378402.1|831245_831809_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378401.1|831817_832333_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378400.1|832474_834553_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378399.1|834552_835503_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378398.1|836370_836769_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_075275373.1|836994_837324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875844.1|837940_838960_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	871068	990215	3186791	tRNA,protease,transposase	Staphylococcus_phage(11.76%)	104	NA	NA
WP_053093682.1|871068_871812_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929698.1|872252_872546_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_017377396.1|872546_872801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242714.1|872817_875310_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_017377399.1|875302_875986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377400.1|875985_877029_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_017377401.1|877028_878258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377402.1|878259_878589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377403.1|878585_879785_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_144420824.1|879897_880287_+	signal peptidase, peptidase S26 family protein	NA	NA	NA	NA	NA
WP_026063632.1|880286_881231_+	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_017377406.1|881350_882748_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
WP_017377407.1|883073_883595_+	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377408.1|883718_884027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875847.1|884041_889264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242717.1|889654_891661_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377568.1|891791_894122_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_144420823.1|894297_895128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773453.1|895244_895640_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_027242719.1|895636_896170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242720.1|896166_896568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875848.1|896962_897283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377563.1|897292_898249_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
WP_017377562.1|898758_899283_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_017377561.1|899383_900382_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_027242721.1|900470_901367_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080963593.1|901440_902727_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377557.1|903186_904503_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377556.1|904616_904787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|904806_905781_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377551.1|905907_906168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377550.1|906435_906726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377545.1|909264_910305_-	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_048875849.1|910407_911379_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377543.1|911501_912350_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_017377542.1|912501_912789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|913099_913471_+	isochorismatase	NA	NA	NA	NA	NA
WP_155046561.1|914892_915030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|915043_915256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377537.1|915779_916604_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210041.1|917934_919344_+	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_027242724.1|919491_921072_-	APC family permease	NA	NA	NA	NA	NA
WP_017377534.1|921811_922807_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242725.1|922812_924879_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_048875850.1|924936_925887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210045.1|926081_926408_+	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_026063646.1|926630_927890_+	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_036772663.1|928149_929025_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377528.1|929063_930026_+	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_017375799.1|935718_936063_-	DMT family protein	NA	NA	NA	NA	NA
WP_047927156.1|936159_937083_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375796.1|937582_938071_+	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_017375795.1|938173_938974_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375794.1|938984_940736_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_081000012.1|941625_941868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420737.1|941871_942270_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|943550_943778_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_081078121.1|943809_944610_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375951.1|945328_945787_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420736.1|945968_946154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|946869_948684_-	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_017375948.1|949094_949763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375947.1|949772_951089_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375945.1|951248_952211_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210730.1|952291_952447_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375944.1|952460_952697_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_036773720.1|952889_954107_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375942.1|954084_954543_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_017375941.1|954570_955950_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_075275379.1|955986_956205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|956524_957820_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|958024_958216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|958414_959290_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|959477_960743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875854.1|960776_961652_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378152.1|961773_962232_-	NfeD family protein	NA	NA	NA	NA	NA
WP_017378151.1|962255_963176_-	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378150.1|963303_964086_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378149.1|964176_965676_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_027242686.1|965989_967873_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_027242685.1|968132_968795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242684.1|968861_969971_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_017378146.1|969982_970627_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_017378145.1|970645_971632_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378144.1|971716_972793_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378143.1|972994_973819_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378142.1|974121_975087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378141.1|975405_976458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|976516_977491_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027242682.1|977826_978255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|978491_978974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378138.1|979029_980280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378137.1|980382_980601_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378136.1|981072_981927_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378135.1|981981_982452_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_026063709.1|982748_982985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063708.1|983131_983512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|983570_984446_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063707.1|985212_986124_+	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_017378132.1|986240_987089_+|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_065653735.1|987155_988166_+	lipase	NA	NA	NA	NA	NA
WP_017378129.1|988189_988513_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017375569.1|988523_988919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875856.1|989195_990215_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1064009	1106368	3186791	transposase	Chrysochromulina_ericina_virus(20.0%)	54	NA	NA
WP_036772169.1|1064009_1064885_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378046.1|1064965_1065598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378045.1|1065551_1066997_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_051929544.1|1067031_1067451_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017378043.1|1068224_1068593_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_017378042.1|1068602_1069142_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_017378041.1|1069302_1069734_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_017378040.1|1069737_1070436_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_017378039.1|1070683_1071190_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_017378038.1|1071232_1071601_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_017378037.1|1071871_1075948_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
WP_017378036.1|1076011_1080220_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_016209765.1|1080381_1080756_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_016209732.1|1080860_1081334_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_017378035.1|1081349_1083461_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209759.1|1083488_1084679_+	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_016209760.1|1084685_1084997_+	30S ribosomal protein S10	NA	NA	NA	NA	NA
WP_017378034.1|1085119_1085758_+	50S ribosomal protein L3	NA	NA	NA	NA	NA
WP_016209735.1|1085773_1086391_+	50S ribosomal protein L4	NA	NA	NA	NA	NA
WP_016209744.1|1086387_1086684_+	50S ribosomal protein L23	NA	NA	NA	NA	NA
WP_017378033.1|1086698_1087523_+	50S ribosomal protein L2	NA	NA	NA	NA	NA
WP_017378032.1|1087539_1087815_+	30S ribosomal protein S19	NA	NA	NA	NA	NA
WP_016209755.1|1087820_1088153_+	50S ribosomal protein L22	NA	NA	NA	NA	NA
WP_017378031.1|1088165_1088900_+	30S ribosomal protein S3	NA	NA	NA	NA	NA
WP_017378030.1|1088913_1089327_+	50S ribosomal protein L16	NA	NA	NA	NA	NA
WP_016209750.1|1089326_1089527_+	50S ribosomal protein L29	NA	NA	NA	NA	NA
WP_017378029.1|1089526_1089784_+	30S ribosomal protein S17	NA	NA	NA	NA	NA
WP_017378028.1|1089905_1090274_+	50S ribosomal protein L14	NA	NA	NA	NA	NA
WP_016209734.1|1090291_1090603_+	50S ribosomal protein L24	NA	NA	NA	NA	NA
WP_016209761.1|1090618_1091161_+	50S ribosomal protein L5	NA	NA	NA	NA	NA
WP_026063699.1|1091173_1091479_+	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_016209763.1|1091507_1091900_+	30S ribosomal protein S8	NA	NA	NA	NA	NA
WP_017378025.1|1091912_1092446_+	50S ribosomal protein L6	NA	NA	NA	NA	NA
WP_016209757.1|1092455_1092809_+	50S ribosomal protein L18	NA	NA	NA	NA	NA
WP_016209764.1|1092819_1093320_+	30S ribosomal protein S5	NA	NA	NA	NA	NA
WP_017378024.1|1093325_1093508_+	50S ribosomal protein L30	NA	NA	NA	NA	NA
WP_017378023.1|1093510_1093945_+	50S ribosomal protein L15	NA	NA	NA	NA	NA
WP_016209749.1|1093945_1095268_+	preprotein translocase subunit SecY	NA	NA	NA	NA	NA
WP_016209752.1|1095324_1095438_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_017378021.1|1095581_1095938_+	30S ribosomal protein S13	NA	NA	NA	NA	NA
WP_016209730.1|1095963_1096353_+	30S ribosomal protein S11	NA	NA	NA	NA	NA
WP_017378020.1|1096362_1096983_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_016209739.1|1097004_1097982_+	DNA-directed RNA polymerase subunit alpha	NA	NA	NA	NA	NA
WP_017378019.1|1098030_1098429_+	50S ribosomal protein L17	NA	NA	NA	NA	NA
WP_017378018.1|1098541_1099789_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_027242670.1|1099775_1100432_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_036772490.1|1100516_1100795_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1101037_1101265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875859.1|1101397_1102192_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_053856770.1|1102500_1103715_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|1104112_1104292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|1104260_1104914_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376985.1|1105289_1105538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771653.1|1105627_1106368_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
>prophage 12
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1115791	1170702	3186791	tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_017376975.1|1115791_1116343_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_017376974.1|1116353_1117721_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376973.1|1117871_1118108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376972.1|1118166_1118910_+	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_027242667.1|1118909_1119551_+	lipoprotein	NA	NA	NA	NA	NA
WP_017376970.1|1119550_1121215_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_017376969.1|1121243_1121579_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_027242666.1|1121743_1123342_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376966.1|1123401_1123692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772765.1|1123892_1124324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|1124386_1126867_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_017376963.1|1126953_1127433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772771.1|1127405_1128446_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_080963574.1|1128382_1129099_+	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_016210374.1|1129111_1129447_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_016210381.1|1129483_1129954_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_017376959.1|1129996_1131832_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_036818645.1|1131876_1132965_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376957.1|1132986_1134048_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_017376956.1|1134125_1134641_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376955.1|1134681_1135959_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376954.1|1135973_1136825_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376953.1|1136853_1137501_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026063584.1|1137497_1138457_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_036774534.1|1138548_1138974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|1138978_1139848_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875862.1|1139992_1140247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856769.1|1140391_1140958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|1141063_1141504_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_051929598.1|1141461_1141719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242664.1|1142015_1143218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|1143501_1144476_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_155046562.1|1144657_1144801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|1145519_1146131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376943.1|1146127_1146385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376942.1|1146635_1147028_-	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016210000.1|1147157_1147706_+	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_026063583.1|1147705_1148533_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_017376940.1|1148582_1150268_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_017376939.1|1150345_1150807_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_026063582.1|1150843_1151407_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209991.1|1151633_1151963_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_017376937.1|1151943_1152168_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_017376936.1|1152312_1152903_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376935.1|1152927_1154199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|1154216_1155470_+	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376933.1|1155466_1156111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376932.1|1156183_1157233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376931.1|1157334_1158972_+	response regulator	NA	NA	NA	NA	NA
WP_017376930.1|1159006_1159336_-	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376929.1|1159492_1159780_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376927.1|1160206_1160344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376925.1|1160848_1162069_-	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376924.1|1162127_1164926_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376923.1|1165230_1166397_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_036772950.1|1166495_1167032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376921.1|1167093_1167426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|1167683_1168586_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|1168655_1169153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1169298_1170702_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1244989	1291956	3186791	transposase	Streptococcus_phage(33.33%)	44	NA	NA
WP_048875872.1|1244989_1246273_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|1246445_1246583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875873.1|1246579_1247983_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927246.1|1248096_1248534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242638.1|1248654_1249083_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017375827.1|1249330_1249768_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|1250199_1251588_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_155764754.1|1251922_1253527_+	amino acid permease	NA	NA	NA	NA	NA
WP_036773936.1|1253721_1254477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420725.1|1254976_1255207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|1256311_1257322_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375821.1|1257318_1257540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242636.1|1258258_1259200_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026063480.1|1259727_1260126_+	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_075275366.1|1260065_1260920_+	MFS transporter	NA	NA	NA	NA	NA
WP_017375815.1|1261011_1261293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242634.1|1261378_1262056_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_026063478.1|1262101_1263382_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_017375812.1|1263557_1264607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375811.1|1264685_1265486_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375810.1|1265499_1266294_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375809.1|1266396_1267416_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375808.1|1267462_1268074_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375807.1|1268077_1268764_+	acireductone synthase	NA	NA	NA	NA	NA
WP_017375806.1|1268760_1269303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375805.1|1269595_1270783_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375804.1|1271027_1271753_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_144420816.1|1271938_1272727_+	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_047927106.1|1272723_1273119_-	YchJ family protein	NA	NA	NA	NA	NA
WP_017375801.1|1273511_1274552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|1274548_1275952_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|1278367_1278625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420723.1|1278664_1280050_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242633.1|1280379_1281477_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_017377120.1|1281510_1282761_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_017377119.1|1282761_1283394_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017377118.1|1283683_1284136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063598.1|1284181_1285024_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377116.1|1285058_1285550_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_017377115.1|1285745_1287713_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377113.1|1287940_1288345_+	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_047927448.1|1288322_1289351_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_027242632.1|1289337_1290126_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_053856766.1|1290552_1291956_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1331462	1465129	3186791	tRNA,plate,transposase	Staphylococcus_phage(13.64%)	109	NA	NA
WP_036772726.1|1331462_1332011_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
WP_017377077.1|1332763_1334143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|1334502_1335966_+	nuclease	NA	NA	NA	NA	NA
WP_017377075.1|1336149_1336962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377074.1|1337426_1339421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377073.1|1339815_1341195_+	MFS transporter	NA	NA	NA	NA	NA
WP_036774567.1|1341232_1341670_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036774569.1|1341712_1342429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|1343974_1344505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|1344571_1346392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|1346956_1347463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242613.1|1347547_1348951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|1349065_1349320_+	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_017377065.1|1349472_1349745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|1350320_1350503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|1350619_1351195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048025.1|1351176_1351362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242612.1|1352262_1352505_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_027242611.1|1352807_1353899_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377060.1|1353879_1354833_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_017377059.1|1355056_1356541_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_027242610.1|1356580_1357084_+	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_051929897.1|1357343_1358519_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_051929903.1|1358666_1359071_+	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_036772169.1|1359227_1360103_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242609.1|1360137_1360491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|1363820_1364246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|1364476_1365613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242608.1|1365599_1366922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377048.1|1366914_1368033_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377047.1|1368153_1368687_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377046.1|1368825_1370463_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377045.1|1370467_1370689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377044.1|1370797_1371811_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377043.1|1372073_1374302_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377041.1|1375220_1375550_+	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377039.1|1376950_1377169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1377227_1378103_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377037.1|1378095_1378962_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_017377036.1|1379029_1380349_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_036772137.1|1380818_1381379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856764.1|1381697_1382624_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376601.1|1383519_1384428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1388123_1388963_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376604.1|1389149_1389365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1389413_1389989_-	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376606.1|1389985_1390324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376607.1|1390492_1391482_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_051929685.1|1392471_1393374_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_048875984.1|1393633_1394170_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420814.1|1394314_1395232_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376610.1|1395666_1396677_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_017376611.1|1397483_1398020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764755.1|1399081_1399222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376613.1|1399232_1399580_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275357.1|1399724_1400684_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376616.1|1400785_1401568_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243116.1|1401700_1402660_+	response regulator	NA	NA	NA	NA	NA
WP_017376619.1|1402684_1403089_-	RidA family protein	NA	NA	NA	NA	NA
WP_026063546.1|1403117_1403792_-|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_027243117.1|1403891_1405607_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_016209558.1|1405603_1405966_+	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_026063550.1|1405980_1407135_+	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_017376622.1|1407138_1408146_+	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_017376623.1|1408148_1409165_+	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376624.1|1409380_1410466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376625.1|1410572_1410965_-	RidA family protein	NA	NA	NA	NA	NA
WP_027243118.1|1411097_1412381_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_027243119.1|1412396_1413698_+	aspartate kinase	NA	NA	NA	NA	NA
WP_036772145.1|1413715_1415518_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420721.1|1415522_1416515_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376630.1|1416595_1417672_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017376631.1|1417769_1418744_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_144420813.1|1418811_1419783_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376633.1|1419966_1420236_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036772149.1|1422187_1422868_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376024.1|1428523_1428772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816881.1|1428849_1429068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365741.1|1429751_1430354_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_027242570.1|1430567_1431707_-	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_017376020.1|1431915_1433286_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_017376019.1|1433664_1434657_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376018.1|1434660_1435176_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376017.1|1435172_1436012_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_027242569.1|1436044_1437595_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376015.1|1437702_1438074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376011.1|1439294_1439456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1440036_1441440_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375660.1|1441474_1441912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1441935_1442910_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036774104.1|1442968_1443397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376321.1|1443584_1444391_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_017376322.1|1444465_1444858_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376323.1|1444902_1445724_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376324.1|1445736_1446720_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376325.1|1446721_1447990_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_048876074.1|1447996_1450501_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376328.1|1450631_1451657_+	phosphotransferase	NA	NA	NA	NA	NA
WP_080963653.1|1452287_1453118_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376331.1|1453267_1453651_+	response regulator	NA	NA	NA	NA	NA
WP_027242863.1|1453685_1454585_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_027242862.1|1454630_1455302_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_017376334.1|1455384_1455960_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_017376335.1|1456058_1456859_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376336.1|1457000_1457858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1458720_1459857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242860.1|1459923_1463094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242859.1|1463106_1463817_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242858.1|1463821_1465129_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 15
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1473771	1520070	3186791	plate,transposase	Staphylococcus_phage(21.43%)	50	NA	NA
WP_017376356.1|1473771_1474170_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_027242851.1|1474166_1475855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242850.1|1475836_1476793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|1476835_1477351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|1477455_1478388_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_017376360.1|1478607_1478994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376361.1|1479011_1479656_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376362.1|1479806_1480646_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376363.1|1480721_1481324_+	signal peptidase I	NA	NA	NA	NA	NA
WP_017376364.1|1481324_1482179_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_017376365.1|1482536_1482848_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017376366.1|1482872_1484261_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|1484416_1485148_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_027242849.1|1485144_1485672_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|1485703_1486261_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242848.1|1486266_1487247_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209539.1|1487386_1488187_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_017376369.1|1488190_1488958_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_017376370.1|1488954_1489419_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_017376371.1|1489441_1490095_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017376372.1|1490098_1490446_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017376373.1|1490479_1490731_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|1490807_1492076_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242847.1|1492078_1492837_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_017376376.1|1492898_1493789_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|1493839_1494523_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_017376377.1|1494532_1494880_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_069971660.1|1495152_1497258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376380.1|1498288_1500118_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_075286697.1|1500285_1500867_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_144420811.1|1501250_1501697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|1501714_1501888_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_017376383.1|1501946_1502996_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_017376384.1|1503002_1503953_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_017376385.1|1504007_1504952_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_017376386.1|1504979_1505717_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|1505805_1506048_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|1506122_1507346_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_017376387.1|1507377_1508226_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_017376388.1|1508222_1509275_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_017376389.1|1509411_1510032_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
WP_087910645.1|1510257_1511410_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_036771330.1|1512430_1513405_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046570.1|1513401_1513572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971647.1|1514540_1515137_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876071.1|1515105_1516266_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_017377691.1|1516776_1517118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377690.1|1517221_1518256_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|1518252_1518963_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_036771330.1|1519095_1520070_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 16
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1528230	1582539	3186791	tRNA,protease,transposase	Prochlorococcus_phage(37.5%)	50	NA	NA
WP_017377942.1|1528230_1528737_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243058.1|1528818_1529235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377818.1|1529326_1530013_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155764733.1|1530033_1530186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420810.1|1530283_1530829_+	chorismate lyase	NA	NA	NA	NA	NA
WP_017377937.1|1530911_1531763_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_048876070.1|1531804_1534711_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|1534771_1534969_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_017377935.1|1534975_1535986_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_017377934.1|1535982_1537041_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_087910662.1|1537055_1537835_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027243055.1|1537837_1538650_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377933.1|1538661_1539609_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_144420809.1|1539619_1540912_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377931.1|1541090_1542194_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_017377930.1|1542190_1542583_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_027243054.1|1542595_1543972_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377929.1|1543965_1545435_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_155764740.1|1545741_1546062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910651.1|1546357_1546534_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_047927390.1|1547502_1548594_+	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	31.7	3.4e-36
WP_017377925.1|1549095_1549488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774583.1|1550880_1551531_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_155046574.1|1552229_1553024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876067.1|1553203_1553848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1554022_1554997_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377920.1|1555397_1555655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420808.1|1557332_1558010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243155.1|1558243_1559068_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377914.1|1559161_1559875_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_017377913.1|1559964_1561056_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377912.1|1561127_1561709_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377911.1|1561714_1562341_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_026063691.1|1562437_1563385_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_065653730.1|1563731_1564394_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_017377908.1|1564564_1565224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377907.1|1565392_1566652_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377906.1|1566648_1567734_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377905.1|1567726_1568608_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_027243154.1|1568596_1569847_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_144420719.1|1571232_1571553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1571811_1572078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1572568_1572787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420718.1|1573772_1573994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1573990_1575073_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063690.1|1575083_1575455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773050.1|1575451_1575631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1578334_1578610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1579445_1580903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048033.1|1581330_1582539_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1626219	1688954	3186791	tRNA,transposase	Staphylococcus_phage(28.57%)	54	NA	NA
WP_048875904.1|1626219_1627095_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376744.1|1627351_1627789_-	DUF1841 family protein	NA	NA	NA	NA	NA
WP_017376743.1|1627849_1628482_-	endonuclease III	NA	NA	NA	NA	NA
WP_017376742.1|1628497_1629145_-	RnfABCDGE type electron transport complex subunit B	NA	NA	NA	NA	NA
WP_027242971.1|1629147_1631211_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
WP_027242972.1|1631537_1632830_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242973.1|1633218_1635429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242974.1|1635445_1636102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242975.1|1638487_1639363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420805.1|1639621_1640233_+	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_027242976.1|1640660_1643249_+	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
WP_017375712.1|1643351_1644113_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242977.1|1644109_1644646_-	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375710.1|1644694_1645651_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242978.1|1645728_1648914_-	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_017375707.1|1648917_1649973_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
WP_027242979.1|1650202_1650805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375705.1|1650848_1651511_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_017375704.1|1651545_1651893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375702.1|1652361_1653393_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|1653854_1655258_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242980.1|1656376_1656721_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027242981.1|1656812_1657268_+	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_144420715.1|1657516_1657651_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377756.1|1657643_1658285_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|1658281_1658998_-	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377754.1|1659001_1660321_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_155051395.1|1661002_1661146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377751.1|1662125_1664762_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_036773645.1|1664803_1665889_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377749.1|1665888_1666572_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_017377748.1|1666632_1668294_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377747.1|1668446_1668701_+	LapA family protein	NA	NA	NA	NA	NA
WP_017377746.1|1668779_1669097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377745.1|1669249_1669648_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242983.1|1669729_1670368_+	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_036771330.1|1670524_1671499_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420804.1|1671871_1672147_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1672696_1672981_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772261.1|1674797_1675391_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_155764756.1|1675730_1676408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243172.1|1676695_1677577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376527.1|1677688_1679368_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_017376526.1|1679494_1680745_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376525.1|1680820_1681282_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376524.1|1681278_1682427_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376523.1|1682432_1683107_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376522.1|1683103_1683760_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376521.1|1683885_1684359_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376520.1|1684360_1684783_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_047927196.1|1684769_1685789_+	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_155046578.1|1685947_1686127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243174.1|1686345_1686627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|1688078_1688954_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1692856	1759817	3186791	tRNA,protease,transposase	Bacillus_phage(22.22%)	56	NA	NA
WP_062365735.1|1692856_1694260_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1694618_1695386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1695499_1696903_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046579.1|1696899_1697061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1697376_1698351_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376505.1|1698591_1699875_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376506.1|1699941_1700865_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376509.1|1703060_1705205_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_016210310.1|1705226_1705433_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376510.1|1705493_1706114_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_017376511.1|1706154_1707048_-	YicC family protein	NA	NA	NA	NA	NA
WP_016210308.1|1707133_1707859_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210305.1|1707920_1708325_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_027243115.1|1708487_1710596_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_017376514.1|1710719_1711769_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376515.1|1711765_1713232_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376516.1|1713374_1714712_+	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_047927029.1|1714779_1716270_-	nuclease	NA	NA	NA	NA	NA
WP_017376518.1|1716497_1716869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|1717019_1717847_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_027243112.1|1718149_1718806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927028.1|1718753_1719677_-	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036774751.1|1719690_1720614_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420713.1|1720843_1721545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1723244_1723472_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376989.1|1723796_1724345_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017376990.1|1724425_1724701_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_027242882.1|1724700_1725750_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376991.1|1725862_1727800_-	AsmA family protein	NA	NA	NA	NA	NA
WP_080963631.1|1727947_1729660_+	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376994.1|1729728_1730448_+	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_017376995.1|1730444_1731047_+	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376996.1|1731161_1732049_-	ROK family protein	NA	NA	NA	NA	NA
WP_016210463.1|1732239_1732587_+	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376997.1|1732637_1733477_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_017376998.1|1733572_1734319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063589.1|1734515_1735142_+	porin family protein	NA	NA	NA	NA	NA
WP_017377000.1|1735457_1736027_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017377001.1|1736170_1736869_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_155764757.1|1737218_1737467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377003.1|1737575_1738199_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_052106204.1|1738308_1739202_+	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377006.1|1739308_1740919_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_027242880.1|1740915_1742211_-	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_027242879.1|1742232_1744155_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_017377007.1|1744265_1744568_+	DUF2835 family protein	NA	NA	NA	NA	NA
WP_017377008.1|1744662_1749549_+	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_047927528.1|1749596_1750919_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_036771855.1|1751043_1752138_+	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_026063591.1|1753207_1753792_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242876.1|1754176_1755067_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_017377014.1|1755269_1755761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242875.1|1755900_1756392_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209885.1|1756560_1757274_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242874.1|1757702_1758677_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_048875904.1|1758941_1759817_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1765430	1827658	3186791	transposase	Staphylococcus_phage(33.33%)	57	NA	NA
WP_017377787.1|1765430_1765658_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377021.1|1765684_1766725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377022.1|1766791_1767361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1767591_1767996_+	SufE family protein	NA	NA	NA	NA	NA
WP_017377024.1|1768008_1768149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929560.1|1768243_1769443_+	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_016211971.1|1769463_1770075_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_027242871.1|1770276_1771038_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_080963583.1|1771333_1772260_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_144420803.1|1772420_1773377_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999998.1|1773521_1773791_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1774057_1775032_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375625.1|1775185_1775413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420711.1|1775529_1775955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|1776111_1777041_+	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_027242870.1|1777487_1778018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|1778339_1778645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|1779122_1779434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963609.1|1779773_1780940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1783127_1784099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046581.1|1784701_1784875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376283.1|1785270_1786188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376284.1|1786188_1787040_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016211518.1|1787480_1788527_+	glutathione synthase	NA	NA	NA	NA	NA
WP_144420802.1|1788516_1790508_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_036773579.1|1790617_1790992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420801.1|1791245_1791428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1791689_1792391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420709.1|1792391_1792811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1794497_1797248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376294.1|1797483_1798776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1799262_1800168_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376296.1|1800945_1801662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420658.1|1801947_1802709_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_048876053.1|1802741_1804145_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|1804141_1804306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|1804365_1804653_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017375910.1|1805397_1806126_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_048876052.1|1806094_1806841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420708.1|1806921_1807311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1807307_1808282_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036772454.1|1808438_1808756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243100.1|1808960_1811144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1811614_1811887_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_017377863.1|1814420_1814858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1815459_1816647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963626.1|1816917_1818552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|1818602_1819331_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377858.1|1820470_1821433_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377857.1|1821646_1822642_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377856.1|1822669_1823605_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1823648_1824110_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080963625.1|1824088_1824706_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1824735_1825710_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377852.1|1825764_1826232_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377851.1|1826244_1826889_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1826929_1827658_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
>prophage 20
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1836357	1897163	3186791	transposase	Acinetobacter_phage(20.0%)	49	NA	NA
WP_082300708.1|1836357_1836918_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378014.1|1838242_1838638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1838646_1839003_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_048876047.1|1838995_1839871_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420706.1|1839956_1840535_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876046.1|1840492_1840786_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_047927811.1|1841746_1843258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|1843505_1843817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1843813_1844896_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999997.1|1845101_1845536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275341.1|1845618_1846323_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1846581_1847070_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_051929548.1|1847098_1847773_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1848013_1848889_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375657.1|1849092_1849275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|1849418_1850027_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375723.1|1850297_1850756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375724.1|1851034_1851424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1851609_1852425_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375727.1|1852647_1853553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211119.1|1853716_1854478_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375728.1|1854481_1855348_+	OmpA family protein	NA	NA	NA	NA	NA
WP_017375729.1|1855433_1856045_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375730.1|1856423_1857671_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_144420800.1|1857822_1858524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1858821_1858995_-	phosphatase	NA	NA	NA	NA	NA
WP_048876044.1|1859484_1859985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1861063_1861291_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420705.1|1861376_1861577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1861605_1862286_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_027242790.1|1862308_1864483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378188.1|1864728_1865799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1865795_1867199_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378190.1|1867341_1867833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242789.1|1867904_1868726_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378192.1|1869392_1870892_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_017378193.1|1871195_1873889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1873885_1877287_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378195.1|1877931_1878180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1878874_1880278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378201.1|1881356_1882028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1884936_1885911_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378207.1|1886619_1887375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1887669_1889220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1890002_1890626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929892.1|1891022_1894145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242785.1|1894577_1895594_+	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929890.1|1895618_1896167_+	chorismate mutase	NA	NA	NA	NA	NA
WP_036771347.1|1896185_1897163_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 21
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1911757	1952862	3186791	transposase	Staphylococcus_phage(28.57%)	41	NA	NA
WP_053093677.1|1911757_1912477_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_155046584.1|1912704_1912881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375975.1|1913129_1913453_+	YqcC family protein	NA	NA	NA	NA	NA
WP_036771316.1|1913541_1915560_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375977.1|1915582_1916536_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375978.1|1916701_1917889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876036.1|1918602_1919241_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_036771312.1|1919538_1920534_-	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_027242772.1|1920674_1921721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1921713_1922739_+	FUSC family protein	NA	NA	NA	NA	NA
WP_017375766.1|1922805_1924836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1926142_1926370_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375561.1|1927713_1927857_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_062365727.1|1927853_1928546_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420703.1|1928806_1929130_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_027242770.1|1929272_1929683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242769.1|1929839_1930166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963649.1|1930312_1931350_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242767.1|1931391_1931637_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_129556541.1|1931761_1932076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242765.1|1932083_1933658_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242764.1|1933812_1934382_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242763.1|1934691_1936494_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_087910649.1|1936490_1937432_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036771308.1|1937459_1937681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242761.1|1937843_1938518_+	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_144420798.1|1938523_1939423_+	GTPase Era	NA	NA	NA	NA	NA
WP_027242759.1|1939436_1940180_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_027242758.1|1940182_1940914_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242757.1|1940910_1941294_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242756.1|1941431_1942679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242755.1|1943089_1944235_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242754.1|1944227_1944581_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242753.1|1944861_1945404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927692.1|1946048_1946237_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1946256_1947231_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420702.1|1947274_1948150_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036815628.1|1948503_1949331_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080963648.1|1949430_1949592_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017375762.1|1950242_1951583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1952634_1952862_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 22
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	1964686	2025334	3186791	tRNA,transposase	Staphylococcus_phage(40.0%)	55	NA	NA
WP_048876031.1|1964686_1966090_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242999.1|1967056_1968151_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_027242998.1|1968232_1968754_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242997.1|1968807_1969284_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242996.1|1969325_1969622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242995.1|1969686_1970394_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242994.1|1970770_1971169_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242993.1|1971214_1971646_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242992.1|1971656_1972340_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|1972414_1974610_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242991.1|1974714_1975452_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_027242990.1|1975479_1976265_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242989.1|1976310_1977015_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_087910648.1|1977002_1978190_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242987.1|1978244_1979078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242986.1|1979147_1982135_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242985.1|1982176_1983568_+	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_080963581.1|1983581_1984043_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_047927184.1|1984052_1984397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1984393_1985269_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876030.1|1985338_1986442_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774087.1|1986509_1986833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242984.1|1986989_1987772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063491.1|1987907_1988885_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_047927375.1|1988958_1990950_+	TRAP transporter permease	NA	NA	NA	NA	NA
WP_017375900.1|1991005_1991287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|1991540_1992740_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_051929862.1|1995171_1995684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1995870_1996746_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375562.1|1996782_1996947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1998155_1998569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774270.1|1998579_1998915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420796.1|1999059_2000178_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876026.1|2000407_2000674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2001956_2002184_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773258.1|2002194_2002701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243127.1|2002778_2003396_-	VOC family protein	NA	NA	NA	NA	NA
WP_017376680.1|2003527_2004760_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_017376681.1|2004749_2005412_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_026063554.1|2005686_2006943_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376683.1|2007813_2008515_+	cyclase family protein	NA	NA	NA	NA	NA
WP_036771330.1|2009262_2010237_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376688.1|2011445_2011799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107517381.1|2012012_2012207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|2012274_2012787_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376691.1|2012924_2013779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|2013827_2014472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|2014505_2015150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243125.1|2015671_2015965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376695.1|2016063_2016846_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_017376696.1|2016928_2017879_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_027243124.1|2019921_2022762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376700.1|2022784_2023366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376701.1|2023485_2024214_+	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_036771330.1|2024359_2025334_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 23
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2030745	2097143	3186791	transposase	Staphylococcus_phage(20.0%)	55	NA	NA
WP_080999995.1|2030745_2032116_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376714.1|2032800_2033454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242970.1|2033513_2035493_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_026063557.1|2035623_2036442_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_087910646.1|2036526_2037651_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063558.1|2037653_2038220_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_017375873.1|2039411_2039573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|2040244_2041219_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375871.1|2041443_2041992_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_144420795.1|2042119_2042797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|2042913_2046405_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_017375867.1|2046462_2047716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375866.1|2047825_2048728_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375865.1|2048782_2049820_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375864.1|2049957_2051196_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_047927270.1|2051188_2051914_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375862.1|2052017_2053745_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016211829.1|2054045_2054399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375861.1|2055095_2055596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876023.1|2055935_2057039_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_087910645.1|2057129_2058282_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876022.1|2058695_2059547_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420700.1|2059684_2059834_-	phosphatase	NA	NA	NA	NA	NA
WP_017377952.1|2060458_2062825_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_017377953.1|2062872_2064069_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_027242965.1|2064637_2067070_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036773041.1|2067391_2068891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242964.1|2068999_2069572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|2069886_2071356_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017377960.1|2071428_2072178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876021.1|2072181_2072955_-	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_027242961.1|2073053_2074004_-	DMT family transporter	NA	NA	NA	NA	NA
WP_017377963.1|2074143_2075586_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242960.1|2075801_2076986_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377966.1|2077109_2077796_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_026063694.1|2077931_2078516_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_144420699.1|2078605_2078935_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_017377969.1|2079270_2079510_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_017377970.1|2079558_2079750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275334.1|2080524_2080818_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017378162.1|2081642_2082182_-	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|2082520_2083165_-	porin family protein	NA	NA	NA	NA	NA
WP_017378160.1|2083498_2084149_-	porin family protein	NA	NA	NA	NA	NA
WP_017378159.1|2084672_2085725_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378158.1|2085742_2088823_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242571.1|2088988_2089237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772663.1|2089302_2090178_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036772025.1|2091098_2091605_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_027243218.1|2091622_2091820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|2091838_2091982_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046586.1|2092049_2092223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2092427_2093741_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_081000010.1|2093750_2094014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2094072_2095047_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377787.1|2096915_2097143_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 24
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2128359	2176969	3186791	tRNA,transposase	Bacillus_thuringiensis_phage(25.0%)	38	NA	NA
WP_036772026.1|2128359_2129235_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242912.1|2129339_2132642_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_017376668.1|2132638_2134462_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_017376669.1|2134501_2134900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242911.1|2135008_2136025_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376671.1|2136459_2137812_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376672.1|2137994_2141051_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017376676.1|2142945_2143410_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_075275332.1|2143482_2144484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771585.1|2147376_2147709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420693.1|2148070_2148214_-	phosphatase	NA	NA	NA	NA	NA
WP_048876152.1|2148201_2149146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420692.1|2149149_2149539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275328.1|2149357_2149696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376273.1|2150070_2150670_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_017376274.1|2150669_2151017_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_026063520.1|2151167_2152151_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376276.1|2153060_2153375_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_144420691.1|2153523_2153682_-	phosphatase	NA	NA	NA	NA	NA
WP_144420690.1|2153653_2154583_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_026063521.1|2155497_2155914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|2157042_2157759_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376099.1|2158507_2158666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|2158714_2159290_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075275424.1|2159434_2159713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376100.1|2159777_2160653_-	ParA family protein	NA	NA	NA	NA	NA
WP_048876018.1|2160818_2164685_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376103.1|2164840_2165650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376104.1|2165699_2166521_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376105.1|2166720_2167953_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376106.1|2168123_2168849_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376107.1|2168891_2170430_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376108.1|2170436_2171822_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_048876011.1|2172135_2173185_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|2173744_2174122_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420688.1|2174313_2175189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2176170_2176398_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876149.1|2176450_2176969_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2181266	2367891	3186791	tRNA,protease,integrase,transposase	Staphylococcus_phage(19.51%)	168	2288694:2288753	2316158:2317152
WP_048875984.1|2181266_2181803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876016.1|2181947_2182358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876015.1|2182628_2183033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|2183237_2183573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375878.1|2183910_2184183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243180.1|2184254_2185514_-	phosphoesterase	NA	NA	NA	NA	NA
WP_017375881.1|2185598_2186864_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_026063485.1|2187022_2187505_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_036772592.1|2187582_2189043_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_155046587.1|2189165_2189306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|2189719_2190220_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_017375698.1|2196334_2197528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243221.1|2197871_2199500_+	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_027243222.1|2199515_2200664_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_051929845.1|2200738_2201563_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876007.1|2201966_2202941_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927610.1|2203126_2203720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|2203900_2204365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910660.1|2204759_2205041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2205037_2206441_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377324.1|2207092_2207473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|2207712_2208369_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_036773200.1|2208513_2208810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|2208869_2209157_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_027243051.1|2209440_2209650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772296.1|2210346_2210724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|2210923_2211973_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377209.1|2211949_2213767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|2214036_2214615_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_065653751.1|2214642_2215107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377206.1|2215143_2216601_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_075286718.1|2216649_2218149_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377202.1|2218918_2219521_-	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_017377201.1|2220082_2220553_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_036772316.1|2222200_2222944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275422.1|2223095_2223527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764759.1|2224211_2224919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243044.1|2226163_2227510_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_036772310.1|2227597_2229403_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_017378301.1|2229868_2230666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378302.1|2231050_2231512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2231734_2232709_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963614.1|2232751_2232874_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376833.1|2232945_2234901_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|2235290_2235476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376832.1|2235797_2236787_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_027243043.1|2237199_2238825_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376830.1|2238933_2239248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|2239543_2240929_+	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376829.1|2241093_2241321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|2241461_2241920_-	amino acid permease	NA	NA	NA	NA	NA
WP_144420685.1|2242120_2242306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|2242374_2243202_-	DsbA family protein	NA	NA	NA	NA	NA
WP_144420792.1|2243656_2244181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420684.1|2244363_2244612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243041.1|2244781_2245735_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_036771330.1|2245929_2246904_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048876009.1|2247031_2248057_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|2248709_2248997_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929542.1|2249056_2249389_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377820.1|2249593_2250154_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_017376814.1|2252748_2253474_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_026063564.1|2253848_2256668_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_048876146.1|2257517_2258651_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_017376809.1|2258875_2260645_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_017376808.1|2260783_2261827_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376807.1|2261840_2262584_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_027243093.1|2262696_2263014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243094.1|2263317_2264025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420791.1|2264808_2266020_+	protein kinase	NA	NA	NA	NA	NA
WP_017376801.1|2266075_2266900_-	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_017376798.1|2268087_2268723_-	LysE family translocator	NA	NA	NA	NA	NA
WP_017376797.1|2269004_2269364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|2269637_2271923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420683.1|2271911_2272568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|2272744_2273377_+	MarC family protein	NA	NA	NA	NA	NA
WP_027243097.1|2273412_2273598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243098.1|2273663_2274809_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243099.1|2275044_2276358_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_155046588.1|2277473_2277683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420682.1|2278217_2278379_-	phosphatase	NA	NA	NA	NA	NA
WP_017376785.1|2279785_2280691_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376784.1|2280931_2281117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242578.1|2281153_2281690_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_027242577.1|2281707_2283009_+	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_048876008.1|2283005_2283980_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_155046589.1|2284059_2284209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046590.1|2284388_2284553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|2284554_2285430_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|2285720_2285885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|2285886_2286762_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420680.1|2287077_2287998_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_017375696.1|2288013_2288397_-	hypothetical protein	NA	NA	NA	NA	NA
2288694:2288753	attL	TCTGACTCCTGATGAAAAGGCTGAGCTTCAATCCCTGCGAAAGAAAGTAAAGCAACTGCA	NA	NA	NA	NA
WP_144420679.1|2288723_2289680_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_027243017.1|2290436_2291780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046591.1|2291953_2292097_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876007.1|2292176_2293151_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_047927346.1|2293298_2295170_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_075275322.1|2295202_2295301_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017378518.1|2295536_2296166_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017378517.1|2296149_2296572_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378516.1|2296578_2298318_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378515.1|2298318_2299383_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|2299386_2299740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|2299872_2300841_+	ferrochelatase	NA	NA	NA	NA	NA
WP_017378513.1|2300850_2301162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|2301177_2301747_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378512.1|2302010_2303339_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_036771639.1|2303379_2304354_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420677.1|2304940_2305342_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243019.1|2305861_2308432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773893.1|2308520_2309372_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075286734.1|2309428_2311123_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_069971648.1|2312594_2313569_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_047927336.1|2313931_2314177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065653736.1|2314540_2315569_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_017375591.1|2315699_2315903_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420679.1|2316187_2317144_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_047927838.1|2317436_2317682_+	hypothetical protein	NA	NA	NA	NA	NA
2316158:2317152	attR	TCTGACTCCTGATGAAAAGGCTGAGCTTCAATCCCTGCGAAAGAAAGTAAAGCAACTGCAGATGGAGAAAGAAATTTTAAAAAAGGCGAGTGCCTTCTTCGCGAAAGAAATGAAGTAAAATTTAATTTTATTCGGAAGAACAAAGTGTTATATCCTATTAATCTGACCTGTAAAGTGATGAAGGTAAGCCGTTCTGCCTTTTATGCTTGGGACAAGCGGCCTGCTAAAGTGATTTCAATTGAAGAGCTTCAGCTTTATCGGCGCTGTAAGGAGCTTTTTAAAGAAAGTCGCGGCAGCTTAGGATCACGAATGATGGCATATAAACTTCAAGAAGAAGGCTTTCAAGTAGGCCGTTATCGGGCGAGAAGCCTAATGCAAAAACTCGGTTTAAAGGTGCTGCAACGTAAAGCTTATAAAGTGACAACTAAGCGTAAGCACCATCACGCTGTTGCAGATAACGTATTGAATCAGCAGTTTAATCCAGTCATTGCAAATCACTCATGGGCAGGTGACATTACCTACCTTAGAACTGCTGAAGGCTGGTTGTATCTTGCGGTCGTTATTGATTTATACTCTCGAAAAGTGATTGGCTGGGCGATGAATAAGAGAATGAGCGAAAATCTAGTTTGTCGTGCAATGGATATGGCGATTCACTTGCGGCAGCCGACAGAACACTTGTTATTTCACAGTGATCGTGGTTCGCAGTATACCAGTAAAAAATATCGAAAACTGTTGAAGAAGCATAAAATCACCGCTTCTATGAGCAGTGTCGGTGCTTGCGTTGACAATGCGGTTGTCGAGCGTTTTTTTGGCAGCCTAAAGCACGAATGGCTGTTGAATGTGATTCACTTAACCCGTGATACTATGAAGGAGGATGTTGAGGCCTATATTCGATATTACAATCATGATCGGTTGCATACAGCCAATGGTAACCTATCGCCTATTAATTTTGAAAAGTCTCAATTAAAAGTGTCCAATATGACTTGACCAGAACA	NA	NA	NA	NA
WP_016212018.1|2317678_2317978_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_036774927.1|2318200_2318671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|2319281_2319509_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036772851.1|2320731_2321049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243023.1|2321042_2321285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243024.1|2321635_2322736_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_017377328.1|2322904_2324206_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_047927520.1|2324282_2324786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2324961_2326365_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772872.1|2326552_2327410_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243025.1|2327534_2328170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|2328218_2328470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243027.1|2328725_2329625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|2329761_2330835_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_017375995.1|2330935_2331349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375994.1|2331369_2332083_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_027243028.1|2332270_2333683_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243029.1|2333892_2334861_+	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_075275321.1|2335594_2335963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420675.1|2335966_2336284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2336359_2337334_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375989.1|2337853_2338354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243163.1|2338424_2339753_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|2339888_2341277_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243165.1|2341424_2342735_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|2343075_2344359_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_017375982.1|2344432_2345053_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_051929832.1|2345251_2345512_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_155046592.1|2345714_2345861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774659.1|2345836_2346130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|2348292_2348511_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036772303.1|2349763_2350534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420790.1|2350620_2350836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376496.1|2350932_2352054_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036771330.1|2352320_2353295_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771628.1|2353557_2354679_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_017376491.1|2354971_2355259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420674.1|2355231_2355735_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_053093673.1|2355815_2356475_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876005.1|2356816_2357734_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_075275317.1|2357863_2358037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|2358702_2360061_-	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_017376486.1|2360135_2360699_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376485.1|2360893_2362123_-	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_017376484.1|2362168_2362795_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_027242833.1|2362944_2364132_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_048876004.1|2364140_2364833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910642.1|2364954_2366107_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876002.1|2366907_2367891_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
>prophage 26
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2426220	2516531	3186791	tRNA,protease,transposase	Burkholderia_phage(14.29%)	85	NA	NA
WP_036774017.1|2426220_2427096_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377182.1|2427485_2427824_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_026063604.1|2427820_2428417_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_027242821.1|2428419_2430414_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_017377185.1|2430477_2431416_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_036771332.1|2431764_2432739_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_080999986.1|2432942_2433140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000007.1|2433301_2433706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816928.1|2435289_2435730_+	universal stress protein	NA	NA	NA	NA	NA
WP_048875996.1|2436056_2436932_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420669.1|2436944_2437187_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275315.1|2437593_2437848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|2439059_2440025_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420668.1|2440117_2440429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|2440629_2441406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816899.1|2442235_2442427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377573.1|2443155_2444205_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_017377574.1|2444375_2445149_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377575.1|2445209_2446799_-	APC family permease	NA	NA	NA	NA	NA
WP_017377576.1|2446989_2448081_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377577.1|2448103_2448421_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377578.1|2448507_2449785_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377579.1|2449806_2450643_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377580.1|2450649_2452284_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_026063647.1|2452715_2453075_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377583.1|2453356_2454715_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_017377584.1|2454740_2454983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376600.1|2455476_2455656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|2455911_2457168_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377585.1|2457281_2457539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420667.1|2457683_2458694_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_144420786.1|2459070_2459925_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|2459954_2460788_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_036773204.1|2461364_2462138_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_047927606.1|2462219_2462540_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_144420665.1|2462758_2463664_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_048875992.1|2463749_2464148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|2464292_2464790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242786.1|2466462_2467554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929549.1|2467652_2468030_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2468109_2469084_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_080999985.1|2470628_2471348_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|2471431_2471719_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420664.1|2472003_2472876_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_048875990.1|2472832_2473609_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036816484.1|2473813_2474149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963600.1|2474547_2474904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377440.1|2475065_2475341_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_017377441.1|2475450_2475798_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377442.1|2475815_2476595_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377443.1|2476594_2477104_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|2477139_2477388_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377444.1|2477699_2478035_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_017377445.1|2478334_2479585_+	MFS transporter	NA	NA	NA	NA	NA
WP_027242820.1|2479666_2481694_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377447.1|2482239_2482458_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242819.1|2482629_2482992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|2483140_2484544_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242818.1|2484825_2486001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377453.1|2486018_2488016_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_155764761.1|2487996_2488308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377455.1|2488475_2488976_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075275308.1|2489031_2489874_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_036772544.1|2489873_2490290_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275307.1|2490270_2490690_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017377459.1|2490712_2491342_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_017377460.1|2491910_2494100_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377461.1|2494111_2495317_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081377823.1|2495301_2496213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075286723.1|2496374_2497148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075286724.1|2497179_2498370_+	MFS transporter	NA	NA	NA	NA	NA
WP_017377463.1|2498356_2498626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075286725.1|2498682_2500224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242813.1|2500257_2501511_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017377465.1|2501516_2502374_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_017377694.1|2502392_2503121_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_081078114.1|2504259_2505051_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017376231.1|2505416_2505704_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017376477.1|2507826_2508216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376476.1|2508392_2509151_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_036772166.1|2509147_2511547_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_027242812.1|2511560_2512838_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376475.1|2512927_2514226_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_017376474.1|2514423_2515317_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_027242811.1|2515316_2516531_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
>prophage 27
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2527230	2577715	3186791	tRNA,transposase	Vibrio_phage(14.29%)	46	NA	NA
WP_069971651.1|2527230_2528106_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376461.1|2528478_2528742_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_017376460.1|2529048_2531643_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376459.1|2531639_2532122_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376458.1|2532099_2533140_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376457.1|2533314_2533800_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376456.1|2533907_2536478_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376455.1|2536511_2536973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773947.1|2537309_2538185_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376452.1|2538462_2540223_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_017376451.1|2540316_2540982_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376450.1|2540994_2542500_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376449.1|2542521_2543052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376448.1|2543125_2544388_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376447.1|2544574_2545447_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_026063532.1|2545548_2546337_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376445.1|2546429_2547755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376444.1|2548108_2549284_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376443.1|2549452_2550106_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376442.1|2550261_2552202_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_036773538.1|2552198_2552822_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036773116.1|2552986_2553961_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_075275305.1|2554232_2554853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|2554849_2556253_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910640.1|2556320_2556737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875986.1|2557144_2557642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2557638_2558613_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046598.1|2558692_2559262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|2559406_2559943_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375549.1|2559947_2560244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|2560252_2560858_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017378212.1|2561043_2561442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|2561632_2561836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046599.1|2561980_2562136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378213.1|2562260_2562713_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017378214.1|2562829_2564302_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_016211840.1|2564740_2565205_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_144420785.1|2565893_2567144_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_017378219.1|2567253_2567724_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_047927040.1|2567746_2568340_-	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_027242798.1|2568477_2569527_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_017378221.1|2569550_2570474_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|2570490_2570952_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378223.1|2571059_2571878_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_155046600.1|2572487_2572631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378228.1|2576794_2577715_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
>prophage 28
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2637917	2646760	3186791	transposase	Staphylococcus_phage(50.0%)	12	NA	NA
WP_017378288.1|2637917_2638139_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2638197_2639172_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046582.1|2639370_2639535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|2639531_2640167_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420659.1|2640443_2641223_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420658.1|2641255_2642017_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_075275303.1|2641993_2642983_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378290.1|2643118_2643994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|2644012_2644672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378292.1|2644701_2644908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927801.1|2644913_2645360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2645356_2646760_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2651829	2728870	3186791	tRNA,transposase	uncultured_Mediterranean_phage(29.41%)	60	NA	NA
WP_048875980.1|2651829_2653233_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927313.1|2654038_2656969_-	peptidase M16	NA	NA	NA	NA	NA
WP_027242809.1|2657112_2659071_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_144420783.1|2659264_2659912_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377496.1|2659967_2661293_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_075275301.1|2661327_2661597_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_017375667.1|2661867_2662353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|2662841_2663030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764762.1|2663360_2663504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242807.1|2664014_2664503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|2664632_2665601_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242805.1|2666307_2669634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377489.1|2669692_2670730_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377488.1|2670934_2672848_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377487.1|2672899_2673547_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377486.1|2673658_2674783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377485.1|2674779_2675376_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|2675406_2675739_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_027242804.1|2675841_2677695_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_027242803.1|2678141_2679854_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_036772905.1|2680062_2680416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420657.1|2681906_2682968_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376418.1|2684757_2685297_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_017376419.1|2685679_2686096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|2686191_2687007_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376421.1|2687139_2688633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|2688818_2689244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376423.1|2689240_2691301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376424.1|2691584_2692400_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376425.1|2692500_2693319_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_027242802.1|2693315_2693684_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_075275409.1|2693865_2694693_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|2694756_2695485_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|2695887_2696616_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017376428.1|2697005_2697731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875975.1|2697765_2701638_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376430.1|2701838_2702972_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_026063530.1|2702985_2703174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376433.1|2703397_2704756_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_081078111.1|2706362_2707115_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929627.1|2707237_2707588_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|2707647_2707935_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_144420654.1|2707987_2708767_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376415.1|2709191_2710109_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376414.1|2710160_2710916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242801.1|2710983_2712258_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376412.1|2712378_2713056_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017376411.1|2713256_2714681_+	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_016209938.1|2714655_2715294_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376410.1|2715656_2715935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376409.1|2716168_2717113_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376408.1|2717134_2719003_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376407.1|2719023_2719377_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_026063528.1|2719415_2720531_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376405.1|2720715_2721756_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_075286728.1|2721758_2722763_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376402.1|2722788_2723850_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_017376401.1|2723961_2725434_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376400.1|2725586_2726030_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376399.1|2726098_2728870_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
>prophage 30
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2733301	2782166	3186791	transposase	Staphylococcus_phage(25.0%)	45	NA	NA
WP_036773116.1|2733301_2734276_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376395.1|2734799_2737526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2738413_2739388_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_051929562.1|2739638_2740343_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377436.1|2741582_2742101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242883.1|2743068_2744553_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_017377433.1|2744677_2746213_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017377432.1|2746235_2746565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963636.1|2746461_2746677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910639.1|2748660_2749860_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017377428.1|2750069_2750930_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_017377427.1|2751045_2751624_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_017377426.1|2751780_2752422_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
WP_017377425.1|2752460_2752682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377424.1|2752674_2753658_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_080963565.1|2754051_2754549_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_026063633.1|2754693_2754969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377423.1|2755120_2756803_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_017377422.1|2756810_2757833_-	YHYH protein	NA	NA	NA	NA	NA
WP_017377421.1|2758001_2759003_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_017377420.1|2759116_2759455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377419.1|2759930_2761190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2761398_2761626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420653.1|2761654_2761873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772807.1|2762010_2762376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772810.1|2762443_2762686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242887.1|2762700_2763036_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_017377418.1|2763040_2763478_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_036772815.1|2764998_2765430_-	flaG family protein	NA	NA	NA	NA	NA
WP_144420782.1|2765535_2767047_-	B-type flagellin	NA	NA	NA	NA	NA
WP_017377414.1|2767337_2768930_-	flagellin	NA	NA	NA	NA	NA
WP_027242888.1|2769130_2771326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242889.1|2771419_2772853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927084.1|2772895_2773411_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036815723.1|2773410_2773776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242891.1|2774018_2774357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242892.1|2774340_2775006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242893.1|2775002_2775731_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_047927085.1|2775720_2776467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963566.1|2776450_2777515_-	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_017377789.1|2777719_2778907_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377788.1|2778963_2780082_-	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
WP_047927086.1|2780529_2780787_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_144420652.1|2781066_2781744_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_017375591.1|2781962_2782166_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2801865	2867678	3186791	tRNA,protease,transposase	Burkholderia_virus(10.0%)	59	NA	NA
WP_017377787.1|2801865_2802093_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377765.1|2802182_2802938_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377764.1|2803351_2803948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377763.1|2804027_2806832_+	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377762.1|2806812_2807766_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377761.1|2807758_2809129_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_080999971.1|2809299_2810703_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275295.1|2811474_2811801_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764763.1|2812005_2812740_-|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	6.5e-15
WP_017376600.1|2812978_2813158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|2813413_2814670_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999979.1|2814908_2815055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081049196.1|2815137_2815494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|2815989_2816349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375623.1|2816358_2816742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|2817630_2817771_+	phosphatase	NA	NA	NA	NA	NA
WP_048875965.1|2817915_2818836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377998.1|2820993_2821524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243145.1|2821534_2822590_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_036773465.1|2822605_2824645_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_017378003.1|2824631_2825462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378005.1|2829180_2829900_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378006.1|2830138_2830768_+	response regulator	NA	NA	NA	NA	NA
WP_048875961.1|2830887_2832291_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378007.1|2832436_2834380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|2834897_2835758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|2836193_2837939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|2838341_2839814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|2839996_2840596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|2840733_2840931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|2841131_2841272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875964.1|2841339_2842119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|2842683_2843085_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773793.1|2843229_2843607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|2844066_2845374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048058.1|2845922_2846105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619530.1|2846410_2846668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2846719_2848123_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377869.1|2848363_2850073_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377870.1|2850242_2850605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2850712_2851687_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927659.1|2851745_2852516_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_017377874.1|2852881_2853649_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377875.1|2853650_2854580_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377877.1|2854782_2856375_+	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377878.1|2856436_2856670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377879.1|2856673_2856889_-	SlyX family protein	NA	NA	NA	NA	NA
WP_027242835.1|2857070_2857874_+	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_027242836.1|2857924_2858572_-	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_144420778.1|2858574_2859474_-	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_017377882.1|2859546_2860188_-	OmpA family protein	NA	NA	NA	NA	NA
WP_048875959.1|2860223_2861576_-	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_036771700.1|2861635_2862730_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_017377887.1|2862732_2863164_-	protein TolR	NA	NA	NA	NA	NA
WP_017377888.1|2863198_2863903_-	protein TolQ	NA	NA	NA	NA	NA
WP_017377889.1|2864015_2865026_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377890.1|2865102_2865708_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377891.1|2865704_2866226_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377892.1|2866256_2867678_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 32
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2876786	2925807	3186791	tRNA,protease,transposase	unidentified_phage(15.38%)	52	NA	NA
WP_036771957.1|2876786_2877758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375746.1|2878106_2878415_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_048875957.1|2878411_2879068_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375749.1|2879201_2879687_-	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_017375750.1|2879764_2880286_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375751.1|2880331_2881225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|2881221_2882043_-	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_155046605.1|2882237_2882387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|2882614_2883445_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046606.1|2884850_2885021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242841.1|2885173_2886577_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_144420645.1|2886686_2887943_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080963644.1|2887914_2888646_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_017376088.1|2888657_2889935_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_017376087.1|2890034_2890409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376086.1|2890493_2891381_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376085.1|2891438_2892167_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_036771725.1|2892163_2893273_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376083.1|2893424_2893853_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_144420777.1|2893947_2894304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376081.1|2894296_2895508_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376080.1|2895504_2896293_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376079.1|2896455_2897250_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376078.1|2897699_2898440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376077.1|2898443_2900942_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376076.1|2901204_2902161_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_036771709.1|2902144_2902906_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_048875955.1|2903113_2904088_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_048875954.1|2904196_2904952_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|2905076_2905322_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_017376072.1|2905381_2907655_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_036772670.1|2907709_2908012_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_016211261.1|2908252_2908546_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_065653731.1|2908716_2908896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420644.1|2908971_2909583_-	DedA family protein	NA	NA	NA	NA	NA
WP_017376068.1|2909829_2911146_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|2911156_2911525_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376067.1|2911555_2912218_-	adenylate kinase	NA	NA	NA	NA	NA
WP_144420776.1|2912640_2913219_+	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376065.1|2913198_2913606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999977.1|2913729_2914026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2914072_2914948_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048876123.1|2915017_2917198_-	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_017376060.1|2917301_2918651_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_155764764.1|2918724_2919432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2919546_2920734_+	MFS transporter	NA	NA	NA	NA	NA
WP_017376055.1|2921252_2921897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2921893_2923207_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|2923411_2923585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2923854_2924328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420642.1|2924472_2924667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2924931_2925807_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	2944868	2993091	3186791	tRNA,transposase	Staphylococcus_phage(16.67%)	41	NA	NA
WP_036771639.1|2944868_2945843_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155048060.1|2945922_2946180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619425.1|2946324_2947011_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2947156_2947576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2947852_2948533_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875949.1|2948498_2948849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376032.1|2948881_2950093_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376031.1|2950433_2951063_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376030.1|2951111_2952128_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_016211035.1|2952374_2952590_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376029.1|2952642_2953092_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_027243175.1|2953171_2954917_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376026.1|2955008_2956880_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_053093667.1|2957324_2958041_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378197.1|2959478_2960348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2960304_2960532_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378198.1|2961500_2962415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875948.1|2962460_2963483_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_048875947.1|2963551_2964601_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420639.1|2965684_2965975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2966159_2967563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376857.1|2967589_2967820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771959.1|2968141_2968366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2968376_2969588_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_155049758.1|2970087_2970882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375569.1|2971055_2971451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2971703_2972747_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376859.1|2972866_2973103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376860.1|2973891_2975445_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2977625_2977853_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_069971648.1|2978723_2979698_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_017375736.1|2980424_2981507_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_017375735.1|2981549_2982200_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375734.1|2982422_2982794_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_027243178.1|2982904_2984266_+	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_155046609.1|2985986_2986193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2986503_2987586_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|2987582_2987894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2988939_2989914_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999976.1|2990632_2991412_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2991873_2993091_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	3005968	3066936	3186791	integrase,transposase	Staphylococcus_phage(30.0%)	47	3013821:3013880	3064242:3065002
WP_144420638.1|3005968_3007051_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|3007047_3007359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243152.1|3008856_3009792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774146.1|3010384_3011530_+	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_048875940.1|3013772_3014936_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
3013821:3013880	attL	GTCTTAGAGGTCATTGAAGGAGATCAGACGCTCAACCAAATATGCTCGAAATATGAGCTA	NA	NA	NA	NA
WP_144420637.1|3014964_3015189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|3016536_3017712_-	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420636.1|3018057_3020568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|3020626_3021439_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377669.1|3021879_3022584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|3022633_3023608_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420634.1|3023712_3025044_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420774.1|3025242_3025311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375857.1|3025442_3026885_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420773.1|3027276_3028689_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375855.1|3029378_3029825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|3030419_3031268_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017376916.1|3031521_3032580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927497.1|3032571_3034278_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_036774028.1|3034349_3036083_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_017376912.1|3036379_3036946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376911.1|3037070_3037724_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_027243158.1|3037750_3039211_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376909.1|3039307_3040285_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_048875878.1|3040754_3042158_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063577.1|3042683_3042977_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_026063576.1|3043203_3043968_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_017376905.1|3044175_3044403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|3044466_3044649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376903.1|3045211_3045391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376902.1|3045454_3045766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|3046620_3047325_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376899.1|3047522_3047663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772665.1|3048067_3048592_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_144420633.1|3048738_3049995_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|3050062_3050542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|3050982_3052386_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420632.1|3052800_3055116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377475.1|3055688_3057581_-	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_036771639.1|3057752_3058727_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377472.1|3059030_3059837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377471.1|3059905_3060517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377467.1|3061998_3062295_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075275282.1|3062291_3063134_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|3063524_3064310_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_080999974.1|3064314_3065718_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
3064242:3065002	attR	TAGCTCATATTTCGAGCATATTTGGTTGAGCGTCTGATCTCCTTCAATGACCTCTAAGACTAATGGCACTACCTTAAGGAGCGGATGAACATTTTTTATTGCTATTTTTCTTCATTCTTTTAGTTATTTCTGCCTTTTCCAATTCCCTGCTTTTATTCAGTCGCCTGAATGCTTTGGGACGTTTTTTAACAGCCCGAGGTTCAATCCGTCCAGGCCTATTCCCAACCTTGTTTTTTATGATTGCATGCAACAATATTGCATGGGCTTTATTACAGTCTGCCGAGAAACTGAGTAATGACACAAAGCTATTAAATAACTGTATTACATCCTTGAAACTAACCTGTATAGGAAGGCGTTCAGTATTACGACAAGCTTCTGCAATAAGCGTTCTAATTAAGTTGTATGCTAAAAAGTGTACTGCAATTTCTTTATGTACCATGTCAGGTGTCTTACTTCTTAAATGATCCATTGACATAATGGTTTTTAAGCTGTTGAAATTGATTTCAATGTGCCACCTTTGTTTGTAATGATTAGCCAATGCAACTTTATTGTATTTTTTATGATCTTGAAAAGTTGTTACATAAACCTCCCCTTTGATTTTGAACTCTCTTACCGTCATTTGATCAGGATAACTATCGTATGTTTCTTGTGTCATCCAGTCAGGTTTGTGAGGCTTTTTCCAAATGACAAGGTGATTTTTTGAACCCAACTTCCTTCCTTTACGAAAGTCATACTTCCTCTGTGAATGTGCTTTAAAAATA	NA	NA	NA	NA
WP_048875933.1|3065991_3066936_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP013796	Piscirickettsia salmonis strain AY6532B, complete genome	3186791	3087777	3115430	3186791	protease,transposase	Staphylococcus_phage(25.0%)	28	NA	NA
WP_017377305.1|3087777_3089079_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_016209647.1|3089160_3089766_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377304.1|3089878_3091183_-	trigger factor	NA	NA	NA	NA	NA
WP_017377303.1|3091783_3092659_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_075275279.1|3092774_3093446_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377301.1|3093625_3094981_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_017377300.1|3095101_3095839_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_144420629.1|3095917_3096634_-	aldolase	NA	NA	NA	NA	NA
WP_036771756.1|3097282_3098557_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209646.1|3098587_3099163_+	VOC family protein	NA	NA	NA	NA	NA
WP_017377295.1|3099207_3100173_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_027243030.1|3100636_3101545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|3101932_3102184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377293.1|3102328_3102757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|3102742_3103687_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046611.1|3103891_3104044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910637.1|3104072_3104807_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_017377288.1|3104901_3105162_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_080999973.1|3105380_3106346_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_146619452.1|3106322_3106619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|3106809_3107259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|3107518_3107947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|3108042_3108543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|3108479_3108641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420627.1|3109521_3109743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|3111241_3111919_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_081377824.1|3113233_3113572_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|3114455_3115430_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 1
NZ_CP013797	Piscirickettsia salmonis strain AY6532B plasmid p1PS9, complete sequence	188297	0	60661	188297	head,transposase,integrase,portal,capsid,tail	unidentified_phage(16.67%)	58	56346:56405	66858:67146
WP_155764765.1|2039_2348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243192.1|2500_2821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075286748.1|2948_3377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764766.1|3330_3630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377827.1|3572_4037_-	ParA family protein	NA	A0A222YXS3	Escherichia_phage	42.4	1.1e-20
WP_075275473.1|4152_4329_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|5566_6457_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075286749.1|6881_10109_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_036771347.1|10781_11759_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771353.1|11840_12560_+	ParA family protein	NA	NA	NA	NA	NA
WP_036771355.1|12576_14013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|14484_15462_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|15489_15918_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|15976_18667_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|18663_19221_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|19210_19996_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|19925_20597_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|20593_20935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|20927_23006_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|23009_23276_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|23332_23656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|23657_24080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|24079_24430_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|24426_24822_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|25000_25426_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|25422_25734_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|26118_26703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|26716_27256_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|27305_28280_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036771953.1|28742_31022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242588.1|31038_31392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|31730_32705_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|32992_33310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|33293_33995_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|34018_34252_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|34395_35370_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027243195.1|35735_36782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|37107_38124_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_047927763.1|38615_38879_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|38875_39274_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|39517_39973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|41873_42131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|42275_42446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|43115_44042_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|44237_44966_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|46114_46735_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|46790_47519_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|48369_48642_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|48644_49373_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|49402_50335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377509.1|50476_51205_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036773695.1|51234_53307_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_144420836.1|54992_55193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212398.1|55367_55829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|55923_56379_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
56346:56405	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_048875857.1|57366_58341_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.5	2.2e-26
WP_081000017.1|58741_58993_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_080999971.1|59257_60661_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
66858:67146	attR	AAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGT	NA	NA	NA	NA
>prophage 2
NZ_CP013797	Piscirickettsia salmonis strain AY6532B plasmid p1PS9, complete sequence	188297	64837	129245	188297	integrase,transposase,portal	Streptococcus_phage(48.15%)	60	72373:72432	112015:112935
WP_027243203.1|64837_65632_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|65725_65929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|66123_66459_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_036771296.1|67158_69054_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_144420835.1|69394_71308_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|71603_71870_+|transposase	transposase	transposase	NA	NA	NA	NA
72373:72432	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTA	NA	NA	NA	NA
WP_036771330.1|72409_73384_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|73690_74095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|74095_74842_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|75350_76412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|77391_77610_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|77628_78357_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|78508_79192_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|79196_79766_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|79936_80665_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|81148_81877_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|81929_82325_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|82618_83347_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|83504_86846_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_155046639.1|86945_87149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|87314_88043_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|88317_89253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|89966_90740_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|90913_91642_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036774376.1|91951_92380_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774316.1|92376_92676_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|92718_93288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|93492_93684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|93697_94738_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|94804_95134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|95157_96120_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|97497_98226_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|98472_98622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|98633_99362_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|99391_99778_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|99713_100142_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|101693_101921_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243207.1|102593_103145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|103226_103955_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|104298_104445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|104750_106616_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|106688_106955_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|107135_107477_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|107657_108191_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|109430_110159_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|110641_111664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772450.1|113477_114605_+	hypothetical protein	NA	NA	NA	NA	NA
112015:112935	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGTTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCGGCAAACTCTGTTCCGTTGTCAGAAGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAA	NA	NA	NA	NA
WP_051929764.1|115276_115768_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	6.9e-21
WP_032126795.1|117126_117387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|117390_117663_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|117738_118467_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|119035_120007_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|120871_121699_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|122552_123023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|123916_124060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|125266_125866_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|126219_126996_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|127356_128085_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_080963638.1|128160_128355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|128273_129245_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013797	Piscirickettsia salmonis strain AY6532B plasmid p1PS9, complete sequence	188297	135484	140255	188297		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_017375964.1|135484_135910_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036771651.1|136180_137146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|137479_137887_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|137994_139038_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|139339_139573_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|139710_139863_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|139892_140255_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
>prophage 4
NZ_CP013797	Piscirickettsia salmonis strain AY6532B plasmid p1PS9, complete sequence	188297	144391	188070	188297	transposase,terminase,portal	Streptococcus_phage(37.5%)	50	NA	NA
WP_027242929.1|144391_144775_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|144861_145344_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|145346_146678_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|146882_147317_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|147403_147790_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|147827_148562_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|148608_149322_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|150700_150886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|150889_154234_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|154414_155143_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|155236_156211_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|156524_156887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|156926_157436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|157667_158648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971702.1|159113_159986_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.3	3.8e-38
WP_036771347.1|160067_161045_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|161059_161221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|161438_161693_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|161682_161970_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_155048088.1|162464_163295_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.8	4.9e-35
WP_036771347.1|163295_164273_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_069971704.1|164380_164872_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|164953_165931_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|166058_166787_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|166969_168256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|168276_168441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082884401.1|168857_168980_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|169077_169806_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420835.1|170211_172125_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|172420_172687_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|173232_173961_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|174001_174172_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|174247_175225_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|175306_175990_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|176017_176170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|176571_178311_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|178313_178676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|179625_180312_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|180657_181278_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|181256_181985_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|182072_182459_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|182455_182701_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075286753.1|183140_184154_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	30.4	2.5e-25
WP_017375840.1|185122_185341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|185385_185790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|185803_186142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|186134_186359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046641.1|186385_186550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|186730_187339_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|187341_188070_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 1
NZ_CP013798	Piscirickettsia salmonis strain AY6532B plasmid p2PS9, complete sequence	60078	0	52923	60078	integrase,transposase	Choristoneura_rosaceana_entomopoxvirus(12.5%)	56	48860:48890	53182:53212
WP_075286759.1|857_1214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377828.1|1402_1597_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075286763.1|1644_2283_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_053063426.1|2258_3044_-	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927058.1|3163_3520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774994.1|3598_3877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420828.1|4082_4337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106244.1|4534_4852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036775000.1|4867_5158_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_048876012.1|5337_6741_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_062365791.1|6773_7283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929536.1|7275_7980_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_051929537.1|7989_9459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653727.1|9461_9908_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_036774456.1|9920_12500_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_155764767.1|12459_12834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963562.1|12757_13444_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_036773373.1|13548_14538_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_036773372.1|14546_15212_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_069971679.1|15217_17023_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_069971648.1|17081_18056_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	2.9e-26
WP_036773367.1|18218_19031_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_027242554.1|19027_19519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242553.1|19511_20894_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_080963561.1|20865_23685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242551.1|23701_24019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242550.1|24101_24845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929530.1|25213_25939_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_051929529.1|25890_27210_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027242548.1|27209_27962_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_027242547.1|27973_28180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275450.1|28248_34119_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_036774904.1|34113_34443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774901.1|34433_34877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774899.1|35462_35756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927050.1|35819_36608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816706.1|36667_37231_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_047927049.1|37299_37671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420829.1|38097_38352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242581.1|38528_40715_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
WP_027242582.1|40724_41126_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242583.1|41122_41434_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_144420830.1|41790_42096_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242576.1|42201_44064_+	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_075286765.1|44195_44582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046643.1|44815_44968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377829.1|45015_45750_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155764056.1|45848_46022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|46021_46279_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774631.1|47545_48010_+	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_080963647.1|48348_48519_+	hypothetical protein	NA	NA	NA	NA	NA
48860:48890	attL	GGCTGAAACTTTCAAATTCTTCAATATTGAA	NA	NA	NA	NA
WP_027242602.1|49494_49767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|50092_50365_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|50368_50629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242600.1|50901_51492_+|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_048876031.1|51519_52923_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
53182:53212	attR	GGCTGAAACTTTCAAATTCTTCAATATTGAA	NA	NA	NA	NA
>prophage 2
NZ_CP013798	Piscirickettsia salmonis strain AY6532B plasmid p2PS9, complete sequence	60078	57197	58903	60078		Brevibacillus_phage(50.0%)	2	NA	NA
WP_047927060.1|57197_58058_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
WP_036774869.1|58054_58903_+	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
>prophage 1
NZ_CP013799	Piscirickettsia salmonis strain AY6532B plasmid p3PS9, complete sequence	33518	211	16225	33518	integrase,head,tail,transposase,terminase,capsid	unidentified_phage(38.46%)	21	9079:9138	25457:25745
WP_075286767.1|211_517_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	45.2	9.9e-18
WP_027242945.1|1523_2039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420855.1|2838_3054_-|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_036771330.1|3127_4102_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242946.1|4482_5064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|5099_5492_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|5588_6563_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|6582_6768_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|6770_7253_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|7339_7723_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|7935_8802_-	hypothetical protein	NA	NA	NA	NA	NA
9079:9138	attL	TCGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGC	NA	NA	NA	NA
WP_036771330.1|9427_10402_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|10499_10856_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|10839_11094_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|11238_11604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|12136_13111_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|13287_13641_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|13633_13894_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|14124_14715_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|14780_15137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|15250_16225_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
25457:25745	attR	GCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGATAGGCCCAAAAACTTTTGATCACGCTATACATCATGCACCTTGTTTGATGAGTGTTATTAGTTCAATCGGGGTAAGGTTCTCACGTTCGGGCAAGCGTAAGCCGCAGCGCTTTAAAATCTGCGCGGCAAACTCAGCGCATTGCCAACCCGTGGGATCTTTTTGCTTAAGACCTAAGCCGGCCCGTATTGCATCAATTAAGCTGTAATCATCGGCTAAGTGCTGCAAAAT	NA	NA	NA	NA
