The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	0	69795	3193374	transposase,tRNA	uncultured_Mediterranean_phage(26.67%)	57	NA	NA
WP_017376407.1|341_695_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|715_2584_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|2605_3550_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|3783_4062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|4424_5063_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|5037_6462_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|6662_7340_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|7460_8735_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376415.1|9608_10526_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|10660_10831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|10950_11730_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|11782_12070_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|12129_12480_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|12673_12826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|12753_13227_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|13239_13875_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|14386_15262_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|16868_18227_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|18450_18639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|18652_19786_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|19986_23859_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|23893_24619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|25008_25737_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|26139_26868_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|26931_27759_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|27940_28309_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|28305_29124_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|29224_30040_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|30323_32384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|32380_32806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|32991_34485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|34617_35433_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|35528_35945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|36327_36867_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|37783_37945_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|38656_39718_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|41208_41562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|41770_43483_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|43929_45783_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|45885_46218_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|46248_46845_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|46841_47966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|48077_48725_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|48776_50690_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|50894_51932_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|51990_55317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|56023_56992_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|57121_57610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|58051_58285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|58594_58783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|59271_59757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|60027_60297_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|60331_61657_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|61712_62360_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|62553_64512_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|64655_67586_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|68391_69795_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	74864	83707	3193374	transposase	Acinetobacter_phage(50.0%)	12	NA	NA
WP_048876031.1|74864_76268_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|76264_76711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|76716_76926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|76952_77612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|77630_78506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|78641_79631_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|79607_80369_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_155046602.1|80401_81181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|81457_82093_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|82089_82254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|82452_83427_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|83485_83707_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	94296	95010	3193374		Cyanophage(100.0%)	1	NA	NA
WP_017378273.1|94296_95010_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.0	7.4e-40
>prophage 4
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	138634	139933	3193374		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017378233.1|138634_139933_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
>prophage 5
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	143380	195763	3193374	transposase,tRNA	Vibrio_phage(13.33%)	47	NA	NA
WP_017378229.1|143380_145273_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.8	9.7e-87
WP_017378228.1|145279_146200_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|150363_150507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|151116_151935_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|152042_152504_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|152520_153444_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|153467_154517_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|154654_155248_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|155270_155741_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|155850_157101_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|157788_158253_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|158691_160164_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|160280_160733_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|160857_161013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|161157_161361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|161551_161950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|162135_162741_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|162749_163046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|163050_163587_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|163731_164301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|164380_165355_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|165351_165849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|166256_166673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|166740_168144_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|168140_168761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|169032_170007_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|170171_170795_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|170791_172732_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|172887_173541_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|173709_174885_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|175238_176564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|176656_177445_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|177546_178419_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|178605_179868_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|179941_180472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|180493_181999_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|182011_182677_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|182770_184531_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|184808_185684_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376455.1|186020_186482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376456.1|186515_189086_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376457.1|189193_189679_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376458.1|189853_190894_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
WP_017376459.1|190871_191354_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_017376460.1|191350_193945_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|194251_194515_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|194887_195763_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	206462	274489	3193374	transposase,tRNA,protease	Burkholderia_phage(17.65%)	62	NA	NA
WP_027242811.1|206462_207677_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|207676_208570_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|208767_210066_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|210155_211433_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_017376476.1|213841_214600_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|214776_215166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|217288_217576_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|217941_218733_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|219391_219883_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|219871_220600_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|220618_221476_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|221481_222735_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|222768_224637_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|224623_225862_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|225846_227694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|227678_228884_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|228895_231085_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|231653_232283_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|232305_232725_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_027242816.1|232717_233122_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|233121_233964_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|234019_235000_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|234980_236978_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|236995_238171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|238452_239856_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|240004_240367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|240538_240757_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|241302_243330_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|243411_244662_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|244961_245297_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|245608_245857_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|245892_246402_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|246401_247181_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|247198_247546_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|247655_247931_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|248092_248449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|248847_249183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|249387_250164_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|250120_250993_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|251277_251565_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|251648_252368_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|252498_253107_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|253912_254887_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|254966_255344_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027242786.1|255442_256534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|258206_258704_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|258848_259247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|259332_260238_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|260456_260777_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|260858_261632_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|262208_263042_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|263071_263926_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|264302_265313_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|265457_265715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|265828_267085_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|267340_267520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|268013_268256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|268281_269640_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|269921_270281_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|270712_272347_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|272353_273190_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|273211_274489_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
>prophage 7
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	277847	279841	3193374		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_017377574.1|277847_278621_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|278791_279841_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
>prophage 8
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	290257	291232	3193374	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771332.1|290257_291232_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
>prophage 9
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	323509	330368	3193374		Hokovirus(33.33%)	5	NA	NA
WP_027242826.1|323509_324061_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	3.7e-07
WP_027242827.1|324360_325545_+	MFS transporter	NA	NA	NA	NA	NA
WP_026063602.1|325699_327298_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	7.4e-56
WP_017377147.1|327755_328379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377146.1|328424_330368_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.0	1.7e-14
>prophage 10
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	340890	341613	3193374		Bacillus_phage(100.0%)	1	NA	NA
WP_017377133.1|340890_341613_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
>prophage 11
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	349588	494341	3193374	transposase,tRNA,protease,integrase	Staphylococcus_phage(18.92%)	136	369615:369674	476042:477146
WP_017377125.1|349588_350344_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.0	2.0e-11
WP_080963632.1|350324_351725_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_027242831.1|351748_352966_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.5	4.0e-94
WP_016209778.1|352996_353371_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_017377121.1|353389_353941_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_027242832.1|354288_354726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876002.1|355111_356095_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|356894_358048_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|358169_358862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|358870_360058_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|360207_360834_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|360879_362109_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|362303_362750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|362941_364300_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|364965_365139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|365268_366186_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|366527_367187_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|367267_367771_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|367743_368031_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|368322_369444_-	calcium:proton antiporter	NA	NA	NA	NA	NA
369615:369674	attL	CGCCCTCCGTCATCTGAAGTGCAACACTCAGTAGAGAGTTCATATTCATACAGATAAACT	NA	NA	NA	NA
WP_036771330.1|369706_370681_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376496.1|370947_372069_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_144420790.1|372165_372381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772303.1|372467_373238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155601400.1|374378_374591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036816364.1|374490_374709_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048876006.1|376572_377166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046592.1|377141_377288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929832.1|377490_377751_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017375982.1|377949_378570_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_017375983.1|378643_379927_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_027243165.1|380267_381578_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_036773519.1|381725_383114_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_027243163.1|383249_384578_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_017375989.1|384648_385149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|385668_386643_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|386718_387036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|387039_387408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|388141_389110_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|389319_390732_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|390919_391633_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|391653_392067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|392167_393241_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|393377_394277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|394532_394784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|394832_395468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|395591_396449_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_053856766.1|396636_398040_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|398215_398719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|398795_400097_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|400265_401366_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|401716_401959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|401952_402270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|403492_403720_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|404330_404801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|405023_405323_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|405319_405565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|405857_406814_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|407098_407302_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|407432_408461_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|408824_409070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|409432_410407_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|411878_413585_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|413630_414482_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|414684_417141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|417660_418062_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|418648_419623_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|419663_420992_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|421255_421825_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|421840_422152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|422161_423130_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|423242_423596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|423599_424664_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|424664_426404_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|426410_426833_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|426816_427446_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|427681_427780_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|427812_429684_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|429831_430806_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|430885_431029_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|431202_432546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|433044_433323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|433590_434547_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|434873_435257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420680.1|435272_436193_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|436508_437384_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|437385_437550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|437729_437915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|437958_438933_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|438929_440231_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|440248_440785_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376785.1|441247_442153_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|443559_443721_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|444255_444465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|445580_446894_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|447129_448275_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243097.1|448340_448526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|448561_449194_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|449370_450027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|450015_452301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|452574_452934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|453215_453851_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|455038_455863_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|455918_457130_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|457913_458621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|458683_458863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312151.1|458924_459257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|459354_460098_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|460111_461155_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|461293_463063_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|463287_464421_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|465270_468090_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|468464_469190_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|471784_472345_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|472549_472882_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|472941_473229_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|473881_474907_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|475034_476009_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|476203_477157_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
476042:477146	attR	AGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCGATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAGTATTGTATTACCTAAGCGCTGAACATAAAAATCAAATAAATTTAAAAAAATTAATTACTGACCTACTCGATTTAATATCTGTATACGTGCGCACTCAATGATTTTTTGAGGATTCACCTTACCAATAAACTCATTACAATCGGTCTGCTGAATATCATTTTTATTAAATACACCAGTAATAGACGTATTTAAAATAATAAACAAGTTCTTTAATCCTGGATGCTCGCGGCATGCTTTAATAAAGGCATAACCATCGATTTCTGGCATCTCAACATCTGCAATAACCATTAAGTATTTTTGAGTAATATCACCTCCTGCCCCAGGCAACACATTGATCAAGTAATCTAAAGCCTCTCGACCATTTCGCATGAGAATACTTTTTACACCTATGGTATCTAAGGCTTTTTTAACCTGCTTACGTGCAATCAGGGAGTCATCTACAACTAGCGCTGTATAGTGAGGTGCTTGCTCTATCACAACATTTTCAAGCGTATTAGTGCTGACCTTAATATCATATTGAGCAGGATGAATTTCATAAATCACTTTTTCAACATCAATGACTTGTATCAGTGATGTAGCTCCTTCTTCATTAATTTTTAAAACACTAGTAATATATTTATCTTTACCGGTTGCCTCGGGTGCAGCAATTACATTTTCCCATGTTGCATTGATAATGTGATGAACTTCATGAACAAGAAACCCTTGCACAGAATGATTATATTCAGTCACGATCAAAATGCCGCTTAAAGGATCAATCGTTTTCTTAGCAAAAATTGCCTGACAAGTATCAATCACCGCTAGAGACTGATTACGAATATGAACAACTCCAAGCACGGCCGGATGACTTTCCGGTAGCACTGCCAACTCCGGTAAATGCAATACTTCTCTCACTTTAAAGACATTAATCGCATATTGACGCCCATAAATGCTAAATACTAACGCTTCAAAGCGATTCCTGCCCACTAATTTTGTTCGTGAATCAATATTCTCTAATAAA	NA	NA	NA	NA
WP_144420684.1|477326_477575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|477757_478282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|478736_479564_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|479632_479818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|480018_480477_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|480617_480845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|481009_482395_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|482690_483005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|483113_484739_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|485151_486141_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|486462_486648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|487037_488993_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|489064_489187_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|489229_490204_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|490426_490888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|491272_492070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|492535_494341_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
>prophage 12
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	505339	632932	3193374	transposase,tRNA	Acinetobacter_phage(11.76%)	107	NA	NA
WP_017377206.1|505339_506797_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|506833_507298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|507325_507904_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|508174_509992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|509968_511018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|511217_511595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|512784_513072_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|513131_513428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|513572_514229_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|514468_514849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|515500_516904_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|516900_517182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|517576_518041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|518221_518815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|519000_519975_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|520378_521203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|521277_522426_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|522441_524070_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|524413_525607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|531721_532222_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|532635_532776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|532898_534359_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|534436_534919_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|535077_536343_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|536427_537687_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|537758_538031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|538368_538704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|539064_539313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|539583_539994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|540138_540675_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|540685_540871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|541306_542278_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|542259_543231_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|543344_544118_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|544388_544718_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|544973_545492_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|545544_545772_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|546753_547629_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|547820_548198_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|548757_549807_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|550120_551506_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|551512_553051_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|553093_553819_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|553989_555222_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|555421_556243_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|556292_557102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|557257_561124_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|561289_562165_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|562229_562508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|562652_563228_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|563276_563435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|564183_564900_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|566028_566445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|567359_568289_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|568260_568419_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|568567_568882_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|569791_570775_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|570925_571273_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|571272_571872_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|572246_572585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|572403_572793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|572796_573741_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|573728_573872_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|574233_574566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|577458_578460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|578532_578997_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|579369_579789_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376672.1|581179_584236_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|584317_585772_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|586206_587223_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_017376669.1|587331_587730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376668.1|587769_589593_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_027242912.1|589589_592892_+	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_036772026.1|592996_593872_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|593909_594824_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|594888_595518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|595562_595997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|595977_596718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|596731_598129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|598131_601080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|601079_602801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|602815_603220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|603220_606100_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|606102_606825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|607186_609079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|609110_611651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|611682_612846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|612851_613475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|613489_614989_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|615005_615512_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|616767_616839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|617021_617204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|618405_618678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|618693_620127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|620271_621537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|621822_623574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|623586_624750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|624753_625050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|625089_625317_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|627185_628160_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|628218_628482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|628491_629805_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|630009_630183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|630250_630394_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|630412_630610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|630627_631134_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|632056_632932_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	644438	648091	3193374		uncultured_Caudovirales_phage(50.0%)	3	NA	NA
WP_017377966.1|644438_645125_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|645248_646433_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|646648_648091_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
>prophage 14
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	662687	712973	3193374	transposase	Staphylococcus_phage(28.57%)	39	NA	NA
WP_048876022.1|662687_663539_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|663951_665105_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|665195_666299_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|666638_667139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|667835_668189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|668489_670217_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|670320_671046_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|671038_672277_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|672414_673452_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|673506_674409_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|674518_675772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|675829_679321_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|679437_680115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|680242_680791_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|682661_682823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|684014_684581_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|684583_685708_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|685792_686611_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|686741_688721_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|688780_689434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|690118_691489_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|693204_693852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|693889_694282_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|694534_695281_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|695879_696785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|696900_697875_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|698020_698749_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|698868_699450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|699472_702313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|704355_705306_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|705388_706171_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|706269_706563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|707085_707730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|707763_708408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|708456_709311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|709448_709961_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|710028_710223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|710436_710790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|711998_712973_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 15
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	717476	776187	3193374	transposase,tRNA	Burkholderia_virus(28.57%)	54	NA	NA
WP_017376680.1|717476_718709_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|718840_719458_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|719535_720042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|720052_720280_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|721562_721829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|722058_723177_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|723321_723657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|723667_724081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|725289_725454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|725490_726366_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|726552_727065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|729496_730696_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|730949_731231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|731286_733278_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|733351_734329_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|734464_735247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|735402_735726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876030.1|735793_736897_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|736966_737842_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|737838_738183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|738192_738654_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|738667_740059_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|740100_743088_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|743157_743991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|744045_745233_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|745220_745925_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|745970_746756_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|746783_747521_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|747625_749821_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|749895_750579_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|750589_751021_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|751066_751465_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|751841_752549_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|752613_752910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242997.1|752951_753428_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|753481_754003_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|754084_755179_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|756145_757549_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|757718_758282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|758417_759893_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|759899_760106_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|760163_761234_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|761431_763402_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|763762_765322_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|765918_766275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|767115_767775_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|767870_769232_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|769373_769601_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|770652_771993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|772643_772805_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075278705.1|772904_773732_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|774085_774961_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|775004_775979_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|775998_776187_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	783717	787544	3193374		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_027242761.1|783717_784392_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|784554_784776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|784803_785745_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|785741_787544_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
>prophage 17
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	793689	860048	3193374	transposase	Burkholderia_virus(22.22%)	48	NA	NA
WP_062365727.1|793689_794382_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|794378_794522_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|795865_796093_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|797399_799430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|799496_800522_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|800514_801561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|801701_802697_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|802994_803633_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|804346_805534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|805699_806653_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|806675_808694_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|808782_809106_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|809354_809531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|809758_810478_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|811093_811477_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|812121_812595_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|812700_814071_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|814186_814918_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|814942_816040_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|816075_817494_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|817703_818156_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|818167_818395_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|818444_818771_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|818974_819664_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|819812_820301_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_036771342.1|820341_821442_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|821487_822570_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|822562_823123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|823113_824418_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|824471_825494_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|825518_826535_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_146619549.1|826967_830135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|830486_831110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|833736_834492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|835200_836175_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|839083_839755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|840833_842237_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|843824_847226_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|847222_849916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|850219_851719_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|852385_853207_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|853278_853764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|853912_855316_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|855312_856383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|856628_858803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|858825_859506_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|859534_859735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|859820_860048_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 18
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	863440	864688	3193374		Phage_21(100.0%)	1	NA	NA
WP_017375730.1|863440_864688_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
>prophage 19
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	871084	922163	3193374	transposase	Acinetobacter_phage(27.27%)	46	NA	NA
WP_075275340.1|871084_871693_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|872223_873099_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|873339_874014_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|874042_874531_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|875576_876011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|876216_877620_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|877867_879379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|880339_880633_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|880590_881169_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|881254_882130_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|882122_882479_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|882487_882883_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|884207_884768_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|885890_887780_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|887814_889020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|889022_890321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|890301_891525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|891574_892375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|892371_892770_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|892766_893075_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|893468_894197_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|894237_894882_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|894894_895362_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|895416_896391_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|896420_897038_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|897016_897478_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|897521_898457_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|898484_899480_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|899703_900666_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|902093_902822_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|902872_904507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|904777_905965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|906566_907004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|909537_909810_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|909885_910194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|912669_912987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|913143_914118_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|914114_914504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|914584_915331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|915299_916028_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|916772_917060_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|917119_917284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|917280_918684_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|918716_919478_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|919763_920480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278706.1|921257_922163_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	934385	989186	3193374	transposase,tRNA,protease	Staphylococcus_phage(20.0%)	50	NA	NA
WP_017376284.1|934385_935237_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|935237_936155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|936550_936724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|937326_938298_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080963609.1|940485_941652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377033.1|941991_942303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420710.1|942780_943086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242870.1|943407_943938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377031.1|944384_945314_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|945470_945896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|946012_946240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|946393_947368_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|947634_947904_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377955.1|948048_948276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764143.1|948272_949097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963583.1|949164_950091_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|950386_951148_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|951349_951961_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|951981_953181_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|953275_953416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|953428_953833_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|954063_954633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|954699_955740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|955766_955994_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|957044_957902_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|957898_958660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|958744_961474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|961607_962483_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|962747_964088_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|964150_964864_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|965032_965524_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|965663_966155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|966357_967248_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|967632_968217_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|968297_969236_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|969287_970382_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|970506_971829_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|971876_976763_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|976857_977160_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|977270_979193_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|979214_980510_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|980506_982117_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|982223_983117_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|983226_983850_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|984556_985255_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|985398_985968_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|986283_986910_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|987106_987853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|987948_988788_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|988838_989186_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
>prophage 21
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	997953	1050588	3193374	transposase	Staphylococcus_phage(41.67%)	45	NA	NA
WP_017377787.1|997953_998181_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027243109.1|999880_1000537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774751.1|1000811_1001735_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047927028.1|1001748_1002672_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027243112.1|1002619_1003276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243113.1|1003578_1004406_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_017376518.1|1004556_1004928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927029.1|1005156_1006647_+	nuclease	NA	NA	NA	NA	NA
WP_017376516.1|1006714_1008052_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_017376515.1|1008194_1009661_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_017376514.1|1009657_1010707_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_027243115.1|1010830_1012939_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|1013101_1013506_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|1013567_1014293_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_017376511.1|1014378_1015272_+	YicC family protein	NA	NA	NA	NA	NA
WP_017376510.1|1015312_1015933_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|1015993_1016200_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|1016221_1018366_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|1020561_1021485_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|1021551_1022835_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|1023075_1024050_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|1024365_1024527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1024523_1025927_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1026040_1026808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1027166_1028570_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|1029390_1029591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|1029831_1031277_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|1032472_1033348_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|1034799_1035081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|1035299_1035479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|1035638_1036658_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|1036644_1037067_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|1037068_1037542_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|1037667_1038324_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|1038320_1038995_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|1039000_1040149_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|1040145_1040607_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|1040682_1041933_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|1042059_1043739_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|1043850_1044732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|1045721_1046315_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|1046676_1047192_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1048131_1048416_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|1048965_1049241_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1049613_1050588_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 22
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1055223	1058987	3193374		Streptococcus_phage(50.0%)	2	NA	NA
WP_036773645.1|1055223_1056309_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_036773644.1|1056350_1058987_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
>prophage 23
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1071139	1072195	3193374		Halovirus(100.0%)	1	NA	NA
WP_017375707.1|1071139_1072195_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
>prophage 24
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1075461	1080452	3193374		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_017375710.1|1075461_1076418_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242977.1|1076466_1077003_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375712.1|1076999_1077761_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242976.1|1077863_1080452_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
>prophage 25
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1089900	1091964	3193374	tRNA	Catovirus(100.0%)	1	NA	NA
WP_027242971.1|1089900_1091964_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
>prophage 26
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1098945	1099620	3193374		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017376751.1|1098945_1099620_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	8.9e-35
>prophage 27
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1118573	1168881	3193374	transposase,tRNA	Organic_Lake_phycodnavirus(16.67%)	45	NA	NA
WP_017377990.1|1118573_1119617_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	27.6	3.1e-18
WP_017377989.1|1119629_1120100_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377988.1|1120232_1121423_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_144420806.1|1121781_1122033_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_048875859.1|1122174_1122969_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|1123258_1124182_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|1124449_1124743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|1125945_1126869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|1127004_1127847_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|1127934_1128585_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|1128598_1129639_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|1129761_1130847_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|1130873_1131983_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|1132287_1132605_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|1132601_1132961_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|1133063_1135796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|1137285_1137963_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|1138209_1138428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|1138572_1139781_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1140208_1141666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1142501_1142777_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|1145480_1145660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|1145656_1146028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1146038_1147121_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|1147117_1147339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1148324_1148543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1149033_1149300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|1149558_1149879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|1151264_1152515_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|1152503_1153385_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|1153377_1154463_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|1154459_1155719_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|1155887_1156547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|1156716_1157379_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|1157725_1158673_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|1158769_1159396_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|1159401_1159983_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|1160054_1161146_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|1161235_1161949_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|1162042_1162867_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|1163100_1163778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|1165455_1165713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1166113_1167088_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|1167262_1167907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|1168086_1168881_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1172515	1211700	3193374	transposase,protease	Acinetobacter_phage(28.57%)	36	NA	NA
WP_027243053.1|1172515_1173541_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_087910651.1|1174575_1174752_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|1175047_1175482_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|1175675_1177145_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|1177138_1178515_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|1178527_1178920_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|1178916_1180020_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|1180198_1181491_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|1181501_1182449_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|1182460_1183273_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|1183275_1184055_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|1184069_1185128_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|1185124_1186135_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|1186141_1186339_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|1186399_1189306_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|1189347_1190199_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|1190281_1190827_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|1190924_1191785_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|1191876_1192293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|1192374_1192881_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|1192926_1195878_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|1195899_1196232_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|1196349_1196859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|1197392_1197548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|1198622_1199789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|1199933_1200686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1201041_1202016_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|1202148_1202859_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|1202855_1203890_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|1203993_1204335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|1204845_1206006_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|1205974_1206571_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|1207539_1207710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1207706_1208681_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|1209700_1210854_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_017376389.1|1211079_1211700_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
>prophage 29
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1215063	1215306	3193374		Erythrobacter_phage(100.0%)	1	NA	NA
WP_016210413.1|1215063_1215306_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
>prophage 30
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1226605	1227289	3193374		Harp_seal_herpesvirus(100.0%)	1	NA	NA
WP_016209511.1|1226605_1227289_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
>prophage 31
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1232942	1236713	3193374		Planktothrix_phage(33.33%)	5	NA	NA
WP_016209539.1|1232942_1233743_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_027242848.1|1233882_1234863_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209499.1|1234868_1235426_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242849.1|1235457_1235985_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|1235981_1236713_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
>prophage 32
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1240483	1243674	3193374		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_017376362.1|1240483_1241323_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376361.1|1241473_1242118_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376360.1|1242135_1242522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|1242741_1243674_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
>prophage 33
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1256000	1389392	3193374	transposase,plate,tRNA	Acinetobacter_phage(13.64%)	113	NA	NA
WP_027242858.1|1256000_1257308_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|1257312_1258023_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|1258035_1261206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1261272_1262409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|1263271_1264129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|1264270_1265071_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|1265169_1265745_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|1265827_1266499_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|1266544_1267444_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|1267478_1267862_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|1268011_1268842_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|1268766_1269477_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|1269473_1270499_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|1270629_1273134_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|1273140_1274409_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|1274410_1275394_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|1275406_1276228_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|1276272_1276665_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|1276739_1277546_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|1277733_1278162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1278220_1279195_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|1279218_1279656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1279690_1281094_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|1281674_1281836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|1283056_1283428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|1283535_1285086_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|1285118_1285958_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|1285954_1286470_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|1286473_1287466_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|1287844_1289215_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|1289423_1290563_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|1290776_1291751_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_017375775.1|1291798_1291993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052676.1|1292031_1292319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|1297974_1298655_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|1298719_1300006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|1300607_1300877_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|1301060_1302032_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|1302099_1303074_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|1303171_1304248_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|1304328_1305321_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|1305325_1307128_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|1307145_1308447_-	aspartate kinase	NA	NA	NA	NA	NA
WP_081377956.1|1308462_1308717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929826.1|1308644_1309745_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|1309877_1310270_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|1310376_1311462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|1311677_1312694_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|1312696_1313704_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|1313707_1314862_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|1314876_1315239_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|1315235_1316951_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|1317050_1317725_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1317753_1318158_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|1318182_1319142_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|1319274_1320057_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|1320158_1321118_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|1321262_1321610_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376611.1|1322822_1323359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376610.1|1324166_1325177_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_144420814.1|1325611_1326529_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|1326673_1327210_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|1327469_1328372_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|1329361_1330351_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|1330519_1330858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1330854_1331430_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|1331478_1331694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1331880_1332720_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|1336416_1337325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|1337455_1338112_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|1338220_1339147_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|1339465_1340026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|1340495_1341815_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|1341882_1342749_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|1342741_1343617_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|1343675_1343894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|1345294_1345624_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|1345858_1346563_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|1346543_1348772_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|1349043_1350057_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|1350165_1350387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|1350391_1352029_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|1352167_1352701_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|1352821_1353940_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|1353932_1355255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|1355241_1356378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|1356608_1357034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|1360363_1360717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1360751_1361627_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|1361783_1362188_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|1362335_1363511_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|1363770_1364274_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|1364313_1365798_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|1366021_1366975_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|1366955_1368047_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|1368349_1368592_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155048025.1|1369492_1369678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|1369659_1370235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|1370351_1370534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|1371109_1371382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|1371534_1371789_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|1371903_1373307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|1373391_1373898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|1374462_1376283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|1376349_1376880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|1378425_1379142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|1379184_1379622_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|1379659_1381039_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|1381433_1383428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|1383892_1384705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|1384888_1386352_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|1386711_1388091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|1388843_1389392_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 34
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1421470	1464830	3193374	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|1421470_1422445_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|1422441_1422879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|1423053_1424457_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|1424467_1424743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|1425020_1425491_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|1425793_1427164_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|1427493_1427961_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|1427973_1428984_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|1429185_1430589_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|1431015_1431804_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|1431790_1432819_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|1432796_1433201_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|1433428_1435396_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|1435591_1436083_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|1436117_1436960_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|1437005_1437458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|1437747_1438380_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|1438380_1439631_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|1439664_1440762_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|1441091_1442477_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|1442516_1442774_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|1445189_1446593_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|1446589_1447630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|1448022_1448418_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|1448414_1449203_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|1449388_1450114_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|1450358_1451546_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|1451838_1452381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|1452377_1453064_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|1453067_1453679_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|1453725_1454745_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|1454847_1455642_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|1455655_1456456_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|1456534_1457584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|1457759_1459040_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|1459085_1459763_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|1459848_1460130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|1460221_1461076_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|1461015_1461414_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|1461941_1462883_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|1463601_1463823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|1463819_1464830_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1473159	1530880	3193374	transposase	Staphylococcus_phage(71.43%)	51	NA	NA
WP_048875873.1|1473159_1474563_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|1474559_1474697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875872.1|1474869_1476153_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875871.1|1476357_1476561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376862.1|1476735_1477740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376863.1|1478097_1479333_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376864.1|1479499_1480450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|1480957_1481932_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_087910670.1|1482887_1483073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|1483166_1483631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1484018_1484993_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|1485420_1485684_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|1486125_1487100_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876253.1|1487096_1487753_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036772347.1|1487914_1488331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|1488333_1488675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|1488705_1489239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|1489420_1489648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|1489690_1490167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420818.1|1490178_1490367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|1490568_1493895_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_017376870.1|1493897_1494794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|1495070_1497374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|1497415_1499035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242646.1|1499486_1500989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|1501050_1504050_-	ATPase AAA	NA	NA	NA	NA	NA
WP_048875870.1|1504086_1504512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376878.1|1504518_1505172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|1505164_1506241_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242650.1|1506243_1506732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|1509221_1509461_-	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_017376886.1|1509465_1510596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376887.1|1510598_1511345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|1511337_1511841_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_027242651.1|1511893_1512304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|1512418_1513459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242653.1|1513474_1514401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|1514418_1515642_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_017376891.1|1515638_1516541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|1516710_1517481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|1517785_1518682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376894.1|1518905_1519139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|1519355_1519949_+	DedA family protein	NA	NA	NA	NA	NA
WP_027242656.1|1519966_1520785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856768.1|1521076_1521871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242658.1|1521946_1523410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1524752_1526156_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|1526275_1526914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|1527261_1528236_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|1528544_1529570_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|1529677_1530880_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
>prophage 36
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1536047	1536551	3193374		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_017377353.1|1536047_1536551_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
>prophage 37
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1545380	1546805	3193374		Synechococcus_phage(100.0%)	1	NA	NA
WP_017377343.1|1545380_1546805_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
>prophage 38
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1554307	1589398	3193374	transposase	Escherichia_phage(16.67%)	39	NA	NA
WP_048875864.1|1554307_1555333_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|1555716_1556574_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|1556743_1557472_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|1557672_1559076_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|1559221_1559719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|1559788_1560691_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376921.1|1560948_1561281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772950.1|1561342_1561879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376923.1|1561977_1563144_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_017376924.1|1563449_1566248_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376925.1|1566306_1567527_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376927.1|1568032_1568170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376929.1|1568596_1568884_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|1569040_1569370_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376931.1|1569404_1571042_-	response regulator	NA	NA	NA	NA	NA
WP_017376932.1|1571143_1572193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376933.1|1572265_1572910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|1572906_1574160_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376935.1|1574177_1575449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376936.1|1575473_1576064_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376937.1|1576208_1576433_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|1576413_1576743_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_026063582.1|1576969_1577533_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_017376939.1|1577569_1578031_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_017376940.1|1578108_1579794_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_026063583.1|1579843_1580671_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|1580670_1581219_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_017376942.1|1581348_1581741_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017376943.1|1581991_1582249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|1582245_1582857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|1583061_1583277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|1583293_1583431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|1583900_1584875_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|1585158_1586361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|1586657_1586915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|1586872_1587313_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|1587418_1587985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|1588129_1588384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|1588528_1589398_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1592417	1593695	3193374		Stx2-converting_phage(100.0%)	1	NA	NA
WP_017376955.1|1592417_1593695_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
>prophage 40
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1601509	1627860	3193374	transposase,tRNA,protease	Staphylococcus_phage(40.0%)	29	NA	NA
WP_017376964.1|1601509_1603990_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|1604052_1604484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|1604684_1604975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|1605034_1606633_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|1606797_1607133_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|1607161_1608826_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|1608825_1609467_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|1609466_1610210_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|1610268_1610505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|1610655_1612023_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|1612033_1612585_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|1612665_1613769_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|1613770_1615528_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|1615750_1616374_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|1616428_1616848_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|1616988_1617603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|1617660_1618446_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|1619077_1620094_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|1620096_1620609_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|1620650_1621124_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|1621179_1621965_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|1622008_1622749_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|1622838_1623087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|1623462_1624116_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|1624084_1624264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|1624661_1625876_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875859.1|1626184_1626979_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1627111_1627339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|1627581_1627860_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 41
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1643697	1656505	3193374		Klosneuvirus(25.0%)	6	NA	NA
WP_016209759.1|1643697_1644888_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_017378035.1|1644915_1647027_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209732.1|1647042_1647516_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_016209765.1|1647620_1647995_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_017378036.1|1648156_1652365_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_017378037.1|1652428_1656505_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
>prophage 42
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1671770	1674932	3193374		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_017378059.1|1671770_1672913_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.5	2.7e-31
WP_017378060.1|1672997_1674932_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.6	6.3e-150
>prophage 43
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1681928	1684314	3193374		Staphylococcus_phage(50.0%)	3	NA	NA
WP_017378070.1|1681928_1682402_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.9e-28
WP_036771446.1|1682592_1683486_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_017378072.1|1683495_1684314_-	hypothetical protein	NA	M1HWP4	Paramecium_bursaria_Chlorella_virus	28.5	1.3e-16
>prophage 44
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1690199	1695049	3193374	transposase	Staphylococcus_phage(100.0%)	5	NA	NA
WP_036771330.1|1690199_1691174_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378082.1|1691995_1692349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378083.1|1692378_1692957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242676.1|1693074_1693836_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048875857.1|1694074_1695049_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 45
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1701446	1703350	3193374		Bacillus_virus(50.0%)	2	NA	NA
WP_017378095.1|1701446_1702856_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.0	7.6e-28
WP_047927315.1|1702852_1703350_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	33.6	1.1e-13
>prophage 46
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1711521	1822368	3193374	transposase,tRNA,protease	Staphylococcus_phage(13.33%)	102	NA	NA
WP_017378106.1|1711521_1712466_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|1712465_1712819_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|1712867_1715543_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|1715559_1717077_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|1717153_1717606_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|1717824_1719264_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|1719263_1720802_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|1720816_1722787_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|1722790_1723096_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|1723119_1723743_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|1723762_1724251_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|1724264_1725290_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|1725294_1727688_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|1727737_1729027_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|1729033_1729534_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|1729533_1730787_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|1730788_1731466_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|1731483_1731969_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|1731959_1732328_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|1733006_1733369_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|1733382_1734144_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|1734445_1735792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|1735888_1736431_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|1736546_1737380_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|1737401_1737995_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|1738170_1739190_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|1739460_1739862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|1739872_1740196_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|1740219_1741230_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|1741296_1742145_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|1742261_1743173_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|1743939_1744815_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|1744873_1745254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|1745400_1745637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|1745933_1746404_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|1746458_1747313_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|1747784_1748003_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|1748105_1749356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|1749411_1749894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|1750130_1750559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|1750894_1751869_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|1751927_1752980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|1753298_1754264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|1754566_1755391_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|1755592_1756669_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|1756753_1757740_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|1757758_1758403_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|1758414_1759524_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|1759590_1760253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|1760512_1762396_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|1762709_1764209_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|1764299_1765082_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|1765209_1766130_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|1766153_1766612_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|1766733_1767609_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|1767642_1768908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1769095_1769971_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|1770169_1770361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|1770565_1771861_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|1772180_1772399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|1772435_1773815_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|1773842_1774301_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|1774278_1775496_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|1775688_1775925_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|1775938_1776094_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|1776174_1777137_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|1777296_1778613_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|1778622_1779291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|1779701_1781516_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|1782231_1782417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|1782598_1783057_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1783775_1784651_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|1784882_1785281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|1785284_1785527_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|1786416_1788168_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|1788178_1788979_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|1789081_1789570_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|1790069_1790993_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|1791089_1791434_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|1797128_1798091_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|1798129_1799005_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|1799264_1800524_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|1800746_1801073_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|1801267_1802218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|1802275_1804342_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|1804347_1805343_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|1806100_1807681_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|1807828_1809238_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|1809297_1810431_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|1810569_1811394_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_027242723.1|1811621_1811921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|1811917_1812130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|1812143_1812281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052673.1|1812418_1812643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|1813703_1814075_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|1814385_1814673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|1814824_1815673_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|1815795_1816767_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|1816869_1817910_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|1820448_1820739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|1821006_1821267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1821393_1822368_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 47
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1828925	1829882	3193374		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017377563.1|1828925_1829882_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
>prophage 48
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1843578	1845823	3193374	tRNA	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage(50.0%)	2	NA	NA
WP_017377407.1|1843578_1844100_-	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377406.1|1844425_1845823_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
>prophage 49
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1855361	1916006	3193374	transposase,tRNA	Acinetobacter_phage(33.33%)	57	NA	NA
WP_075278722.1|1855361_1856237_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|1856761_1857358_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|1857628_1858207_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|1862729_1864235_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|1864262_1864544_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|1864692_1865034_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|1865154_1867059_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|1867191_1868763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278723.1|1868780_1869992_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|1870113_1871112_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|1871115_1871874_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|1871875_1873075_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|1873058_1873730_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|1873751_1874528_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|1874531_1875530_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|1875531_1876110_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|1876106_1877576_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|1877619_1877907_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|1878107_1879028_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|1879143_1879698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|1879813_1880239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|1880509_1880860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|1881053_1881593_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|1881677_1882214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|1882873_1883176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|1883624_1884194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|1884262_1884607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|1884785_1885760_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|1886026_1886200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1886305_1887709_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|1887713_1888733_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|1889349_1889679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|1889904_1890303_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|1891170_1892121_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|1892120_1894199_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|1894340_1894856_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|1894864_1895428_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|1895408_1896155_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|1896293_1896746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|1896881_1897718_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|1897714_1898611_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|1898643_1899711_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|1899729_1900098_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|1900123_1901575_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|1901581_1902961_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|1903001_1904315_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|1904304_1905279_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|1905372_1905876_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|1906010_1907162_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|1907158_1907638_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|1907784_1910106_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|1910050_1910677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|1910681_1911581_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|1911761_1912316_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1912355_1913330_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|1913919_1914297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1915031_1916006_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 50
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1926199	1927507	3193374		Moraxella_phage(100.0%)	1	NA	NA
WP_027242742.1|1926199_1927507_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
>prophage 51
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1935596	1938290	3193374		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_027242743.1|1935596_1938290_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
>prophage 52
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1948918	1950052	3193374		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_017378449.1|1948918_1950052_-	hypothetical protein	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	3.1e-40
>prophage 53
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1973075	1977756	3193374		Bacillus_virus(50.0%)	3	NA	NA
WP_017378470.1|1973075_1975487_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.1e-110
WP_027242745.1|1975517_1976615_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_017378473.1|1976649_1977756_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.0	7.5e-47
>prophage 54
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	1982398	2101358	3193374	transposase,tRNA,protease	Escherichia_phage(18.18%)	109	NA	NA
WP_017378478.1|1982398_1983778_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|1983892_1985785_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|1985832_1986459_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|1986478_1987363_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|1987395_1988286_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|1988400_1988799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|1988803_1989619_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|1989670_1990075_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|1990129_1990600_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|1990611_1991139_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|1991155_1992697_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|1992722_1993583_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|1993613_1995005_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|1995029_1995458_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|1995551_1996916_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|1996972_1998808_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|1998921_1999650_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|2000176_2001718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|2001984_2002641_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|2003338_2003998_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|2004142_2004400_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|2004512_2005265_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|2005323_2006037_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|2006228_2006861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2008595_2009999_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|2009995_2010220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2010299_2011274_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|2011293_2011611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|2011688_2011901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|2012147_2012567_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|2012664_2013111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|2013455_2014454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|2014486_2014840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|2014884_2015157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|2015553_2016972_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|2017198_2018140_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|2018174_2020154_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|2020150_2020756_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|2020757_2021099_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|2021099_2021936_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|2022101_2022419_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|2022496_2023918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|2023914_2024610_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|2025796_2026642_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|2026651_2026990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|2027558_2028962_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|2028994_2029939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|2030143_2030317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|2030924_2031974_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2032128_2032347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2032666_2034070_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|2034080_2034638_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|2034634_2035510_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|2035734_2036025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|2038648_2039422_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|2039840_2040197_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|2040228_2040681_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243065.1|2040833_2043896_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_017376261.1|2043892_2044957_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376260.1|2045320_2046274_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376259.1|2046306_2047470_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376258.1|2047475_2048075_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376257.1|2048262_2048763_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376256.1|2048780_2049869_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376255.1|2050007_2051252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|2051248_2052091_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376253.1|2052070_2052880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420746.1|2053066_2053282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376251.1|2053282_2054245_+	TonB family protein	NA	NA	NA	NA	NA
WP_017376250.1|2054300_2054852_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376249.1|2054981_2055404_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376248.1|2055396_2056158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376247.1|2056212_2056911_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_026063518.1|2056897_2057746_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376244.1|2058363_2058888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376243.1|2059020_2060235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376242.1|2060549_2061611_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376241.1|2061624_2063352_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027243064.1|2063385_2064117_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027243063.1|2064116_2064905_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243062.1|2065009_2065633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376237.1|2066964_2067717_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027242703.1|2073396_2074020_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376193.1|2074059_2074545_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017376192.1|2074591_2075737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653742.1|2075738_2078009_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_036771610.1|2078010_2078871_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_017376188.1|2078867_2079740_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_017376187.1|2079736_2080744_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376186.1|2080763_2081171_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_065653741.1|2081199_2082588_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_027242702.1|2082584_2083757_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_017376183.1|2083788_2084640_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242701.1|2084649_2085813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242700.1|2085809_2086817_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242699.1|2086813_2087950_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017376177.1|2087946_2088873_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_017376176.1|2088967_2090368_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_144420747.1|2090655_2092044_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_036771589.1|2092125_2092953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771607.1|2093171_2094176_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|2094229_2094460_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771588.1|2094467_2095346_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_017376171.1|2095482_2096457_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376170.1|2096814_2097915_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376169.1|2097980_2098691_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036771603.1|2098740_2099982_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016209598.1|2100048_2100633_+	YggT family protein	NA	NA	NA	NA	NA
WP_144420748.1|2100722_2101358_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A0N9R3I3	Chrysochromulina_ericina_virus	28.9	6.9e-05
>prophage 55
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2109498	2113877	3193374		Burkholderia_virus(50.0%)	3	NA	NA
WP_017376155.1|2109498_2110401_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.7	4.5e-18
WP_058893787.1|2110424_2111309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376152.1|2111867_2113877_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	8.6e-110
>prophage 56
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2117130	2124661	3193374		Staphylococcus_phage(50.0%)	4	NA	NA
WP_017376147.1|2117130_2118651_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	3.2e-32
WP_047927418.1|2119641_2120961_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017376145.1|2121064_2121448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278724.1|2121595_2124661_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.8	7.1e-55
>prophage 57
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2136465	2136723	3193374		Rhizobium_phage(100.0%)	1	NA	NA
WP_017376129.1|2136465_2136723_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	42.1	1.2e-11
>prophage 58
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2142571	2144764	3193374		Bacillus_phage(100.0%)	1	NA	NA
WP_017376121.1|2142571_2144764_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.9	1.7e-106
>prophage 59
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2171195	2306669	3193374	tail,transposase,tRNA,protease	Acinetobacter_phage(10.53%)	115	NA	NA
WP_017377604.1|2171195_2173178_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|2173387_2174731_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|2174997_2177667_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|2177690_2179607_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|2179776_2181198_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|2181342_2182317_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|2182326_2182626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|2182743_2182965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|2183128_2184790_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|2184862_2185153_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|2185379_2185835_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|2185899_2186364_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|2186455_2187802_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|2187801_2188707_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|2188768_2189755_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2189747_2189990_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|2190108_2191653_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|2191699_2192986_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|2193028_2194432_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|2194436_2196974_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|2197370_2197619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|2197550_2198012_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|2198506_2199202_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|2199303_2200866_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|2201193_2202987_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|2203073_2203346_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|2203351_2203978_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|2203964_2205395_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|2205716_2206772_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|2206740_2207418_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|2207407_2208256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|2208401_2208695_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|2208806_2209619_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|2209917_2210772_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|2210925_2211975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|2212020_2212677_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|2212694_2213975_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|2214248_2215610_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|2215670_2216222_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|2221652_2222924_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|2222980_2223964_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|2223960_2224746_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|2225053_2225503_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2225596_2227000_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|2227437_2228919_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|2228974_2230084_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|2231656_2231869_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|2231909_2232605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278726.1|2232868_2235103_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|2235305_2235872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|2236029_2236590_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|2236709_2238113_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|2238109_2238466_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|2238721_2239546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|2240243_2240768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2241053_2242028_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|2242127_2242679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2242791_2243445_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|2243696_2245154_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|2245267_2245747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2245984_2246590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|2246869_2247985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2247923_2248610_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_075278727.1|2248603_2249560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2249614_2250778_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|2251117_2251342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2251724_2252012_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|2252186_2252942_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2252974_2253406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|2253381_2253858_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|2253864_2255442_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|2255444_2256209_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|2256262_2256799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2256795_2257527_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|2257751_2258513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2258838_2259714_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|2261116_2261272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2261465_2263175_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|2263828_2264137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|2264154_2266347_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|2267154_2267403_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|2267515_2267749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|2267983_2268514_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|2268518_2269232_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|2269859_2270585_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|2270593_2272657_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|2272836_2273316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2273808_2275176_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|2275567_2276365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2276476_2277766_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|2277946_2278933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|2279049_2279229_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|2279240_2279672_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|2279884_2280244_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|2280413_2282039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2282762_2284190_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|2284483_2285665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|2288267_2289566_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|2289921_2290815_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|2290811_2291117_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|2291142_2291922_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|2291951_2292182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2292333_2292579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|2292765_2293557_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|2294256_2294979_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|2294975_2295857_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|2295880_2297371_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|2297460_2298348_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|2299020_2299512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2299516_2299744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2299836_2300811_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|2300787_2302026_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243188.1|2302508_2303054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375937.1|2303405_2304224_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_036772717.1|2304299_2306669_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.4	3.7e-160
>prophage 60
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2309992	2366295	3193374	transposase	Staphylococcus_phage(50.0%)	51	NA	NA
WP_053856767.1|2309992_2311396_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2311501_2311687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2312385_2313789_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|2313879_2314383_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2314422_2315397_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|2315393_2315963_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|2316449_2317142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|2317749_2318742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|2318731_2320504_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|2320504_2320693_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|2320730_2321705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|2321763_2321958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2322024_2322252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2322381_2323257_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2323484_2323634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|2323625_2323892_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|2324036_2324936_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2325022_2325280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2325892_2327119_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|2327208_2327748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|2327869_2328508_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|2328541_2329030_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|2329276_2329579_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|2329559_2330048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2330618_2331917_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|2332033_2332324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2332362_2335017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|2335730_2335985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|2336294_2337023_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|2337793_2338978_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|2338996_2339941_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|2340246_2341032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|2341145_2341514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|2341742_2343320_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|2344103_2348528_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|2348664_2350188_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|2350392_2350620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|2350764_2351022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2351589_2352561_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|2352485_2352794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|2352857_2353079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2353198_2354173_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|2354226_2355198_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2355277_2356252_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|2356612_2359282_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|2359452_2360334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|2360344_2361001_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|2361067_2361772_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|2362002_2363406_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378310.1|2363436_2364366_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027242738.1|2364600_2366295_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
>prophage 61
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2401900	2404606	3193374	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017378343.1|2401900_2403475_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_048875857.1|2403631_2404606_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 62
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2414908	2415457	3193374		Klosneuvirus(100.0%)	1	NA	NA
WP_017378355.1|2414908_2415457_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.9	5.9e-29
>prophage 63
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2418731	2542774	3193374	transposase,tRNA	Staphylococcus_phage(24.14%)	106	NA	NA
WP_017378360.1|2418731_2420300_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	6.7e-09
WP_048875895.1|2420391_2421555_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|2421608_2422610_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|2422691_2423261_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|2423474_2424446_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|2424457_2426053_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|2426073_2427105_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|2427436_2428540_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|2428651_2429836_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|2429913_2431902_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|2433061_2434435_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|2434452_2435439_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|2435441_2436596_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|2436592_2437288_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|2437430_2438921_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|2438941_2439991_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|2440057_2441452_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|2442384_2444316_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|2444320_2444851_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|2444885_2445080_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|2445122_2445482_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|2445613_2446609_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|2446621_2449003_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|2449008_2449296_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|2449562_2449769_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|2451377_2452151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|2452152_2453094_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|2453227_2454805_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|2454998_2455397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|2456397_2456604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|2457408_2458053_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|2458120_2459377_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|2459632_2459812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2460034_2460262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|2461537_2462296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|2462513_2463077_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|2463180_2463729_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|2464325_2465478_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|2465823_2466120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2466379_2467291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2467525_2468065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|2469227_2469365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2469611_2470340_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|2470386_2470995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|2472269_2472530_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|2472703_2474242_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|2474420_2475347_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|2475451_2476384_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|2476880_2479694_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|2479686_2480196_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|2480199_2480643_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|2480738_2482040_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|2482301_2482670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|2482661_2483384_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_155052690.1|2484466_2485798_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_144420611.1|2485830_2486031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2486565_2487540_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|2487950_2488280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|2488665_2489031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|2489154_2490015_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2490001_2490781_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|2490856_2491540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|2491700_2492306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|2492522_2493026_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|2493227_2493482_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|2493983_2494451_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|2495017_2496208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2497042_2498446_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|2498752_2499373_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|2499552_2500527_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|2500692_2500959_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|2500955_2501456_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|2501576_2502452_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|2504111_2504642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|2504641_2505166_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|2505328_2506444_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|2506680_2507841_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|2508292_2510296_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|2510364_2511372_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|2511445_2512630_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|2512639_2514094_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|2514124_2515162_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|2515484_2515775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2517129_2518104_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046691.1|2518303_2518900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2519423_2519675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|2519879_2521043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|2521065_2521755_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|2521902_2522553_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|2522653_2523313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2525374_2526136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2526554_2526815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2526900_2527563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2527679_2528807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2529182_2529344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|2531475_2531847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2532126_2533368_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|2533505_2533736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|2533869_2534754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|2534782_2535409_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|2535439_2536639_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|2536877_2537975_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|2538128_2539667_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|2539987_2540323_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|2541135_2541429_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|2541799_2542774_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 64
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2547454	2548087	3193374		Indivirus(100.0%)	1	NA	NA
WP_016210817.1|2547454_2548087_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
>prophage 65
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2552601	2661027	3193374	transposase,tRNA	Bacillus_phage(16.13%)	113	NA	NA
WP_017377787.1|2552601_2552829_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|2553085_2554060_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048875941.1|2554483_2554795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2554791_2555874_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155051409.1|2555907_2556708_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|2556826_2557522_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|2558026_2558533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|2558626_2559184_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|2559481_2560831_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2560917_2561175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2561242_2561953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|2562097_2562277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2562800_2564060_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|2564192_2564666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|2564674_2566057_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|2566049_2566664_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|2566743_2567460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|2567634_2569959_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|2570125_2571100_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376573.1|2572029_2573772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|2573943_2575035_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|2575067_2575706_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|2575744_2576017_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|2576115_2576358_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|2576375_2576678_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|2576761_2577304_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|2577464_2578091_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|2578096_2578936_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|2578925_2579576_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|2579579_2580413_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|2580502_2581630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2581896_2582049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2582156_2582351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|2582543_2583194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|2583448_2584540_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|2584536_2585901_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|2586025_2587222_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|2587278_2587842_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|2588774_2589443_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|2589589_2590891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|2592381_2592786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|2593019_2594102_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|2594086_2594707_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2594771_2595647_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|2595724_2596300_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|2597108_2597402_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|2597518_2597668_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2598996_2599971_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|2600069_2600225_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|2600143_2600404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|2600580_2601108_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|2601362_2601587_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|2601731_2602553_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|2602510_2602804_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|2604280_2604568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2605060_2605831_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2605900_2607313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2607679_2609050_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|2609046_2609211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|2609270_2609558_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|2610589_2611180_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|2611306_2612692_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|2612789_2612987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|2613079_2613913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2614450_2614804_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|2614816_2615053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|2615052_2615259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|2615420_2616140_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|2616228_2618013_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|2618319_2618475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|2618401_2618656_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2618801_2619623_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|2619805_2620030_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2620135_2621539_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|2622103_2622292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|2622421_2622688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|2623073_2624714_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|2624826_2626176_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|2626172_2627042_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|2627966_2629280_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|2629276_2630047_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|2630043_2630271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046617.1|2630975_2631116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046616.1|2631260_2632424_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
WP_069971647.1|2632392_2632989_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2633957_2634185_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|2635152_2635557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2635560_2636556_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|2636541_2637744_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|2637670_2638285_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|2638981_2639143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|2639422_2639968_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|2640001_2640667_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155764145.1|2640726_2641338_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	5.1e-13
WP_048875917.1|2641277_2641682_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_144420767.1|2641960_2642638_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|2642680_2643262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2643406_2644078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|2644680_2645268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2646236_2646464_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|2646436_2646832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|2647260_2648076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|2648166_2649153_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|2649322_2649844_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|2649877_2650129_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|2650139_2651417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|2652108_2652636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|2652752_2655065_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|2655193_2656009_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377718.1|2656265_2656730_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|2658146_2658374_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|2658508_2659972_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|2659974_2661027_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
>prophage 66
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2665729	2729736	3193374	transposase,tRNA	Staphylococcus_phage(37.5%)	51	NA	NA
WP_048875919.1|2665729_2666047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|2666064_2666277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2667230_2667458_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|2668615_2669377_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|2671567_2672542_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|2672666_2674103_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|2674182_2675643_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|2675763_2676051_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|2676248_2677292_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|2677307_2678207_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|2678203_2678722_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|2678791_2679409_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|2679418_2680906_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|2680915_2684596_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|2684669_2685479_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|2685478_2686159_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|2686782_2687757_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2687799_2688795_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2688847_2689822_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|2690134_2691019_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|2691149_2691971_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2691972_2693010_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|2693013_2695671_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|2695748_2696558_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|2696964_2697732_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|2697896_2698775_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|2698778_2699516_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|2699519_2700077_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|2700084_2700831_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_080963646.1|2700745_2701645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2701733_2702609_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|2702705_2704283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242905.1|2704491_2704680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|2704727_2706638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|2707174_2707714_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|2707710_2708739_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|2708728_2709793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069468.1|2709780_2711994_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|2711995_2713063_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|2713347_2715765_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|2715845_2716379_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|2716489_2717539_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2717556_2718003_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|2718002_2718776_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|2718794_2719949_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|2720162_2720732_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_017376200.1|2720755_2724262_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.6	1.9e-192
WP_027242908.1|2724339_2725299_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|2725273_2726734_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|2726769_2728299_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|2728332_2729736_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 67
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2733546	2872642	3193374	transposase,integrase,protease	Staphylococcus_phage(14.81%)	116	2850396:2850455	2866552:2867048
WP_048876012.1|2733546_2734950_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2735095_2736499_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2736983_2737958_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|2738426_2739317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|2739977_2740814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|2741102_2743775_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|2744023_2745214_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|2745546_2745741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|2745677_2747330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2747930_2749157_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|2749552_2750098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|2750057_2750435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2750431_2751835_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|2752053_2752479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|2752530_2754018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|2754327_2754867_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2755156_2755384_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|2756629_2757205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|2757318_2758722_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|2758718_2759009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|2759376_2759790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|2760478_2762266_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|2762432_2763053_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|2763399_2763540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|2763559_2765536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|2765908_2767366_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|2767434_2769015_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|2769655_2773552_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|2773558_2773882_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|2773955_2774429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|2774460_2775456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|2775707_2777345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|2777704_2778652_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|2778970_2779315_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|2779408_2780080_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|2780120_2780948_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|2781034_2781562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|2782447_2782867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|2782976_2783558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|2783912_2785193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|2785313_2786177_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|2786265_2787060_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|2787297_2788284_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|2788289_2789816_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|2789911_2791156_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|2791209_2792589_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|2792706_2793492_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|2793834_2794479_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|2794513_2796319_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2796342_2796918_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|2797967_2798942_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|2801478_2802156_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|2803654_2803876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2804756_2804918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2804854_2805355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2805450_2805879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2806138_2806588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|2806640_2807075_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2807051_2808017_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|2808235_2808496_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|2808590_2809325_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|2809353_2809506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2809710_2810655_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|2810640_2811069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2811213_2811465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|2811852_2812761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|2813224_2814190_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|2814234_2814810_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|2814840_2816115_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|2816763_2817480_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|2817558_2818296_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|2818416_2819772_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|2819951_2820623_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|2820738_2821614_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|2822214_2823519_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2823631_2824237_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|2824318_2825620_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|2825687_2828120_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|2828223_2828496_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|2828578_2830477_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|2830508_2831393_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|2831401_2831797_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|2832219_2834367_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|2834338_2835688_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|2835684_2837805_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|2837801_2839505_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|2839639_2840782_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|2840838_2841867_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|2841993_2843508_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|2843614_2843815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|2843959_2844295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|2844439_2844676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|2844946_2845825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|2846461_2847406_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|2847679_2849083_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2849087_2849873_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|2850263_2851106_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
2850396:2850455	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|2851102_2851399_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|2852880_2853492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|2853560_2854367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2854670_2855645_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|2855816_2857709_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|2858281_2860597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2861011_2862415_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2862855_2863335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|2863402_2864659_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075278730.1|2864805_2865279_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|2865733_2865874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2866071_2866776_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|2867630_2867942_-	hypothetical protein	NA	NA	NA	NA	NA
2866552:2867048	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|2868005_2868185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2868747_2868930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2868993_2869221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|2869428_2870193_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|2870419_2870713_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|2871238_2872642_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 68
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	2877313	3019949	3193374	transposase,tRNA,protease	Staphylococcus_phage(17.86%)	119	NA	NA
WP_036774028.1|2877313_2879047_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|2879118_2880825_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|2880816_2881875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2882128_2882977_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|2883571_2884018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|2884707_2886120_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|2886511_2887954_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|2888085_2888154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|2888352_2889684_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2889788_2890763_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_075275283.1|2890905_2891517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2891957_2892770_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764146.1|2892828_2893116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815616.1|2893124_2895338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2895683_2896859_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|2898206_2898431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|2898459_2899623_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|2901865_2903011_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|2903603_2904539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|2906036_2906348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2906344_2907427_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|2907742_2907949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|2908046_2908577_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|2908864_2910043_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|2910191_2913956_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|2914014_2915517_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|2916068_2916704_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|2917201_2918449_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|2918671_2920108_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2920283_2921501_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|2921962_2922742_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2923748_2924723_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|2925768_2926080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2926076_2927159_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|2927469_2927676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|2929396_2930758_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|2930868_2931240_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|2931462_2932113_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|2932155_2933238_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|2933964_2934939_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|2935809_2936037_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|2938217_2939771_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|2940559_2940796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2940915_2941959_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2942205_2942607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|2942780_2943680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2944074_2945286_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|2945296_2945521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|2945842_2946007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2946099_2947503_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|2947669_2947978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|2948262_2948433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|2949061_2950111_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|2950179_2951202_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|2951247_2952162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2953130_2953358_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|2953314_2954184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|2955621_2956338_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|2956782_2958654_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|2958745_2960491_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|2960570_2961020_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|2961072_2961288_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|2961534_2962551_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|2962599_2963229_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|2963569_2964781_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|2964813_2965164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2965129_2965810_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2966086_2966506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|2966651_2967488_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2967531_2968506_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|2968525_2969161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|2969404_2970406_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|2970504_2971713_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|2971702_2973433_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|2973616_2974753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|2975496_2976132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|2976246_2977581_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|2977709_2978351_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|2978656_2979079_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|2979356_2980319_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|2980357_2981533_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|2981621_2983322_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|2983321_2984860_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|2984898_2986551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|2986624_2987380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2987566_2988442_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|2988706_2988901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2989045_2989519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|2989788_2989962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2990166_2991480_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|2991476_2992121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|2992639_2993827_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|2993959_2994649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|2994722_2996072_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|2996175_2998356_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|2998425_2999301_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|2999347_2999644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|2999767_3000175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|3000154_3000733_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|3001155_3001818_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|3001848_3002217_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|3002227_3003544_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|3003790_3004402_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|3004477_3004657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|3004827_3005121_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|3005361_3005664_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|3005718_3007992_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|3008051_3008297_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|3008421_3009177_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|3009285_3010260_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|3010467_3011229_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|3011212_3012169_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|3012431_3014930_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|3014933_3015674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|3016123_3016918_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|3017080_3017869_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|3017865_3019077_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|3019069_3019426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|3019520_3019949_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
>prophage 69
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	3023438	3082200	3193374	transposase,tRNA	unidentified_phage(18.18%)	56	NA	NA
WP_017376088.1|3023438_3024716_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|3024727_3025459_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|3025430_3026687_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|3026796_3028200_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|3028352_3028523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|3029928_3030759_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|3030986_3031136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|3031330_3032152_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|3032148_3033042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|3033087_3033609_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|3033686_3034172_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|3034305_3034962_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|3034958_3035267_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|3035615_3036587_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|3036891_3037683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|3037672_3038536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|3038562_3038982_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|3039034_3039991_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|3040473_3043146_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|3043226_3043853_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|3044009_3045608_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|3045697_3047119_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|3047149_3047671_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|3047667_3048273_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|3048349_3049360_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|3049472_3050177_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|3050211_3050643_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|3050645_3051740_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|3051799_3053152_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|3053187_3053829_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|3053901_3054801_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|3054803_3055451_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|3055501_3056305_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|3056486_3056702_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|3056705_3056939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|3057000_3058593_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|3058795_3059725_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|3059726_3060494_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|3060859_3061630_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|3061688_3062663_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|3062770_3063133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|3063302_3065012_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|3065252_3066656_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|3066707_3066965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|3067713_3069021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|3069480_3069858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|3070002_3070404_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|3070968_3071748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|3071815_3071956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|3072156_3072354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|3072491_3073091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|3073273_3074746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|3075148_3076894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|3077329_3078190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|3078707_3080651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|3080796_3082200_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 70
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	3088443	3134126	3193374	transposase,protease	Burkholderia_virus(25.0%)	37	NA	NA
WP_036773465.1|3088443_3090483_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|3090498_3091554_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|3091564_3092095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|3094252_3095173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|3095317_3095458_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|3096346_3096730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|3096739_3097099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|3098033_3098180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|3098418_3099675_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|3099930_3100110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|3100429_3101083_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|3101287_3101614_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|3102385_3103789_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|3103959_3105330_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|3105376_3106276_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|3106256_3109061_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|3109140_3109737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|3110150_3110906_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|3110995_3111223_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|3112339_3112981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|3113250_3114576_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|3114572_3116630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|3116607_3117180_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|3117262_3117595_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|3117659_3118694_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|3118681_3119803_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|3119896_3120880_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|3121036_3122704_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|3122990_3123842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|3124250_3126719_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|3126732_3127707_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|3127693_3128962_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|3128995_3130744_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|3130923_3131127_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|3131345_3132023_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|3132302_3132560_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
WP_017377788.1|3133007_3134126_+	hypothetical protein	NA	A0A1V0SIK8	Klosneuvirus	29.3	1.0e-11
>prophage 71
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	3156288	3161311	3193374		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_017377423.1|3156288_3157971_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_026063633.1|3158122_3158398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963565.1|3158542_3159040_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377424.1|3159433_3160417_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_017377425.1|3160409_3160631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377426.1|3160669_3161311_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
>prophage 72
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	3173703	3174678	3193374	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771332.1|3173703_3174678_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
>prophage 73
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	3178815	3179790	3193374	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036773116.1|3178815_3179790_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 74
NZ_CP013786	Piscirickettsia salmonis strain PM58386B, complete genome	3193374	3184221	3189130	3193374	tRNA	Klosneuvirus(50.0%)	3	NA	NA
WP_017376399.1|3184221_3186993_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|3187061_3187505_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|3187657_3189130_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
>prophage 1
NZ_CP013787	Piscirickettsia salmonis strain PM58386B plasmid p1PS7, complete sequence	181332	1110	54779	181332	portal,terminase,transposase	Salmonella_phage(30.43%)	57	NA	NA
WP_036774350.1|1110_1839_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|2321_3344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876196.1|5157_6306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|6335_7313_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|7228_7618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|8413_9928_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|9914_10892_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|11049_11262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|12262_13240_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|13155_13545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|14340_15855_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|15841_16819_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|16976_17189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|18189_19167_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243212.1|19661_19949_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|19938_20193_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|20410_20572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|20586_21564_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|22044_23022_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|23487_24468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|24699_25209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|25248_25611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|25924_26899_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|26992_27721_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243190.1|27901_31246_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|31249_31435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|32813_33527_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|33573_34308_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|34345_34732_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|34818_35253_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|35457_36789_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_075278733.1|36791_37274_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|37360_37744_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_017375952.1|37939_38143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242930.1|38332_39715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242931.1|39860_40268_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|40276_40504_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_026063496.1|40636_41002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081078123.1|41880_42243_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|42272_42425_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|42562_42796_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|43097_44141_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|44248_44656_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|44959_45955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|46225_46651_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_155048090.1|46601_47120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375966.1|47264_47831_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_048876207.1|47831_49307_+	response regulator	NA	NA	NA	NA	NA
WP_144420845.1|49812_50043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|50170_50623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|50619_50838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|51144_51354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375972.1|51798_52107_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242938.1|52108_52477_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048876229.1|52890_53862_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|53780_53981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771279.1|54050_54779_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 2
NZ_CP013787	Piscirickettsia salmonis strain PM58386B plasmid p1PS7, complete sequence	181332	60435	122515	181332	transposase	Streptococcus_phage(54.17%)	59	NA	NA
WP_048876208.1|60435_61263_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_048876229.1|62127_63099_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|63667_64396_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|64471_64744_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|64747_65008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046631.1|67639_68290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|68364_69342_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|69469_70198_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|70380_71667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|71687_71852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420842.1|72268_72427_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|72488_73217_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036771293.1|75831_76098_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|76643_77372_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|77412_77583_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|77658_78636_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|78717_79401_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|79428_79581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|79982_81722_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|81724_82087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|83036_83723_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|84068_84689_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|84667_85396_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|85483_85870_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|85866_86112_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275474.1|86453_87566_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|88534_88753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|88797_89202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|89215_89554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|89546_89771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|90142_90751_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|90753_91482_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_051929563.1|91504_91894_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_036772541.1|91923_92652_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|92663_93368_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_144420840.1|93750_94182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|94212_95091_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|95044_95752_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|95868_96045_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|97283_98174_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243190.1|98482_101827_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|102409_103138_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377521.1|104065_104419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|104927_105656_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_155046640.1|105624_105792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275471.1|106427_107402_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_017377525.1|107942_108740_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_027243210.1|110609_111344_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_047927763.1|111757_112021_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|112017_112416_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|112659_113115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|115015_115273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|115417_115588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|116257_117184_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|117379_118108_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|119256_119877_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|119932_120661_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377512.1|121511_121784_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|121786_122515_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 3
NZ_CP013787	Piscirickettsia salmonis strain PM58386B plasmid p1PS7, complete sequence	181332	150640	161055	181332	transposase	Streptococcus_phage(62.5%)	10	NA	NA
WP_036772541.1|150640_151369_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|151520_152204_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|152208_152778_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|152948_153677_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|154160_154889_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|154941_155337_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|155630_156359_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|156516_159858_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|159921_160161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|160326_161055_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 4
NZ_CP013787	Piscirickettsia salmonis strain PM58386B plasmid p1PS7, complete sequence	181332	174705	181203	181332	portal,transposase	Burkholderia_virus(16.67%)	8	NA	NA
WP_082300723.1|174705_174933_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|175665_176157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|176238_176967_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|177310_177457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|177762_179628_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|179700_179967_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|180147_180489_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|180669_181203_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
>prophage 1
NZ_CP013788	Piscirickettsia salmonis strain PM58386B plasmid p2PS7, complete sequence	50691	0	2996	50691	capsid,tail,head,transposase	Shigella_phage(33.33%)	4	NA	NA
WP_017375778.1|138_450_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|834_1419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|1432_1972_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|2021_2996_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 2
NZ_CP013788	Piscirickettsia salmonis strain PM58386B plasmid p2PS7, complete sequence	50691	6446	10086	50691	transposase	unidentified_phage(50.0%)	5	NA	NA
WP_036771330.1|6446_7421_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|7708_8026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|8009_8711_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|8734_8968_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|9111_10086_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
>prophage 3
NZ_CP013788	Piscirickettsia salmonis strain PM58386B plasmid p2PS7, complete sequence	50691	19121	23078	50691	transposase	Brucella_phage(33.33%)	5	NA	NA
WP_017377663.1|19121_19451_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
WP_017377662.1|19461_19776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275453.1|19863_20838_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	2.9e-26
WP_048876255.1|21080_22082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|22100_23078_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 4
NZ_CP013788	Piscirickettsia salmonis strain PM58386B plasmid p2PS7, complete sequence	50691	26548	50229	50691	tail,transposase	unidentified_phage(23.08%)	25	NA	NA
WP_048876253.1|26548_27205_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|27201_28176_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_032126138.1|28617_28881_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|29308_30283_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_087910671.1|30670_31135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|31228_31414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|32369_33344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036816420.1|33747_34380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929651.1|34383_35436_-	ParA family protein	NA	NA	NA	NA	NA
WP_036771347.1|35597_36575_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375933.1|36974_37967_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	5.0e-10
WP_036771355.1|37983_39420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|39891_40869_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|40896_41325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|41383_44074_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|44070_44628_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|44617_45403_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|45332_46004_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|46000_46342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|46334_48413_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|48416_48683_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|48739_49063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|49064_49487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|49486_49837_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|49833_50229_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
>prophage 1
NZ_CP013789	Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence	57431	0	9031	57431	transposase	Shewanella_sp._phage(25.0%)	9	NA	NA
WP_098082828.1|1278_1536_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|1535_2543_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046643.1|2590_2743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046642.1|2976_3468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|3495_5358_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_144420830.1|5463_5769_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242583.1|6125_6437_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_027242582.1|6433_6835_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242581.1|6844_9031_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
>prophage 2
NZ_CP013789	Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence	57431	41863	47791	57431		Choristoneura_rosaceana_entomopoxvirus(25.0%)	6	NA	NA
WP_053063426.1|41863_42649_+	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927059.1|42624_43326_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036775038.1|43311_44052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242605.1|44346_45642_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.8e-12
WP_036774869.1|46085_46934_-	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_047927060.1|46930_47791_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
>prophage 3
NZ_CP013789	Piscirickettsia salmonis strain PM58386B plasmid p3PS7, complete sequence	57431	53496	54087	57431	integrase	Caulobacter_virus(100.0%)	1	51777:51807	56099:56129
51777:51807	attL	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_027242600.1|53496_54087_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_027242600.1|53496_54087_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
56099:56129	attR	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
>prophage 1
NZ_CP013790	Piscirickettsia salmonis strain PM58386B plasmid p4PS7, complete sequence	33555	0	16246	33555	terminase,transposase,integrase,capsid	unidentified_phage(33.33%)	19	1:60	22832:23588
1:60	attL	GTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTAT	NA	NA	NA	NA
WP_027242946.1|1101_1683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275490.1|1718_2111_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_036771330.1|2207_3182_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242948.1|3201_3387_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_027242949.1|3389_3872_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242950.1|3958_4342_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242951.1|4554_5421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|6046_7021_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|7118_7475_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|7458_7713_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|7857_8223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|8755_9730_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|9906_10260_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|10252_10513_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|10743_11334_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|11399_11756_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|11869_12844_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016211499.1|14269_15253_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027242956.1|15268_16246_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	32.7	7.8e-16
22832:23588	attR	GTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP013790	Piscirickettsia salmonis strain PM58386B plasmid p4PS7, complete sequence	33555	20504	31348	33555	transposase,tail	unidentified_phage(50.0%)	12	NA	NA
WP_036771332.1|20504_21479_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
WP_144420852.1|22046_22187_-	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|22577_23552_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155046645.1|23571_23733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|23732_24386_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_048876242.1|24397_24775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|25259_26234_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027242942.1|26253_26931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365785.1|26930_27986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876241.1|28130_30107_-	host specificity protein J	NA	C7BGD4	Burkholderia_phage	37.8	3.7e-89
WP_027242943.1|30377_30794_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|30790_31348_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
