The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	34912	150959	3141542	transposase,tRNA	Leptospira_phage(10.0%)	109	NA	NA
WP_033923779.1|34912_35749_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|35760_36033_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274825.1|36310_37372_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211312.1|37493_38240_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211306.1|38945_39899_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211305.1|39895_40177_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211309.1|40179_40974_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016211313.1|41014_41536_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016211307.1|41671_42145_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126213.1|42229_43120_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016211308.1|43149_43428_+	lipoprotein	NA	NA	NA	NA	NA
WP_016211310.1|43503_44217_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SEW9	Cyanophage	39.1	2.2e-39
WP_032126212.1|45462_46371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209955.1|46367_47561_+	DotG/IcmE/VirB10 family protein	NA	NA	NA	NA	NA
WP_016209971.1|47567_48473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556635.1|48531_49539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209959.1|49566_49974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307320.1|49998_50505_+	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_016209964.1|50497_51250_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_016209958.1|51249_52377_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_016209962.1|52378_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209953.1|52669_54976_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_016209954.1|54997_55522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126210.1|55527_56571_+	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_016209972.1|56570_57137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209975.1|57187_57619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209956.1|57624_60615_+	ATPase AAA	NA	NA	NA	NA	NA
WP_016209965.1|60619_61417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209973.1|61446_64551_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_016209950.1|64587_65379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556634.1|65682_66225_+	type IVB secretion system apparatus protein IcmL/DotI	NA	NA	NA	NA	NA
WP_016209957.1|66225_66561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209969.1|66967_67933_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_032126209.1|67899_68520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209976.1|68720_68954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211682.1|69823_71506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211680.1|71553_73953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274826.1|74183_75089_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211224.1|75345_76617_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_016211218.1|76641_77379_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211221.1|77631_78774_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211223.1|78790_80392_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_080664858.1|80903_81041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|81037_82315_+	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_032126789.1|82664_82847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126600.1|83118_83640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|83759_84413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212251.1|84574_85111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300384.1|85272_86088_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075274828.1|86496_87819_+	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.2e-11
WP_052133287.1|87920_88319_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212039.1|88507_89065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212040.1|89241_90591_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_054300162.1|90794_91877_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210803.1|91951_93250_-	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016210808.1|93427_94279_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210805.1|94287_94959_+	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_032126141.1|95368_96643_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210804.1|96707_98627_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126139.1|98633_99563_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_033923779.1|102231_103068_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_075274829.1|103079_103352_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|103375_104350_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046725.1|104393_104534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300382.1|104750_105173_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377858.1|105391_106102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300209.1|106305_106671_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|106685_107192_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211414.1|107406_108225_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|108332_108794_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211415.1|108810_109734_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211417.1|109757_110807_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_051307357.1|110943_111537_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211422.1|111559_112030_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_032126143.1|112118_113390_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_075274832.1|113489_114464_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_016211838.1|114775_114949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211840.1|115419_115884_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211839.1|116042_117515_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211841.1|117632_118085_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|118944_120006_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|120308_121391_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212483.1|121401_122199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300286.1|122195_122660_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|123478_124453_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075274834.1|124493_125459_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211470.1|126225_126879_+	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_016211471.1|126938_128924_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_032126343.1|129054_129867_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_032126344.1|129987_131076_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_016211467.1|131078_131645_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_075273298.1|131719_132295_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|132240_132606_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052047029.1|132773_133115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|133187_134249_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032127044.1|134452_134653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212482.1|134867_135011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|135554_135848_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_129556503.1|136909_137776_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	5.6e-58
WP_016210508.1|137784_139482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|139802_140351_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075273576.1|140478_141207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|141266_144764_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_016210514.1|144821_146075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210515.1|146183_147086_-	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210512.1|147139_148177_-	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210506.1|148312_149551_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210510.1|149543_150272_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_081007040.1|150302_150959_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	155762	219022	3141542	transposase,protease,tRNA	Klosneuvirus(25.0%)	53	NA	NA
WP_155764109.1|155762_156359_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|156304_156670_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126565.1|156880_157153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211013.1|157470_159837_+	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_016211011.1|159897_161094_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_016211010.1|161372_163802_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016211008.1|163894_165397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|165505_166078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|166227_166905_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046963.1|167010_167577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|167836_169306_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_016210918.1|169390_170140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210930.1|170143_170917_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210927.1|170977_171928_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210917.1|172052_173495_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_032126561.1|173708_174893_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210925.1|175016_175703_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_016210921.1|175794_176379_+	superoxide dismutase	NA	NA	NA	NA	NA
WP_155046724.1|176603_176771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|177157_177463_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_054300375.1|177677_177878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728346.1|178684_179017_-	ester cyclase	NA	NA	NA	NA	NA
WP_059372539.1|179034_179898_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556501.1|179930_180506_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|180451_180817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211651.1|181050_182586_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016211650.1|182710_184195_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211648.1|184854_185394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|186597_186804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126642.1|186873_187335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126641.1|187370_189941_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_016209840.1|190048_190534_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_016209844.1|190706_191747_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209835.1|191724_192207_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209848.1|192203_194798_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209832.1|195104_195368_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209831.1|195646_196345_-	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209841.1|196564_196759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209827.1|196834_198394_-	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_129556633.1|198712_199609_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|199825_201301_-	APC family permease	NA	NA	NA	NA	NA
WP_016209826.1|201823_202846_-	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209830.1|203176_204544_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209846.1|204779_205034_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126639.1|205049_206336_+	GTPase HflX	NA	NA	NA	NA	NA
WP_016209836.1|206355_207570_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_016209838.1|207569_208463_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209839.1|208660_209959_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209834.1|213733_214492_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209842.1|214668_215058_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016212367.1|215785_216643_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_155764110.1|217792_217951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274836.1|218131_219022_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	245531	290721	3141542	transposase,integrase,tRNA	Tupanvirus(28.57%)	45	253327:253386	301131:301485
WP_016211285.1|245531_246311_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211286.1|246328_246676_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211289.1|246787_247060_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211767.1|248388_249198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211764.1|249748_250570_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126803.1|250770_252003_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_081377862.1|252489_253326_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
253327:253386	attL	TCGTTTATCCTCTATATCGGTAGCTTTTTTTCCACAACATCTTTCAAAGCCTCAATTTCT	NA	NA	NA	NA
WP_032126239.1|253337_253610_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211806.1|254399_255125_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016211805.1|255167_256706_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	36.9	7.5e-05
WP_016211804.1|256712_258098_+|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	32.1	2.5e-47
WP_075274841.1|258792_259920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212498.1|260774_261458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080743052.1|261813_262269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210332.1|262399_263143_-	ribonuclease T2 family protein	NA	NA	NA	NA	NA
WP_016210330.1|263240_263624_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210333.1|263827_264457_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_032126607.1|264530_265814_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_016210326.1|266153_267452_+	ankyrin repeats family protein	NA	NA	NA	NA	NA
WP_016210325.1|267605_268982_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210327.1|269117_270449_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_016210329.1|270509_271028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210321.1|271076_272045_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_129556511.1|272241_273678_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210323.1|273860_274571_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.7	6.3e-39
WP_032126606.1|274482_275004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210320.1|275153_276227_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_016210322.1|276363_277260_-	rasGEF domain protein	NA	NA	NA	NA	NA
WP_016211334.1|277877_278066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211336.1|278114_278729_+	chorismate mutase	NA	NA	NA	NA	NA
WP_032126265.1|278794_279712_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016211328.1|280035_280497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082827.1|280604_281906_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	36.9	4.1e-28
WP_016211330.1|282080_283181_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_032126267.1|283528_283771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211335.1|283764_284082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664859.1|284191_284779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|284947_285205_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|285204_286212_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_051307372.1|286259_286649_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016212275.1|286764_287748_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556512.1|287737_288313_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300363.1|288258_288606_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212589.1|289029_289467_+	MFS transporter	NA	NA	NA	NA	NA
WP_129556637.1|289941_290721_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
301131:301485	attR	AGAAATTGAGGCTTTGAAAGATGTTGTGGAAAAAAAGCTACCGATATAGAGGATAAACGAATGCTCGCTACTTACCTCAAAGATGAACATAAGCTAAGCCTCGTGGTTGCTTGTAATTTAGTCACTCTTCCAAGAGCAAGCTATTACCGAAAAAAACAGCATCAATCTGATAATGCTGAAATAATTTCAGAGCTAAAGACGTTAGCGAGCAAACACAAACGCTGGGGTTGCGACAAAATGGTCGCATATTTAAAAAACAAAGGTAAGCCTTGGAACCATAAGCGCATTCGTCGAGTCTATATTGAAATGGGCTTAAACATAAGCTGTAAACCAAAGCATCACTACGTCAAAAACG	NA	NA	NA	NA
>prophage 4
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	299847	415838	3141542	transposase,protease,integrase,tRNA	Staphylococcus_phage(17.24%)	106	299810:299869	330004:331030
299810:299869	attL	TCCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCT	NA	NA	NA	NA
WP_054300271.1|299847_300822_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126239.1|300906_301179_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274843.1|301190_301817_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	36.0	5.2e-29
WP_032126239.1|301887_302160_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|302171_303008_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377864.1|303021_303261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211148.1|303342_304671_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|304934_305504_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211151.1|305519_305831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|305840_306797_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|306909_307263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211145.1|308330_310070_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211152.1|310076_310499_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211144.1|310482_311112_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075273474.1|311668_312643_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075274844.1|312823_313075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|313083_313920_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|313931_314204_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556515.1|314222_314582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046727.1|315407_315752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|315995_316970_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075275108.1|316946_317552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556516.1|317910_318414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126239.1|318508_318781_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|318792_319629_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_080664876.1|319941_321804_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_081377865.1|322162_322447_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556638.1|323791_324472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273551.1|324471_324774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211974.1|324873_325995_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075274847.1|326277_327153_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155764111.1|327535_328507_+	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_016212013.1|328728_329112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212012.1|329127_329805_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_054300271.1|330041_331016_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300271.1|331663_332638_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
330004:331030	attR	TCCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAGTAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAG	NA	NA	NA	NA
WP_129556517.1|333035_333323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|333341_334178_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|334189_334462_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274849.1|334587_335331_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|335458_336433_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081377867.1|336491_337661_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_016211994.1|339079_339616_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_032126537.1|339652_339838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211991.1|340078_340984_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126538.1|341892_343311_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_081007034.1|343575_343860_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_080728343.1|343841_343982_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_016211561.1|344063_347930_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_016211564.1|348095_348971_+	ParA family protein	NA	NA	NA	NA	NA
WP_016211563.1|349003_349165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274852.1|349375_349819_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764112.1|350917_351133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047138.1|351183_351417_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126690.1|357462_357945_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_122943012.1|360181_360637_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210108.1|360822_362088_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_016210114.1|362180_363440_+	calcineurin-like phosphoesterase	NA	NA	NA	NA	NA
WP_016210107.1|363511_363784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210101.1|364073_365570_-	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210113.1|365992_367042_-	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210110.1|367229_367985_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210102.1|368045_369635_-	APC family permease	NA	NA	NA	NA	NA
WP_016210106.1|369817_370909_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210105.1|370928_371249_-	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210099.1|371332_372610_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_017377579.1|372631_373468_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210111.1|373474_375109_-	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_016210117.1|375529_375889_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210103.1|376169_377528_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_081377868.1|377603_378260_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016211627.1|378565_378730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211632.1|378955_379810_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211634.1|379845_380667_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211631.1|380922_381729_+	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_129556519.1|381987_383166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|383251_383545_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273327.1|383620_384196_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|384141_384507_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556520.1|384467_385364_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	1.8e-54
WP_129556521.1|385314_385503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|386036_386923_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300349.1|388074_389799_-	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_032126825.1|390350_391664_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_016211481.1|391896_393039_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_098082850.1|393113_393290_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_032126824.1|393325_393985_-	MarC family protein	NA	NA	NA	NA	NA
WP_032126823.1|394068_394791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941676.1|394779_395235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274855.1|395426_397052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273804.1|397187_397526_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|397485_397941_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212267.1|398107_398467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|398747_399395_+	LysE family translocator	NA	NA	NA	NA	NA
WP_155046730.1|399662_399803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274856.1|400021_401047_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211733.1|402802_403627_+	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_016211731.1|403682_404789_-	protein kinase	NA	NA	NA	NA	NA
WP_016211734.1|404804_405074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|405495_406194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047160.1|406798_407098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211399.1|407232_407976_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211403.1|407989_409033_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211405.1|409168_410941_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_129556522.1|411147_412380_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211669.1|415487_415838_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	428344	477853	3141542	transposase	Staphylococcus_phage(27.27%)	47	NA	NA
WP_075274858.1|428344_429430_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|429566_429932_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|429877_430453_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|431143_432118_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|432672_433734_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|433831_434806_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556523.1|435141_436027_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209772.1|437045_437597_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_016209778.1|437615_437990_-	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209796.1|438020_439238_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_080664823.1|439261_440662_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209795.1|440642_441398_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_016209793.1|441438_442887_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_032126436.1|442902_443358_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209771.1|444064_444787_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016209791.1|444951_445674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307317.1|445810_446104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209798.1|446165_448190_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_016209769.1|448202_448946_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_017377132.1|448987_449371_-	chemotaxis response regulator CheY	NA	NA	NA	NA	NA
WP_016209784.1|449457_450180_-	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_129556524.1|450176_451064_-	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209767.1|451044_452505_-	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_016209770.1|452535_454629_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209786.1|454663_455797_-	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209787.1|455810_456596_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209776.1|456611_456881_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_080664822.1|456910_457660_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209797.1|457656_458148_-	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_016209775.1|458144_458600_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_129556639.1|458616_459027_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209790.1|459322_459781_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209788.1|459832_460585_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016209785.1|460706_462650_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209794.1|462695_463319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377870.1|464053_464572_-|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.6e-07
WP_081007030.1|464607_465579_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051307341.1|466272_467871_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_016210848.1|468037_469222_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|469517_470072_-	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210850.1|470320_471574_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210851.1|471558_472230_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210847.1|472252_473257_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210849.1|473285_474734_-	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210855.1|474851_475829_+	DMT family transporter	NA	NA	NA	NA	NA
WP_129556525.1|475982_476802_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|476878_477853_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 6
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	492704	555089	3141542	transposase	Staphylococcus_phage(16.67%)	58	NA	NA
WP_032126790.1|492704_493610_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|494571_494910_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|494869_495325_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126602.1|495477_496785_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211857.1|497035_497914_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_016211855.1|497910_498378_-	bacterioferritin	NA	NA	NA	NA	NA
WP_016211856.1|498504_498690_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_054300271.1|498905_499880_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556640.1|500145_501372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211351.1|501447_501786_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_032127067.1|501782_502385_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211349.1|502381_504376_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211350.1|504439_505378_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211352.1|506056_506497_+	universal stress protein	NA	NA	NA	NA	NA
WP_075273313.1|506670_507009_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|506968_507424_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210793.1|507425_508106_+	OmpW family protein	NA	NA	NA	NA	NA
WP_016210801.1|508428_509400_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210795.1|509381_510353_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_051307339.1|510458_511265_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210791.1|511639_511840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|512266_513220_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556527.1|513681_513942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273540.1|514126_514738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210800.1|515104_515932_+	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_051307338.1|516143_517709_+	APC family permease	NA	NA	NA	NA	NA
WP_052047040.1|517734_518673_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|518742_519000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556528.1|519421_519850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211836.1|521373_521862_-	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_051307365.1|521881_522142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211834.1|522398_522713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664871.1|522803_524426_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.9	1.9e-27
WP_032126362.1|524857_525223_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|525168_525744_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212185.1|525837_526827_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|527160_527346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|528025_529981_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016210749.1|530279_530741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210752.1|530910_531708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556641.1|534084_535347_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_032126362.1|539221_539587_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|539532_540108_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211454.1|540248_540719_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_016211452.1|541469_542957_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211455.1|543018_544476_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_122942091.1|544581_544977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211456.1|545004_545583_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_054300325.1|546204_546477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046732.1|546670_546841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274862.1|546955_547552_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211726.1|547723_548317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211728.1|548703_550638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047168.1|550676_551597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|553161_553428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007023.1|553504_554161_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_081007004.1|554335_554791_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|554750_555089_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	559700	659596	3141542	transposase,integrase,plate,tRNA	Bacillus_thuringiensis_phage(14.29%)	90	551940:551999	628093:628395
551940:551999	attL	TAAAATTTTATCGATGATAGGCATGAGCCTATTTTTCATATTCTTGCGAATTTTATTGAT	NA	NA	NA	NA
WP_032126540.1|559700_560564_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212346.1|560797_560944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274864.1|563784_564810_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047087.1|564981_565200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211462.1|565360_566341_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211465.1|566968_567952_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_016211464.1|568102_568450_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_032126752.1|568446_569049_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211466.1|569136_570657_+	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126753.1|570726_571191_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_032126362.1|571283_571649_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|571594_572170_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212485.1|573026_573560_+	IQ calmodulin-binding motif-containing protein	NA	NA	NA	NA	NA
WP_129556532.1|573856_574039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664820.1|574347_574518_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209620.1|574500_577557_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209619.1|577643_579092_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209621.1|579524_580529_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209617.1|580649_581048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209627.1|581087_582911_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_075274865.1|582961_583717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274866.1|583767_586209_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_016209616.1|586239_587154_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016209618.1|587224_587854_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209632.1|587898_588333_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209630.1|588313_589054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|589067_590465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|590467_593416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|593415_595137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209636.1|595151_595556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|595556_598430_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075273639.1|598432_599149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|599516_601409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209637.1|601440_603978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|604009_605182_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209624.1|605178_605790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209623.1|605811_607311_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209615.1|607327_607834_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_155046733.1|609074_609212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046734.1|609356_609494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377829.1|610149_610884_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_129556535.1|611328_612214_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|612404_612662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377871.1|612866_613559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556536.1|613561_614715_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274872.1|614674_615214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274873.1|615688_616186_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046731.1|616207_617092_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274874.1|617093_617462_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126786.1|617760_620841_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016211319.1|620858_621911_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211316.1|622443_623094_+	porin family protein	NA	NA	NA	NA	NA
WP_016211315.1|623428_624073_+	porin family protein	NA	NA	NA	NA	NA
WP_054300314.1|624260_624596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273532.1|624556_625144_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_032126997.1|625361_625601_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_032126998.1|625922_626270_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_036774554.1|626368_626647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007020.1|626699_626987_+|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|626990_627877_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211346.1|629026_629668_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
628093:628395	attR	TAAAATTTTATCGATGATAGGCATGAGCCTATTTTTCATATTCTTGCGAATTTTATTGATTAATTGCAGTCCTTTTTCATAAAGCCTGTTAAATAAATCTTGTGAAATGTAACCTTTATCACCAATAATCTTACCTGTCAGACCTTGAGCAATTTCAGGTAATACAACGCGATCATCCGTTGTTGCCTGACTGAGTTTAAAGGCCATCATCCCCCATATCATTTACAATTAGATGAAGCTTAAAGCCATAGAACCAGCCCATCGTTGAACCACATTTTTTAGCCAGTCCTTTAAAGACTCTAT	NA	NA	NA	NA
WP_016211340.1|629695_629917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211347.1|629909_630893_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211344.1|631106_631925_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211342.1|632085_633768_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.1e-32
WP_016211343.1|633775_634798_-	YHYH protein	NA	NA	NA	NA	NA
WP_016211341.1|634996_635167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|635311_636286_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211940.1|636399_636732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|636852_638112_-	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211214.1|639874_640438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211210.1|640540_642022_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211213.1|642028_642235_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211211.1|642283_643363_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211215.1|643554_645525_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211212.1|645885_647445_+	APC family permease	NA	NA	NA	NA	NA
WP_075274875.1|647727_648030_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|648076_648805_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_129556539.1|648873_649218_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211983.1|649465_650125_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_129556643.1|650220_651585_+	histidine kinase	NA	NA	NA	NA	NA
WP_016212551.1|652042_652537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|652878_653454_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|653399_653690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|653703_654279_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|654224_654590_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211946.1|655810_656566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556540.1|656784_657180_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211947.1|657172_658318_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_075274878.1|658720_659596_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	702283	730179	3141542	transposase	Leptospira_phage(28.57%)	22	NA	NA
WP_032126239.1|702283_702556_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377873.1|702567_703404_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.9	4.6e-41
WP_016212058.1|704046_705597_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_075274880.1|705752_706718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126239.1|707713_707986_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|707997_708834_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_098082828.1|709331_709589_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|709588_710596_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212247.1|710962_711718_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_054300271.1|712345_713320_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300162.1|713659_714742_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212246.1|714845_715502_-	AT hook motif family protein	NA	NA	NA	NA	NA
WP_075274882.1|716437_717034_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556544.1|717148_717505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|717567_718650_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016210771.1|718741_722143_-	UvrD-helicase domain-containing protein	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_016210773.1|722139_724833_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_016210769.1|725136_726639_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_033923762.1|726939_727173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|727300_728110_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_016210772.1|728193_729747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|729879_730179_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	763444	804856	3141542	transposase,protease,integrase	Acinetobacter_phage(25.0%)	45	754180:754239	800538:800826
754180:754239	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_075274886.1|763444_764506_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274888.1|764777_765113_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007004.1|765117_765573_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|765532_765871_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|766028_766193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|766182_766482_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212209.1|766937_767939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274890.1|768739_769420_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_098082828.1|769489_769747_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377874.1|769915_770383_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_155049141.1|770843_772029_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.6e-58
WP_155049882.1|772038_772188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274893.1|772455_773016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300287.1|773424_773754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|773775_774141_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|774086_774662_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274733.1|774680_774998_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|775048_775885_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|775896_776169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211421.1|777027_777252_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|777348_778254_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016210013.1|778439_780107_-	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_122941582.1|780263_781247_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_122941592.1|781341_782193_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016210019.1|782450_783485_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_032126616.1|783549_783909_-	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210007.1|783964_784537_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075274894.1|784555_786571_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210021.1|786567_787893_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210004.1|788153_788795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|788994_789750_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210027.1|790139_790736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210005.1|790815_793620_+	response regulator	NA	A0A1V0SGX0	Hokovirus	32.2	2.4e-57
WP_016210012.1|793600_794272_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210009.1|794347_794554_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016210025.1|794546_795917_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210020.1|796181_796337_-	putative membrane protein	NA	NA	NA	NA	NA
WP_155053573.1|796925_797897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273518.1|798063_798357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210017.1|798432_798816_-	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_016210010.1|798991_799168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046739.1|800812_800953_+	hypothetical protein	NA	NA	NA	NA	NA
800538:800826	attR	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGA	NA	NA	NA	NA
WP_129556549.1|801837_802724_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210524.1|803262_803793_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_016210522.1|803803_804856_-|protease	protease SohB	protease	NA	NA	NA	NA
>prophage 10
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	840497	885212	3141542	transposase,protease,tRNA	Orpheovirus(20.0%)	47	NA	NA
WP_016209434.1|840497_841919_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_075274900.1|842001_843606_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_016209439.1|843763_844390_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_129556647.1|844470_847101_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_016209445.1|847634_848591_+	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_016209435.1|848691_849063_+	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.1e-05
WP_016209404.1|849089_849953_+	chemotaxis protein CheX	NA	NA	NA	NA	NA
WP_016209416.1|849942_850728_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209443.1|851575_852097_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209405.1|852142_853036_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016209406.1|853032_853854_-	ParA family protein	NA	Q8JL10	Natrialba_phage	32.2	5.0e-16
WP_016209408.1|854168_854339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209427.1|854492_855896_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_052047073.1|855989_857240_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_080664816.1|857226_857958_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016209424.1|857969_859247_-|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	25.1	6.6e-23
WP_016209433.1|859346_859721_-	rhodanese-like domain protein	NA	NA	NA	NA	NA
WP_016209412.1|859805_860693_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209436.1|860750_861479_-	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_129556555.1|861475_862606_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_016209444.1|862736_863165_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.1e-17
WP_032126508.1|863259_863619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209447.1|863608_864820_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016209421.1|864816_865605_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_016209411.1|865767_866562_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_054300271.1|866767_867742_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046761.1|868168_868342_+	phosphatase	NA	NA	NA	NA	NA
WP_075274901.1|868486_869500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|869503_869803_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|869792_869957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274902.1|870021_870378_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211553.1|870717_871458_-	outer-membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_016211549.1|871461_873966_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211548.1|874228_875185_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211550.1|875168_875930_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_075274903.1|876007_876883_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211259.1|877007_877253_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_016211262.1|877312_879586_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_075273504.1|879640_879994_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211261.1|880183_880477_+	cold shock domain-containing protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_032126515.1|880649_880829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307354.1|880904_881480_-	DedA family protein	NA	NA	NA	NA	NA
WP_032126514.1|881762_883079_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211263.1|883089_883458_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_016211265.1|883488_884151_-	adenylate kinase	NA	NA	NA	NA	NA
WP_032126362.1|884325_884691_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|884636_885212_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	909070	1012151	3141542	transposase,protease,tRNA	Staphylococcus_phage(21.43%)	100	NA	NA
WP_054300173.1|909070_910132_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556648.1|910545_911517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211446.1|911700_913428_+	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_016211448.1|913417_914626_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211450.1|914724_915747_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016212394.1|916768_917473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556557.1|917520_917832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274906.1|917976_918273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377875.1|918239_918869_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126170.1|919032_919305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211040.1|919532_920744_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211037.1|921094_921724_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211042.1|921772_922789_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211035.1|923035_923251_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211043.1|923303_923753_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211039.1|923832_925578_+	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211036.1|925669_927541_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_054300271.1|927888_928863_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211094.1|928882_929206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211091.1|930269_932750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211092.1|932793_934086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307348.1|934321_937078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049880.1|937547_937712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764113.1|938233_938407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|938652_939354_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|939614_939821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|940050_940356_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|940534_942532_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|942515_943562_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|944269_945121_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|945121_946042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|946452_946737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377876.1|946728_947184_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|947143_947482_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|947694_948624_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|948780_949209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|949289_949826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|949795_950701_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|950891_951500_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|951540_951840_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|951829_951994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274909.1|952377_952704_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|952802_953378_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|953323_953689_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556561.1|953859_955012_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	2.6e-58
WP_016211971.1|955218_955830_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|955850_957047_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|957143_957284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|957296_957701_-	SufE family protein	NA	NA	NA	NA	NA
WP_075273313.1|957826_958165_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556562.1|958124_958427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|958571_958757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|959326_959908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556649.1|959935_960793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|961332_961860_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_075273327.1|962103_962679_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|962624_962990_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209897.1|963011_963254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556650.1|963748_964723_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|965151_965865_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|966033_966525_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|966668_967160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|967362_968253_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|968441_969041_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|969121_970060_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_129556563.1|970111_971212_-	FUSC family protein	NA	NA	NA	NA	NA
WP_016209893.1|972700_977590_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|977682_977985_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|978095_980018_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|980039_981335_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|981331_982942_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_075274911.1|983161_983941_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|984050_984674_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|984750_984951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|985092_985791_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|985937_986507_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|986821_987445_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|987653_988256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|988327_988693_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046744.1|988749_988923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556564.1|990092_990422_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273603.1|991578_991755_+	phosphatase	NA	NA	NA	NA	NA
WP_129556565.1|991878_992274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|993743_994328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274914.1|994878_995754_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_059372565.1|995802_996174_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556566.1|996082_996286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210465.1|996793_997636_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|997686_998034_-	phosphomannose isomerase type II C-terminal cupin domain	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|998224_999112_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|999226_999829_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|999825_1000545_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_075275113.1|1000613_1002323_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_016210464.1|1002473_1004411_+	AsmA family protein	NA	NA	NA	NA	NA
WP_032126596.1|1004519_1005572_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_016210461.1|1005571_1005847_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|1005927_1006476_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210459.1|1009549_1010068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212492.1|1010272_1011127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1011176_1012151_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1032821	1114420	3141542	transposase,tRNA	Staphylococcus_phage(35.29%)	82	NA	NA
WP_036771330.1|1032821_1033796_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016212614.1|1033964_1034171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274915.1|1034315_1035770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211535.1|1036034_1037822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211536.1|1037897_1038131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|1038825_1039749_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_081377877.1|1039987_1040566_+|transposase	IS1 family transposase	transposase	A0A218MNG1	uncultured_virus	31.0	1.8e-07
WP_075274916.1|1040523_1041585_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212177.1|1042580_1042754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|1042830_1043088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764114.1|1043059_1043371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1044161_1044737_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274918.1|1044682_1045048_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212205.1|1045731_1045911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1046049_1047495_+	MFS transporter	NA	NA	NA	NA	NA
WP_016212319.1|1048053_1048281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1048267_1048594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|1048595_1049027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274916.1|1049555_1050617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210831.1|1050711_1051257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|1051525_1052545_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|1052531_1052954_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|1052955_1053429_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|1053544_1054168_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|1054197_1054872_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|1054877_1056026_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|1056022_1056484_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210824.1|1057935_1059615_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|1059724_1060591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274920.1|1062021_1062756_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	4.8e-10
WP_016211000.1|1062851_1063637_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_051307345.1|1063780_1064467_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_016211002.1|1064500_1064899_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|1065062_1065368_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210998.1|1065445_1065700_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|1065853_1067515_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|1067574_1068258_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|1068257_1069346_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_016211004.1|1069394_1072031_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300237.1|1072443_1073505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556568.1|1073694_1075176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1075212_1075788_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|1075733_1076024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1076037_1076613_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1076558_1076924_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212450.1|1077079_1077982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1078025_1079000_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211507.1|1079313_1080633_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1080636_1081353_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|1081349_1081991_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075274921.1|1081983_1082082_+	VOC family protein	NA	NA	NA	NA	NA
WP_075274922.1|1082059_1082356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|1082366_1082822_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211508.1|1082876_1083221_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|1083250_1084294_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|1084708_1084918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1084907_1085483_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1085428_1085794_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210192.1|1086106_1086625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066185.1|1086996_1087164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|1087214_1087562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210186.1|1087596_1088259_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_129556570.1|1088302_1088920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|1089131_1090187_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210205.1|1093455_1094412_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|1094460_1094997_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|1094993_1095755_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_016210202.1|1095860_1098449_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.8	9.7e-122
WP_032126472.1|1098911_1099562_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|1099781_1100657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1100847_1101249_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|1101265_1101817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1102128_1102815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274923.1|1102815_1103409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274924.1|1103641_1105024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|1105377_1105731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1105688_1106750_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212285.1|1106799_1108278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274925.1|1108325_1109387_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556651.1|1109574_1110783_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300237.1|1111024_1112086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|1112356_1114420_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 13
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1154682	1185967	3141542	transposase,tRNA	Planktothrix_phage(22.22%)	37	NA	NA
WP_129556571.1|1154682_1155393_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1155421_1155826_+	RidA family protein	NA	NA	NA	NA	NA
WP_016209567.1|1156941_1157559_-	MFS transporter	NA	NA	NA	NA	NA
WP_155046949.1|1157629_1157800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126712.1|1157993_1158452_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209553.1|1159196_1160207_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	42.2	2.9e-58
WP_016209566.1|1160691_1161603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209545.1|1161928_1165423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209551.1|1165460_1166300_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.0	1.8e-45
WP_016209564.1|1166486_1166702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209547.1|1166750_1167326_-	ribonuclease HI	NA	V9M0C8	Vibrio_phage	46.6	1.3e-29
WP_016209540.1|1167322_1167661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209568.1|1167829_1168819_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.7	1.7e-18
WP_016209572.1|1168819_1169782_-	oligopeptide ABC transporter ATP-binding protein OppD	NA	G9BWD6	Planktothrix_phage	32.1	7.7e-16
WP_016209559.1|1169791_1170694_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300271.1|1170737_1171712_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212612.1|1171849_1172083_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|1172176_1172542_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1172598_1172763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1172752_1173052_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212572.1|1173109_1173502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1173631_1173997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|1174053_1174362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1174453_1175029_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1174974_1175340_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1175492_1175765_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212514.1|1176175_1176313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|1176331_1177168_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_081377878.1|1177257_1177452_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126774.1|1177607_1177943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|1178102_1179635_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|1179667_1180507_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|1180503_1181001_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|1181004_1181997_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|1182111_1183458_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|1183681_1184743_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|1184821_1185967_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
>prophage 14
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1301345	1386514	3141542	transposase,tRNA	Escherichia_phage(41.18%)	84	NA	NA
WP_033923779.1|1301345_1302182_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|1302193_1302466_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144019247.1|1302532_1302889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556577.1|1302881_1303910_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.7	4.8e-16
WP_016211744.1|1303887_1304292_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_016211742.1|1304522_1306502_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_054300202.1|1306781_1307510_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_144019244.1|1307599_1308211_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_016210955.1|1308567_1308822_-	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210954.1|1308920_1310705_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_016210956.1|1310793_1311513_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210951.1|1311695_1311902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210948.1|1311901_1312138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|1312150_1312528_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126573.1|1313034_1313853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210947.1|1313946_1314144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210946.1|1314238_1315624_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210945.1|1315750_1316341_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_075274930.1|1317151_1317571_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274931.1|1317600_1318329_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_032126570.1|1319085_1319385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211816.1|1319397_1319751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211812.1|1319792_1321406_+	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_075274932.1|1321627_1321849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274933.1|1322157_1322886_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|1323502_1324600_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|1324633_1325884_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_075274934.1|1326371_1327040_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.8e-41
WP_016212193.1|1327162_1327501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|1327568_1327955_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|1327951_1328197_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075274933.1|1328605_1329334_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211625.1|1329817_1330687_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_016211621.1|1330683_1332033_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	4.6e-75
WP_016211623.1|1332145_1333786_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_016211987.1|1335607_1337344_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|1337505_1337703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|1337847_1338576_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_155764115.1|1338639_1338867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|1338939_1339272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211655.1|1339973_1340387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211652.1|1340646_1341852_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211653.1|1341959_1342985_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_054300202.1|1343076_1343805_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|1343963_1344464_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036780855.1|1344438_1344936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|1345701_1346430_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211053.1|1346472_1347039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|1347126_1348761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|1349122_1349626_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|1349588_1350296_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|1350364_1351225_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_016211045.1|1351205_1351979_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|1352009_1353263_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|1353262_1354225_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|1354268_1355021_+	ComF family protein	NA	NA	NA	NA	NA
WP_016210615.1|1357396_1357867_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|1357912_1358152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274938.1|1358170_1358677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|1358840_1360265_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|1360329_1361379_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|1361645_1362425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|1362468_1363371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|1363429_1364176_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|1364424_1367235_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_129556661.1|1367535_1368099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|1368087_1368816_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|1368905_1369112_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212263.1|1369274_1369868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212264.1|1369913_1370507_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	5.4e-28
WP_075274939.1|1372340_1373069_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	2.8e-42
WP_087910645.1|1373181_1374334_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274940.1|1374362_1375043_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	2.0e-42
WP_016211997.1|1375398_1376508_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	24.5	4.4e-07
WP_016211996.1|1376509_1377457_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_075274941.1|1377840_1378569_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.2e-42
WP_075275114.1|1378598_1378961_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212339.1|1379113_1379860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274942.1|1379878_1380607_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.1	2.7e-45
WP_032127022.1|1381283_1383470_+	ATP-dependent RecD-like DNA helicase	NA	A0A1P8DII4	Virus_Rctr197k	29.9	6.6e-47
WP_087910645.1|1383531_1384685_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075274943.1|1384970_1385495_+	helix-turn-helix domain-containing protein	NA	Q9MBM9	Staphylococcus_prophage	33.1	1.5e-05
WP_129556588.1|1385685_1385853_-	phosphatase	NA	NA	NA	NA	NA
WP_075274944.1|1385797_1386514_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.8	3.2e-43
>prophage 15
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1401332	1453300	3141542	transposase,integrase,tRNA	uncultured_Caudovirales_phage(20.0%)	47	1399057:1399116	1448562:1448856
1399057:1399116	attL	CACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAG	NA	NA	NA	NA
WP_081377879.1|1401332_1401557_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_016212230.1|1401612_1403061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|1404594_1404783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556589.1|1406184_1406460_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|1406462_1407065_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_155046749.1|1407128_1407416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211876.1|1407960_1409040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211874.1|1409358_1411077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1411120_1412026_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046750.1|1413270_1413408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|1414594_1415170_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_016210050.1|1415245_1416121_-	6-carboxytetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|1416185_1416707_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210069.1|1416691_1417774_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.6e-20
WP_016210073.1|1418841_1419573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|1419829_1421131_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|1421272_1421941_+	Bax inhibitor-1 family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|1422384_1422981_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|1423001_1424198_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_016210064.1|1424322_1425687_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210075.1|1425683_1426775_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210065.1|1427028_1427688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210057.1|1427828_1428338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126424.1|1428346_1429171_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210061.1|1429183_1429828_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_016210062.1|1429817_1430657_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.8e-08
WP_016210074.1|1430662_1431289_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_016210053.1|1431450_1431993_+	septation protein A	NA	NA	NA	NA	NA
WP_016210060.1|1432076_1432379_+	YciI family protein	NA	NA	NA	NA	NA
WP_032126423.1|1432375_1432639_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210070.1|1432731_1433004_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_016210055.1|1433042_1433681_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_032126421.1|1433948_1435040_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032126420.1|1435243_1437004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|1437679_1440004_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_016210675.1|1440171_1440888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275116.1|1440912_1441581_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210672.1|1441573_1442956_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_016210673.1|1442964_1443438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210671.1|1443570_1444830_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_016210676.1|1445285_1447367_+	kinase domain protein	NA	NA	NA	NA	NA
WP_016210678.1|1447669_1448680_+	protein kinase	NA	NA	NA	NA	NA
WP_098082812.1|1448824_1449340_+	hypothetical protein	NA	NA	NA	NA	NA
1448562:1448856	attR	CACGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTGCGTGCCTTGAATCGGCACACTCCACCACTGTGCTCTCACATGACTCTACGGTTCGTATAGATTTTTAGACACTCGTTACGCTTGCTACAGACCTAACGGTCTTTCGCAACTCCGCTCTGCTAAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTGGA	NA	NA	NA	NA
WP_052047041.1|1449572_1449836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211905.1|1450104_1450515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|1450758_1451181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300282.1|1452835_1453300_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1458571	1505467	3141542	transposase,protease,tRNA	Microbacterium_phage(12.5%)	51	NA	NA
WP_081377344.1|1458571_1459699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210935.1|1460029_1460572_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|1460568_1461255_-	acireductone synthase	NA	NA	NA	NA	NA
WP_016210942.1|1461258_1461870_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|1461916_1462936_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|1463037_1463832_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|1463869_1464676_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|1464754_1465804_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|1466001_1467261_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|1467307_1467985_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|1468070_1468352_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016210940.1|1468443_1469631_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	25.2	6.4e-20
WP_129556549.1|1469738_1470625_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210820.1|1470826_1471768_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|1472271_1472496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|1472786_1473491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210823.1|1473940_1474579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|1474913_1475444_+|protease	ATP-dependent zinc protease	protease	NA	NA	NA	NA
WP_036779158.1|1475440_1476973_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|1476969_1477920_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|1478339_1478972_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|1479214_1479412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|1479761_1480190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307340.1|1480267_1480966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274949.1|1480943_1482005_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|1482229_1482526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|1482630_1483275_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_075274950.1|1483518_1484007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377881.1|1484924_1485092_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377882.1|1485098_1485380_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1485339_1485678_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210986.1|1485735_1487274_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	1.3e-86
WP_098082804.1|1487385_1488484_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|1488721_1489921_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|1489950_1490589_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|1490604_1492788_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|1493024_1493369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210984.1|1493382_1494333_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_052104666.1|1494497_1494956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|1495543_1496671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|1496794_1497457_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|1497548_1497794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211962.1|1498091_1498607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|1499155_1499815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|1499916_1500567_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|1500679_1501000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1501058_1502033_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_032126299.1|1502283_1502505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212027.1|1502527_1503751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212028.1|1504245_1504494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1504581_1505467_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1526220	1572717	3141542	transposase,tRNA	Klosneuvirus(28.57%)	47	NA	NA
WP_036771330.1|1526220_1527195_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075274951.1|1527191_1528076_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211784.1|1528629_1529352_+	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_016211783.1|1529343_1529709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|1529989_1531267_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211782.1|1531866_1532049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1532110_1532476_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1532421_1532997_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556593.1|1532993_1533635_+	inositol polyphosphate kinase family protein	NA	NA	NA	NA	NA
WP_016210766.1|1533723_1534167_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_032126291.1|1534170_1534680_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210756.1|1534672_1537486_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_051307336.1|1537624_1538551_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	9.4e-11
WP_016210758.1|1538708_1540247_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_016210764.1|1540420_1540681_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_016210763.1|1540989_1542234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210755.1|1542337_1543066_+	SIMPL domain-containing protein	NA	NA	NA	NA	NA
WP_016210761.1|1543169_1543907_+	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_075273298.1|1544969_1545545_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033923659.1|1545682_1546291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307321.1|1546353_1546902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209980.1|1546988_1548155_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.7e-25
WP_032126286.1|1548460_1551259_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	4.9e-180
WP_016209998.1|1552566_1552968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209994.1|1553634_1553922_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_016209985.1|1554078_1554417_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_016209995.1|1554451_1556089_-	response regulator	NA	NA	NA	NA	NA
WP_016209992.1|1556190_1557240_+	WD domain, G-beta repeat family protein	NA	NA	NA	NA	NA
WP_016209988.1|1557312_1557957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556662.1|1557953_1559201_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_016209986.1|1559206_1560496_-	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_016209989.1|1560520_1561111_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_016209996.1|1561255_1561480_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|1561460_1561790_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_033923658.1|1562015_1562579_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_016209997.1|1562613_1563075_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_016209977.1|1563151_1564837_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_032126288.1|1564886_1565687_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|1565713_1566262_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_016209993.1|1566391_1566784_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_016209990.1|1566840_1567245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556594.1|1567277_1568045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1568510_1569572_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|1569662_1570409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274953.1|1570533_1571397_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|1571640_1572003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377902.1|1572189_1572717_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1589695	1633359	3141542	transposase,protease,tRNA	unidentified_phage(44.44%)	41	NA	NA
WP_016210376.1|1589695_1592176_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|1592238_1592604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273456.1|1592981_1593281_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1593240_1593696_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|1593710_1594001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210570.1|1594066_1595665_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|1595795_1596131_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_016210578.1|1596158_1597823_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	7.1e-33
WP_016210581.1|1597819_1598464_-	SCP2 sterol-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210582.1|1598463_1599207_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|1599265_1599505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|1599655_1601023_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|1601033_1601585_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126278.1|1601665_1602649_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_016210572.1|1602770_1604528_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126277.1|1604750_1605341_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|1605428_1605848_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_016210580.1|1605988_1606249_+	methyltransferase	NA	NA	NA	NA	NA
WP_075274955.1|1606324_1607299_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_075274956.1|1607341_1607710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212327.1|1607770_1608556_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075274955.1|1609941_1610916_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|1611197_1612214_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|1612213_1612729_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|1612770_1613244_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|1613401_1614376_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212084.1|1614657_1615674_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126534.1|1615673_1616189_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212085.1|1616230_1616704_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_075274955.1|1616861_1617836_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_016212306.1|1617871_1618402_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212310.1|1618431_1618887_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_129556598.1|1621435_1623949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211935.1|1624883_1627532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274958.1|1627980_1629042_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|1629068_1629644_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1629589_1629955_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046755.1|1630026_1630203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556599.1|1630593_1631746_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_051307322.1|1632894_1633074_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300181.1|1633077_1633359_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1757231	1825115	3141542	transposase	Erwinia_phage(20.0%)	57	NA	NA
WP_075273298.1|1757231_1757807_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1757752_1758118_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211157.1|1758682_1759339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211161.1|1759446_1760556_-	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.8	2.5e-18
WP_016211154.1|1760567_1761212_-	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_016211163.1|1761230_1762217_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211162.1|1762296_1763373_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_016211156.1|1763575_1764400_+	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016211160.1|1764716_1765721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211155.1|1765929_1766895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274965.1|1767033_1767909_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211700.1|1768205_1769258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|1769546_1769954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|1770167_1770659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|1770714_1771965_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|1772067_1772286_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_080728341.1|1774202_1774373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212561.1|1774344_1774485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210728.1|1775399_1775870_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|1776158_1777538_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|1777565_1778024_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|1778001_1779219_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|1779410_1779647_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|1779660_1779816_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_016210731.1|1779896_1780859_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|1781018_1782335_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|1782344_1783013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|1783375_1785190_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_129556601.1|1785307_1786084_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_052104629.1|1786674_1787700_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211543.1|1788136_1789888_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|1789898_1790699_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|1790801_1791290_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|1791463_1791778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|1792798_1793143_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|1798835_1799798_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|1799984_1801244_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|1801467_1801794_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|1801988_1802939_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|1802996_1805063_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|1805068_1806064_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|1806649_1808230_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|1808386_1809796_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|1809855_1810989_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|1811128_1811953_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|1812180_1812810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|1813146_1813518_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|1813821_1814109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|1814260_1815109_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|1815236_1816277_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|1816349_1817927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210035.1|1818570_1819230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1819384_1820359_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|1820434_1821454_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|1821501_1821648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556602.1|1821852_1822062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274966.1|1824053_1825115_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	1882076	1967364	3141542	transposase,tRNA	Staphylococcus_phage(23.08%)	90	NA	NA
WP_075274971.1|1882076_1882529_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|1882714_1882936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|1883051_1883684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274972.1|1883661_1884723_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211865.1|1885162_1885702_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|1885786_1886323_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016211866.1|1886974_1887277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|1887726_1888035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|1888643_1889093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|1889375_1890086_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|1890312_1890711_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|1891578_1892529_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|1892528_1894607_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|1894754_1895270_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|1895278_1895842_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|1895822_1896569_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|1896708_1897161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|1897584_1898421_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|1898417_1899314_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|1899346_1900414_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|1900432_1900801_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_155764117.1|1900826_1902149_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|1902283_1903663_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|1903703_1905035_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|1905006_1905966_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|1906058_1906562_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|1906696_1907848_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|1907844_1908324_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|1908470_1910792_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|1910736_1911363_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_016210344.1|1911367_1912267_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|1912339_1912918_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|1913218_1913476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556611.1|1913484_1914638_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155049899.1|1915322_1915466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046758.1|1915774_1915906_+	phosphatase	NA	NA	NA	NA	NA
WP_155046759.1|1916050_1916206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|1916533_1917307_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|1917848_1918031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1918634_1919609_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212335.1|1920703_1921042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212337.1|1921058_1921769_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212336.1|1921756_1921951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|1922109_1922409_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|1922398_1922563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|1922619_1922985_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|1924289_1924985_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_016211793.1|1924981_1926409_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211791.1|1926434_1926698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1927058_1928033_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556612.1|1928091_1928942_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|1928979_1929324_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|1929320_1930157_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|1930157_1930499_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|1930500_1931106_-	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_032126720.1|1931102_1933097_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|1933116_1934058_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211292.1|1934285_1935710_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|1936222_1937197_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|1937255_1937912_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|1937958_1938642_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|1939187_1939502_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_129556613.1|1939396_1940392_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211924.1|1940547_1940706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942409.1|1941065_1941497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556614.1|1941634_1941787_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211852.1|1942372_1943086_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_075273625.1|1943144_1943897_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211851.1|1944093_1944750_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273397.1|1945438_1945834_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_081377884.1|1946045_1947266_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	9.5e-11
WP_075274976.1|1948061_1948313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274978.1|1949485_1950124_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209318.1|1950188_1950830_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016209329.1|1950952_1952788_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-124
WP_016209325.1|1952843_1954208_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.5	6.6e-37
WP_016209335.1|1954301_1954730_-	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209339.1|1954754_1956146_-	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_016209322.1|1956176_1957037_-	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209323.1|1957062_1958604_-	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209332.1|1958620_1959148_-	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378485.1|1959159_1959630_-	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209328.1|1959684_1960089_-	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_016209354.1|1960140_1960956_-	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209313.1|1960960_1961359_-	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_016209349.1|1961473_1962367_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_016209314.1|1962399_1963284_-	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	1.7e-17
WP_016209348.1|1963303_1963930_-	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_016209346.1|1963977_1965870_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_016209326.1|1965984_1967364_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
>prophage 21
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2010366	2050477	3141542	transposase	uncultured_Caudovirales_phage(16.67%)	40	NA	NA
WP_081007013.1|2010366_2010666_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211577.1|2011018_2013712_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.8	2.6e-69
WP_129556616.1|2013743_2014331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664863.1|2014375_2015416_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_016211572.1|2015536_2015761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556427.1|2016002_2016578_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2016523_2016889_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|2017087_2017849_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_016211195.1|2018150_2019677_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|2020048_2020888_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|2020927_2022235_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|2022209_2023379_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|2023433_2024159_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|2024437_2024827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2024986_2025892_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|2025967_2026111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274979.1|2026158_2026998_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375632.1|2026990_2027326_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_155046698.1|2027504_2027666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377701.1|2027841_2028075_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210704.1|2028969_2030916_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|2031570_2034633_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|2034629_2035694_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|2036049_2037003_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|2037034_2038198_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|2038203_2038803_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|2038990_2039491_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|2039508_2040597_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|2041023_2042268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|2042264_2043107_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211096.1|2043086_2043896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|2044073_2044301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|2044301_2045252_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|2045307_2045859_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|2045985_2046408_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|2046400_2047147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|2047189_2047888_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|2047898_2048723_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|2049052_2049421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274980.1|2049415_2050477_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2106905	2196071	3141542	transposase,protease,tRNA	Staphylococcus_phage(20.0%)	92	NA	NA
WP_054300271.1|2106905_2107880_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|2108381_2109794_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|2110286_2111294_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|2111313_2112834_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_129556430.1|2112890_2113097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211018.1|2114072_2115389_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211015.1|2115492_2115876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211019.1|2116010_2119076_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|2119144_2120248_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|2120271_2120826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|2120940_2121510_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300545.1|2122550_2123612_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|2124006_2124402_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|2124423_2124789_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|2124845_2125010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2124999_2125299_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2125551_2125917_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2125862_2126438_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212607.1|2126438_2126795_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2126883_2127459_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2127404_2127770_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|2128249_2128816_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|2128827_2129613_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|2130244_2131168_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|2131219_2132215_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|2132246_2132741_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|2132832_2133090_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|2133179_2133602_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|2133920_2134637_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_016210247.1|2134680_2134932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556431.1|2134945_2136373_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|2136400_2137843_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|2137930_2138269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|2138353_2138884_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|2138944_2141137_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|2141179_2141665_-	ProQ/FinO family protein	NA	NA	NA	NA	NA
WP_016210226.1|2141934_2142366_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_016210245.1|2142383_2143214_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|2143228_2143372_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|2143402_2144287_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|2144258_2144480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|2144653_2144932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2145902_2146808_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016212383.1|2147210_2148329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2148325_2148901_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2148846_2149212_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126847.1|2149284_2150031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|2150563_2151364_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|2151580_2152339_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|2152415_2152703_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_075273327.1|2152706_2153282_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274985.1|2153227_2153593_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|2153656_2153929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212441.1|2154196_2154421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372761.1|2155436_2155886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2155949_2156678_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210779.1|2156720_2157650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|2157942_2158536_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|2158504_2159158_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|2159335_2160307_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|2160329_2161226_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|2161384_2161831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210787.1|2161827_2162469_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|2162578_2163157_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|2163632_2164070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|2164393_2165734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|2165997_2167392_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075274986.1|2168840_2169908_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209853.1|2170622_2171066_-	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_016209873.1|2171120_2171378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|2171355_2171982_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|2172059_2174042_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|2174250_2175594_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|2175860_2178530_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|2178553_2180473_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|2180642_2182064_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|2182209_2183184_+	phospholipase A	NA	NA	NA	NA	NA
WP_016209855.1|2183215_2183611_+	VOC family protein	NA	NA	NA	NA	NA
WP_016209859.1|2183613_2183835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|2183998_2185660_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|2185732_2186023_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209861.1|2186248_2186704_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|2186768_2187233_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|2187325_2188672_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|2188671_2189577_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|2189638_2190625_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2190617_2190860_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|2190981_2192526_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|2192572_2193859_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|2193901_2195296_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|2195319_2195499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2195495_2196071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2227351	2272426	3141542	transposase,tRNA	Acinetobacter_phage(40.0%)	47	NA	NA
WP_075274991.1|2227351_2227927_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377888.1|2227930_2228491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556436.1|2228546_2229433_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046701.1|2229459_2229609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|2229753_2229954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|2230001_2230463_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|2230886_2232368_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|2232430_2233540_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|2233637_2235599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|2236128_2236533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300237.1|2236585_2237647_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|2237772_2237928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2240873_2242026_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556437.1|2242068_2242491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274994.1|2242760_2244347_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|2244550_2244865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|2245058_2245196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2245199_2246086_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210630.1|2247227_2248343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|2248281_2248968_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_032126366.1|2248961_2249939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210638.1|2249977_2251141_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210640.1|2251605_2251830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2252215_2252503_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210633.1|2252677_2253433_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|2253438_2253894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210637.1|2253869_2254346_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_016210636.1|2254352_2255930_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_032126367.1|2255933_2256698_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210629.1|2256751_2257288_+	tim44-like domain protein	NA	NA	NA	NA	NA
WP_016210634.1|2257284_2258016_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_032126368.1|2258124_2259279_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_075275120.1|2259423_2259735_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_081377889.1|2260129_2261038_-	protein kinase	NA	NA	NA	NA	NA
WP_129556440.1|2261279_2261888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211899.1|2262230_2262524_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_105962625.1|2262620_2263507_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274996.1|2263915_2265016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126374.1|2265124_2266096_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664866.1|2266127_2266544_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211609.1|2267158_2267467_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_032126373.1|2267499_2269686_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	2.7e-141
WP_016211605.1|2269789_2270023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|2270239_2270770_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|2270798_2271023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|2271205_2272021_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300526.1|2272129_2272426_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2299996	2345546	3141542	transposase	Hokovirus(33.33%)	45	NA	NA
WP_075273298.1|2299996_2300572_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|2300624_2301650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210128.1|2301743_2302007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|2302373_2303192_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|2303264_2305637_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_016210125.1|2306348_2307776_+	amino acid permease	NA	NA	NA	NA	NA
WP_016210131.1|2307810_2308833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|2308849_2309227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|2310068_2310761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|2311387_2312362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|2312351_2314124_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|2314124_2314472_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075274999.1|2316036_2316576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275000.1|2316647_2317334_-	MFS transporter	NA	NA	NA	NA	NA
WP_080664834.1|2317367_2317727_-	VUT family protein	NA	NA	NA	NA	NA
WP_080664833.1|2317772_2318117_-	VUT family protein	NA	NA	NA	NA	NA
WP_016210137.1|2318097_2318649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664832.1|2318875_2320174_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|2320290_2320581_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_155049101.1|2320892_2322134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2322546_2323122_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2323067_2323433_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212359.1|2324168_2324387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2324754_2325729_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212044.1|2326266_2326521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|2327243_2328230_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|2328367_2328562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664870.1|2329244_2329892_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_129556444.1|2329884_2330307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211797.1|2330468_2331872_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|2331922_2332498_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|2332443_2332758_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556445.1|2332798_2333685_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126227.1|2334323_2334614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275002.1|2334758_2335349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212010.1|2335365_2335662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556446.1|2335779_2336931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273619.1|2337203_2337779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211273.1|2337836_2338670_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	29.0	3.5e-17
WP_016211268.1|2338785_2339970_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211271.1|2339988_2340933_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_016211269.1|2341237_2342023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211272.1|2342140_2342509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211270.1|2342736_2344314_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_054300173.1|2344484_2345546_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2405077	2575404	3141542	transposase,integrase,tRNA	Escherichia_phage(39.58%)	175	2486623:2486682	2517706:2517984
WP_054300237.1|2405077_2406139_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210693.1|2406241_2406514_-	feoC like transcriptional regulator family protein	NA	NA	NA	NA	NA
WP_016210692.1|2406556_2408881_-	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_016210694.1|2408877_2409111_-	FeoA domain-containing protein	NA	NA	NA	NA	NA
WP_017378349.1|2409456_2409885_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_016210687.1|2409896_2410286_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_032126121.1|2410446_2411073_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_016210689.1|2411084_2411513_+	stringent starvation B family protein	NA	NA	NA	NA	NA
WP_016210685.1|2411547_2412132_-	phosphoheptose isomerase	NA	NA	NA	NA	NA
WP_016210690.1|2412223_2412559_-	YraN family protein	NA	NA	NA	NA	NA
WP_016210681.1|2412548_2414336_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_016210686.1|2414422_2414971_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	42.6	1.9e-27
WP_016210683.1|2415002_2415977_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_032126122.1|2416251_2416563_+	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_016210684.1|2416582_2416843_+	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_016210691.1|2416948_2417992_+	Obg family GTPase CgtA	NA	NA	NA	NA	NA
WP_075275004.1|2418155_2419019_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|2419235_2420795_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|2420816_2421851_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|2421899_2422469_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|2422604_2423576_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|2423587_2425165_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|2425230_2426217_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210646.1|2426548_2427658_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|2427763_2428948_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|2429025_2431014_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|2431222_2431378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|2431635_2431935_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275005.1|2432093_2432429_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|2433345_2434752_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|2434769_2435756_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|2435758_2436913_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|2436909_2437605_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|2437739_2439230_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|2439250_2440300_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210489.1|2442638_2444570_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|2444574_2445105_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|2445139_2445334_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|2445376_2445736_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|2446155_2447151_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_052133265.1|2450107_2450584_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|2450728_2450926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2451050_2452025_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_075273615.1|2452925_2453024_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210477.1|2453508_2454798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126626.1|2455034_2455727_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|2455768_2456542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|2456543_2457485_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|2457617_2459195_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|2459404_2461162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210486.1|2461710_2462469_-	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032126625.1|2462676_2463249_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|2463352_2463901_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|2464202_2464448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|2464476_2464773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|2465040_2465964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556451.1|2466442_2466700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275008.1|2466763_2467492_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	3.3e-43
WP_098082828.1|2467806_2468064_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275009.1|2468195_2468903_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	45.8	1.3e-44
WP_075275011.1|2468946_2469675_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.2e-42
WP_032126799.1|2469866_2470679_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|2471799_2472147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|2472149_2473889_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300501.1|2474393_2475122_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|2475482_2476259_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|2476470_2476638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|2476612_2477212_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_054300500.1|2477621_2478350_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300501.1|2478698_2479427_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|2479438_2479831_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|2479827_2480073_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275015.1|2480245_2480821_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.1	1.6e-08
WP_075273327.1|2480824_2481400_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2481345_2481711_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300307.1|2482135_2482864_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300307.1|2483470_2484199_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_016212268.1|2484549_2485134_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|2485137_2485821_-	Fic family protein	NA	NA	NA	NA	NA
WP_017375910.1|2486103_2486832_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
2486623:2486682	attL	CCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAACGACAAATGGTTGAACGCTCAAT	NA	NA	NA	NA
WP_052104629.1|2487168_2488194_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212159.1|2488337_2488535_-	antirestriction protein ArdA	NA	A0A222Z017	Rhodococcus_phage	55.7	4.1e-09
WP_016212158.1|2488802_2489717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275019.1|2489826_2490531_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.3	9.2e-43
WP_105962625.1|2490494_2491381_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211714.1|2491755_2495100_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211713.1|2495132_2495822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|2495844_2496573_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_075275021.1|2496640_2497582_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556625.1|2497796_2498354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126478.1|2498346_2498685_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.7e-24
WP_032126479.1|2498671_2499025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212114.1|2499021_2499252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212110.1|2499255_2499726_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	62.5	7.6e-33
WP_054300201.1|2500372_2501101_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212024.1|2501496_2501745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212021.1|2501741_2502341_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212022.1|2502340_2502559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212023.1|2503045_2504038_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|2504034_2504769_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_129556453.1|2505188_2505620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047116.1|2505764_2505944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2506645_2507374_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|2508031_2509312_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|2509311_2510280_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032126737.1|2512791_2513520_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_032126738.1|2513720_2513993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212424.1|2513985_2514264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212425.1|2514467_2515058_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.4	1.1e-20
WP_032126150.1|2515262_2515496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2515594_2516569_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_075275025.1|2518084_2520100_-	DUF1561 family protein	NA	NA	NA	NA	NA
2517706:2517984	attR	CCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAACGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATAATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTTTTACCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCCT	NA	NA	NA	NA
WP_016211807.1|2520349_2520571_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728351.1|2520458_2520617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275027.1|2521169_2522891_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_075275029.1|2523059_2523788_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	9.6e-43
WP_075275032.1|2524531_2525341_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	1.1e-15
WP_032126239.1|2525391_2525664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_033923779.1|2525675_2526512_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_016211646.1|2526881_2527121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|2527113_2527467_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|2527767_2528370_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211641.1|2528374_2528830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211645.1|2528852_2529602_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	28.2	2.4e-09
WP_016211640.1|2529633_2530236_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|2530615_2530918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|2531032_2531299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2531440_2532169_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|2532663_2533101_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|2533530_2534919_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|2535361_2536855_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|2537056_2537806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556457.1|2537849_2538788_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|2538771_2539467_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_036776715.1|2539868_2540597_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|2540690_2541356_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|2541420_2542377_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|2542635_2543334_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|2543376_2544489_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|2545093_2545669_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2545614_2545980_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|2546067_2546418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2547153_2548215_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556458.1|2548590_2548824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049894.1|2549202_2549394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210908.1|2549715_2550531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|2550621_2551605_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|2551775_2552297_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|2552330_2552582_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|2552587_2553865_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|2554557_2555085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|2555204_2557517_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_081377894.1|2557645_2558020_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155764119.1|2558034_2558460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210915.1|2558656_2559121_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_075275036.1|2559250_2560312_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|2560572_2560869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|2561151_2562615_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|2562617_2563670_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_016211494.1|2563659_2564115_+	arginine repressor	NA	NA	NA	NA	NA
WP_016211487.1|2564139_2564463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2564810_2565122_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_032126201.1|2565251_2565998_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300148.1|2566019_2567081_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2567191_2568166_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212075.1|2569372_2569570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|2569815_2570016_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212072.1|2570045_2570243_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212074.1|2570329_2570551_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2570577_2570943_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275038.1|2570888_2571479_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046713.1|2571616_2571781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|2572075_2573512_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|2573553_2575005_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|2575116_2575404_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2586344	2624350	3141542	transposase,plate	Enterobacteria_phage(50.0%)	36	NA	NA
WP_081007010.1|2586344_2586965_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556461.1|2587014_2587305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275039.1|2588108_2588603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|2588597_2588936_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2589315_2590201_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556462.1|2590198_2591044_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.8	1.4e-24
WP_016210435.1|2591274_2592081_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_016210431.1|2592140_2592533_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_016210434.1|2592577_2593396_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_016210429.1|2593408_2594392_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_016210428.1|2594393_2595665_-	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_080664841.1|2595671_2598176_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_016210436.1|2598305_2599331_+	phosphotransferase	NA	NA	NA	NA	NA
WP_155049107.1|2600063_2600315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210440.1|2600314_2600791_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210438.1|2600918_2601302_+	response regulator	NA	NA	NA	NA	NA
WP_016210442.1|2601336_2602236_-	DUF3530 family protein	NA	NA	NA	NA	NA
WP_016210432.1|2602281_2602953_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_016210437.1|2603011_2603587_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.5	3.7e-58
WP_017376335.1|2603685_2604486_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_032126191.1|2604618_2605140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209533.1|2605284_2605605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209536.1|2607466_2610637_-	intracellular multiplication and macrophage-killing family protein	NA	NA	NA	NA	NA
WP_081377896.1|2610649_2611090_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_075275042.1|2611065_2611359_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_016209523.1|2611363_2612713_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|2612763_2613201_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|2613462_2614974_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_032126188.1|2614979_2616206_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2616199_2617228_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209514.1|2617205_2617898_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|2617902_2619372_+	type VI secretion system domain-containing protein	NA	NA	NA	NA	NA
WP_129556464.1|2619361_2619853_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_032126187.1|2621329_2621728_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|2621724_2623413_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_081377897.1|2623516_2624350_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 27
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2658802	2698207	3141542	transposase,protease,tRNA	Prochlorococcus_phage(42.86%)	41	NA	NA
WP_080743011.1|2658802_2659258_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_129556469.1|2659217_2659526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2660319_2661225_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275050.1|2661300_2661996_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275052.1|2662140_2662650_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|2662699_2662909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|2664143_2664590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2664593_2665169_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075275054.1|2665114_2665480_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|2665600_2665786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|2665889_2666924_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|2666920_2667631_-	winged helix-turn-helix domain-containing protein	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|2668105_2668624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|2668741_2669074_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_075275056.1|2669103_2671929_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_016209912.1|2672102_2672600_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|2672659_2673076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|2673167_2674028_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|2674110_2674677_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|2674709_2675564_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_016209914.1|2675605_2678512_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|2678572_2678770_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|2678776_2679787_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|2679783_2680842_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_155764126.1|2680856_2681669_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209913.1|2681637_2682456_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209907.1|2682467_2683415_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|2683422_2684724_+	lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|2684902_2686006_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|2686002_2686395_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|2686406_2687783_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|2687776_2689246_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_016209916.1|2689437_2690409_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	3.7e-34
WP_129556470.1|2690645_2691532_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|2691831_2692077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|2692625_2693360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2693484_2694546_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|2694868_2695573_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|2695666_2696380_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|2696462_2697554_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_016210603.1|2697625_2698207_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 28
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2701871	2770908	3141542	transposase,tRNA	Pseudomonas_phage(16.67%)	54	NA	NA
WP_016210607.1|2701871_2703131_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|2703127_2704213_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|2704205_2705087_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|2705075_2706326_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_075275125.1|2707917_2708961_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2711097_2711463_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2711408_2711984_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209387.1|2712121_2713006_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_016209373.1|2713135_2713957_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_016209389.1|2713958_2714996_-	asparaginase	NA	NA	NA	NA	NA
WP_016209367.1|2714996_2717654_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_016209375.1|2717731_2718541_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_032126579.1|2718963_2719731_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_016209372.1|2719905_2720784_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_016209399.1|2720787_2721525_+	UMP kinase	NA	NA	NA	NA	NA
WP_016209396.1|2721528_2722086_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_032126580.1|2722102_2722840_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.5	7.2e-22
WP_016209379.1|2722847_2723654_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016209397.1|2723741_2724617_+	lysophospholipid acyltransferase family protein	NA	NA	NA	NA	NA
WP_152498662.1|2724737_2726396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209393.1|2729371_2729911_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_016209364.1|2729907_2730936_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_016209394.1|2730925_2731990_-	GHMP kinase	NA	NA	NA	NA	NA
WP_016209385.1|2731977_2734206_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_051307309.1|2734192_2735233_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_129556472.1|2735571_2737965_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_016209381.1|2738045_2738579_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_016209391.1|2738630_2739680_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_016209390.1|2739706_2740144_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_016209377.1|2740143_2740917_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_016209376.1|2740935_2742090_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_032126583.1|2742301_2742871_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	42.9	5.7e-27
WP_016209365.1|2742894_2746401_+	DNA polymerase III subunit alpha	NA	A0A291AVA6	Streptomyces_phage	38.5	4.9e-193
WP_016209366.1|2746478_2747438_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_016209374.1|2747412_2748864_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|2748899_2750429_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_016209380.1|2751004_2751427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556473.1|2751559_2752648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126585.1|2753189_2754110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|2754460_2755276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|2755567_2758258_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_016209388.1|2758547_2759726_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2759893_2761600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|2762198_2763425_+	MFS transporter	NA	NA	NA	NA	NA
WP_075274832.1|2764019_2764994_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.8	6.8e-28
WP_075273456.1|2765116_2765416_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2765375_2765831_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212416.1|2765832_2766363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212417.1|2766486_2766732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|2766782_2767667_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052047106.1|2767741_2768218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2768933_2769299_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2769244_2769820_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|2769846_2770908_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2775350	2831896	3141542	transposase,protease,tRNA	Staphylococcus_phage(23.08%)	45	NA	NA
WP_054300173.1|2775350_2776412_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275065.1|2776711_2777386_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.9e-10
WP_016212172.1|2778275_2779748_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2779767_2780742_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556474.1|2780945_2781167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2781332_2781953_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_016210739.1|2784402_2785860_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|2785928_2787509_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_016210744.1|2787549_2788035_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|2788131_2792028_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|2792034_2792358_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|2793043_2794105_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210303.1|2794154_2794394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307327.1|2794669_2795701_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.7e-35
WP_016210294.1|2796018_2796363_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_075273633.1|2796500_2797127_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_016210301.1|2797176_2798004_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_032126460.1|2798180_2798618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126457.1|2799525_2799945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210293.1|2800989_2802270_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_016210287.1|2802390_2803254_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_016210290.1|2803342_2804137_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_129556475.1|2804359_2805382_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_032126458.1|2805387_2806914_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_032126463.1|2806994_2808251_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210297.1|2808307_2809687_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_129556628.1|2809772_2810588_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	8.5e-32
WP_033923708.1|2810792_2811668_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|2811923_2812568_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|2812598_2814404_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2814427_2815003_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|2815547_2816558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2816653_2817628_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_016209640.1|2818046_2819066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|2819524_2820490_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|2820534_2821110_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|2821140_2822415_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|2823041_2823755_+	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_016209641.1|2823834_2824572_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|2824692_2826048_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|2826224_2826896_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|2827011_2827887_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|2828490_2829795_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2829907_2830513_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|2830594_2831896_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
>prophage 30
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2850688	2892457	3141542	transposase,integrase	Staphylococcus_phage(20.0%)	42	2852957:2853016	2881138:2882241
WP_075275067.1|2850688_2851756_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273512.1|2852511_2852856_-|transposase	transposase	transposase	NA	NA	NA	NA
2852957:2853016	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|2852992_2853967_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126362.1|2854138_2854504_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_051307360.1|2855343_2856273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|2857364_2858171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2858513_2860406_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|2860692_2861097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923634.1|2861301_2861850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2861839_2862726_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212436.1|2863064_2863475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556479.1|2863688_2863871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274918.1|2864358_2864724_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2864669_2865245_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_080664862.1|2866418_2867117_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|2867097_2867403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211532.1|2868048_2868999_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	35.8	1.8e-09
WP_016211534.1|2868985_2869495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|2869500_2870397_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|2870750_2871431_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|2871494_2872085_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|2872287_2872566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|2872558_2872831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2872975_2874058_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211300.1|2874108_2875149_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_129556480.1|2875660_2881150_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|2881173_2882148_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212302.1|2882461_2882761_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
2881138:2882241	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCGT	NA	NA	NA	NA
WP_129556481.1|2882945_2883377_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|2883634_2884717_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|2884940_2885426_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|2885493_2886402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211581.1|2886678_2887449_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.9	8.9e-31
WP_016211585.1|2887567_2888125_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016211582.1|2888186_2888966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2889063_2889417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2889483_2889678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|2889693_2890038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2890395_2890971_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2890916_2891282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275068.1|2891366_2891957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|2892058_2892457_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2908294	2969023	3141542	transposase	unidentified_phage(20.0%)	54	NA	NA
WP_075273371.1|2908294_2908870_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|2908873_2909248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275071.1|2909623_2910598_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	5.2e-28
WP_054300264.1|2910700_2911039_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2911183_2911444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556469.1|2911403_2911712_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|2912213_2913674_-	sodium:proton antiporter NhaD	NA	NA	NA	NA	NA
WP_016211426.1|2914017_2915460_+	MFS transporter	NA	NA	NA	NA	NA
WP_075275073.1|2916423_2917734_+	outer membrane protein transport protein	NA	NA	NA	NA	NA
WP_054300148.1|2917974_2919036_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556485.1|2919188_2921747_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.6	6.3e-73
WP_032126554.1|2921766_2922852_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|2923293_2923731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|2923727_2924612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|2924701_2925232_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_016210420.1|2925302_2926481_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210425.1|2926629_2930478_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|2930464_2931967_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|2932517_2933153_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_081377899.1|2933465_2934329_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|2934743_2935991_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_129556630.1|2936300_2937650_+	methyltransferase regulatory domain-containing protein	NA	NA	NA	NA	NA
WP_129556486.1|2937735_2938083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|2938173_2938293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275075.1|2938401_2939463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|2939457_2939628_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046696.1|2939617_2939782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2939838_2940204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|2940225_2940594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|2941505_2941856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2941944_2942235_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|2942709_2943012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210897.1|2943352_2944333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|2944411_2945749_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|2945867_2946239_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|2946459_2947110_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|2947152_2948235_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|2948288_2950172_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|2950671_2951577_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075275077.1|2951661_2952498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212218.1|2952642_2952993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2955627_2956710_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_032126801.1|2957379_2957889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275079.1|2957936_2958998_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155764121.1|2959146_2959995_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|2961144_2962008_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2962888_2963254_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2963199_2963775_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2964005_2964371_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2964316_2964892_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126869.1|2965412_2965652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2965629_2966691_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212290.1|2966807_2968133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|2968136_2969023_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	2985291	3024544	3141542	transposase,tRNA	Staphylococcus_phage(25.0%)	47	NA	NA
WP_081377357.1|2985291_2985693_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_016212611.1|2986176_2986497_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_075275084.1|2986544_2987606_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212519.1|2987680_2988061_+	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_052047081.1|2988331_2988769_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_016212356.1|2988819_2989665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275086.1|2989642_2990641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2990601_2990967_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2990912_2991488_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274822.1|2991857_2992832_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	8.9e-28
WP_155764122.1|2992943_2993105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212621.1|2993557_2993962_-	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_075273327.1|2993958_2994534_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2994479_2994845_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126498.1|2994906_2995467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211126.1|2995599_2995989_-	lipoprotein	NA	NA	NA	NA	NA
WP_016211125.1|2996158_2996989_-	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211128.1|2997211_2998117_-	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_016211119.1|2998280_2999042_+	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_016211122.1|2999045_2999912_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032126499.1|3000008_3000620_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211118.1|3000998_3002246_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126500.1|3002382_3003099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275089.1|3003232_3003565_-	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	37.3	8.0e-05
WP_129556631.1|3003709_3003877_-	phosphatase	NA	NA	NA	NA	NA
WP_075275091.1|3004885_3005371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|3005641_3006052_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300412.1|3006196_3006511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210280.1|3006747_3007842_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_016210284.1|3007923_3008445_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210276.1|3008499_3008976_-	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210275.1|3009031_3009334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210273.1|3009398_3010106_-	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210274.1|3010477_3010876_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_032126334.1|3010915_3011347_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210271.1|3011357_3012041_+	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_016210285.1|3012125_3014321_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_129556492.1|3014418_3015162_+	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210283.1|3015189_3015975_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_016210272.1|3016014_3016725_+	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210279.1|3016712_3017879_+	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210277.1|3017932_3018766_+	rod-binding protein	NA	NA	NA	NA	NA
WP_016210270.1|3018835_3021823_+	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210281.1|3021864_3023256_+	flagellar hook-associated protein FlgL	NA	NA	NA	NA	NA
WP_016210269.1|3023269_3023620_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_032126362.1|3023657_3024023_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3023968_3024544_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP013778	Piscirickettsia salmonis strain PM51819A, complete genome	3141542	3031495	3083854	3141542	transposase	Bacillus_phage(27.27%)	50	NA	NA
WP_075273327.1|3031495_3032071_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3032016_3032382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|3032515_3033379_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_032126637.1|3033609_3033903_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_155046959.1|3034561_3034735_+	phosphatase	NA	NA	NA	NA	NA
WP_129556495.1|3034883_3035141_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211589.1|3035263_3036496_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_016211592.1|3036485_3037148_-	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_129556496.1|3037422_3038661_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_032126329.1|3038846_3039476_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211588.1|3039551_3040253_+	cyclase family protein	NA	NA	NA	NA	NA
WP_105962623.1|3040420_3041573_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212343.1|3041812_3042619_-	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_155764123.1|3043375_3043519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209808.1|3043922_3044291_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209824.1|3044287_3045106_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209813.1|3045206_3046022_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209801.1|3046306_3048361_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209805.1|3048960_3050454_-	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_016209818.1|3050586_3051402_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209799.1|3051497_3051914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209815.1|3052299_3052839_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_032126326.1|3053606_3054869_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	3.1e-25
WP_016209812.1|3055321_3057145_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_016209821.1|3057234_3057567_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209800.1|3057597_3058194_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209802.1|3058190_3059315_+	D-isomer specific 2-hydroxyacid dehydrogenase catalytic domain protein	NA	NA	NA	NA	NA
WP_016209822.1|3059450_3060098_+	class I SAM-dependent methyltransferase	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_016209810.1|3060159_3062073_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209803.1|3062277_3063315_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_075275092.1|3063373_3064321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275094.1|3064395_3066444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764124.1|3066533_3066671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|3067372_3068341_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_016209809.1|3068447_3068936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209823.1|3069360_3069804_+	response regulator	NA	NA	NA	NA	NA
WP_075275095.1|3069848_3070625_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275097.1|3071026_3071602_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3071547_3071913_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300408.1|3071963_3072620_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_080664854.1|3072956_3073538_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_032126179.1|3073495_3073747_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_016211113.1|3073776_3075102_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_016211112.1|3075157_3075805_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211115.1|3075997_3077950_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_075274672.1|3081377_3081971_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|3082142_3082508_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3082453_3083029_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081377872.1|3083042_3083333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|3083278_3083854_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013779	Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence	165427	0	108160	165427	integrase,head,tail,capsid,transposase	Streptococcus_phage(20.0%)	118	77520:77579	98248:99110
WP_081007042.1|1101_1917_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211897.1|2310_2715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211894.1|2715_3462_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_016211895.1|3970_5029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126360.1|5151_5886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|6092_6668_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|6613_6979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211773.1|7431_8106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211775.1|8207_8576_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	1.2e-25
WP_016211776.1|8743_10081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556697.1|10563_10956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275127.1|11340_12246_-|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	8.9e-14
WP_075273327.1|12716_13292_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275128.1|13237_13603_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|13744_14902_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211142.1|17103_17370_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_016210669.1|17426_17750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|17751_18174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210651.1|18173_18524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210658.1|18520_18916_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210667.1|18908_19232_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210663.1|19228_19540_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	4.3e-08
WP_016210655.1|19858_20455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556716.1|20468_20759_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_052133287.1|20892_21291_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275129.1|21346_22408_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	28.0	3.1e-18
WP_075275128.1|22507_22873_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|22818_23394_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075275133.1|25327_25636_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211938.1|26207_26768_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_016211936.1|27262_28285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275135.1|28774_29164_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_155046767.1|29433_29595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|29594_30095_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|30275_31428_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274752.1|31464_31764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|31760_32336_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|32281_32647_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|33551_35594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|36425_36791_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|36736_37312_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075274748.1|37322_37523_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_016212579.1|39028_39226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|40156_40993_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|41004_41277_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275137.1|41332_41746_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212456.1|41789_42077_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_016212457.1|42073_42475_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_052047124.1|42484_44146_-	AAA family ATPase	NA	A0A0K2FLP8	Brevibacillus_phage	31.5	9.1e-65
WP_075275138.1|44350_44659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126756.1|44803_45247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212404.1|45367_45601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275139.1|46215_46446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275140.1|47072_47807_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.1e-38
WP_129556710.1|47960_48431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|48511_48601_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_075275141.1|48812_50498_-	protein kinase	NA	NA	NA	NA	NA
WP_075275142.1|50780_51509_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_054300271.1|52144_53119_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212365.1|53327_53570_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_129556708.1|53562_53898_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A9D9Y1	Lactobacillus_prophage	35.6	2.6e-11
WP_054300202.1|54013_54742_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212152.1|55211_55595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|55901_56279_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_032126739.1|56442_56775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212156.1|56727_56880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|56963_57743_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212019.1|58556_59252_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_016212018.1|59408_59708_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|59704_59950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212017.1|59979_60378_-	hypothetical protein	NA	W8VUR5	Pseudomonas_phage	38.8	2.3e-06
WP_016212014.1|60672_61086_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_075275144.1|61183_61915_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_033923779.1|61947_62784_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
WP_032126239.1|62795_63068_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962623.1|63212_64365_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556707.1|64994_66014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|66373_67348_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_051307371.1|68165_68780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212139.1|68751_68997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212137.1|69072_70134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274931.1|70577_71306_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.4e-38
WP_075274822.1|71506_72481_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_155046766.1|72524_72662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211890.1|72886_75463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|75666_76395_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046765.1|77281_77476_+	hypothetical protein	NA	NA	NA	NA	NA
77520:77579	attL	GGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAGT	NA	NA	NA	NA
WP_054300202.1|77587_78316_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_032126832.1|78426_79335_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_054300202.1|79579_80308_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211886.1|81096_81525_+	nucleotidyltransferase substrate binding protein	NA	NA	NA	NA	NA
WP_016211884.1|81521_81821_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556706.1|81911_82541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211885.1|82554_83595_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033923686.1|83703_84753_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212150.1|84809_85124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212151.1|85147_86110_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054300162.1|86474_87557_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_075275148.1|88069_89044_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_129556705.1|89102_89603_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	28.0	9.9e-07
WP_155046705.1|89548_89716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274913.1|89640_89913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212121.1|90346_91270_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016212122.1|91223_91925_-	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_129556704.1|92801_93131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|93624_94599_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_016212118.1|96761_97223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126844.1|97317_97614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126843.1|97832_98012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|98315_99044_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016211955.1|99189_100170_-	hypothetical protein	NA	NA	NA	NA	NA
98248:99110	attR	GGCACTGTTGCAAAAAATTTAGATTTGAGTAGGGTGTAGCAATCAACGGAAGTTAAGAGTGAATTGCTGTGGGTAGACGTAAACGATTTAAGAAGAATCAACCCTTTAAATGGAAGCATTATTCCGGTGAGATCATTCTTTGGCTGGTGCGTTGGTATGGCCGCTATGCCTTATCTTACCGTGATCTCAAAGAAATAGCAGCTGAAAGAGGTCTTGAGATTGAGCGTTCAACCATTTGTCGCTGGGTGCACGAGTATGGCTCGCAGATCGCCAAACGGCTGAGGCCCCACTTTCGTCAAACGTGTGCCTCTTGGCGGTTAGATGAAACGTTGGTGAAAATCAAAGGTCGTTGGTATTACCTTTATCGAGCCATTGATAAATATGGCCATACTTTGGACTGGATGCTCAGCCGACAGCAAAATGCCAAAGCGGCGATGCGCTTTTTCAAAAAGGCAATCGCCCAACCTTATGTGAAATCACCGCGTGTTGTGAATGTCGACAAGCACGCTTCATTTCCACCCGCTCACCAAAAAGCCAAAGATGAAGGTGTCTTTTCTAGTCAGTGTAAACTCAGGCGAGTGAAGTATTTAAACAACTGCATTGAAAATGATCACAAAGCGGTAAAGCGCAAATCCCGTTTCCGCCAATGGTACCAATCACTTTCTACAGCACGGCCTACCATTGACATAATGGAAGCGATGCGCATGGTTCAAAAAGGTCAATTACGTTATATTAAAAAACAGAATATCTGTGCCCAAAATCAGCTCATTGATAAATTATTTGGATTAGCTGCTTAATTCTAAGCAGAGAGCACAAGAAAATAACCTTTCTGAAGTTCACTATAATTTTTCGCAACAGTGCCG	NA	NA	NA	NA
WP_016211956.1|100626_101355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556703.1|101412_101901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275149.1|102126_103101_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.9e-25
WP_075273760.1|103444_105847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|106185_107160_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_081377345.1|107156_107681_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_081377912.1|107797_108160_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	1.3e-05
>prophage 2
NZ_CP013779	Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence	165427	111498	157685	165427	integrase,transposase	Streptococcus_phage(26.32%)	57	107197:107256	126676:127630
107197:107256	attL	CTTTCTGAAGCATATTGGCTTCCGCGATCTGAATGCCAAATTAACCCAGCTTTAGGCTTT	NA	NA	NA	NA
WP_054300202.1|111498_112227_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075275154.1|112356_113013_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.7	7.6e-31
WP_155047020.1|113253_114177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300477.1|114333_115062_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_075273751.1|115221_116952_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155047019.1|116964_117117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049199.1|117606_117852_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_054300202.1|117820_118549_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046770.1|118604_118772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211878.1|119068_120409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211879.1|120421_121441_-	ParA family protein	NA	NA	NA	NA	NA
WP_059372616.1|122406_122997_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.8	6.8e-23
WP_081377350.1|123242_124058_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047013.1|124387_124534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|125807_126993_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075274741.1|127062_127320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|127421_127922_-|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
126676:127630	attR	AAAGCCTAAAGCTGGGTTAATTTGGCATTCAGATCGCGGAAGCCAATATGCTTCAGAAAGTCATCGTGAGATTCTTAAAGATCATCAAATTAAGCAAAGTATGAGTCGTAAGGGAGACTGCTGGGATAACGCTGTTTCAGAGAGTTTCTTTCATACCTTAAAAACGGAGTTAGTTCATCACATGAATTTTAAAAATCGACAGGAGGCTAAATCAGCGATCTTTGAGTATATCGAAGTTTTTTATAACAGAAAACGCATTCACTCAGCTAATGATTATTTATCACCTGAGGAATACGAGCATAATCAAAAAATCAGTTAAAAATTTGTCTAGAAAAAGGTTGCCAGATCAAACGCCTAAGATCCAAACTGAAGAAAATATCAGAATGGATGAAGAAGAACCGCAATAAATATCCGCTACGGAAACTTTGGGAAATACTTTGCTCAAAGCTTAAGGGGCACGTCCAGTACTATGGAGTATCTTTTAATGCAGATGGAGTAGGTCTATTTCTTTATAAAGCAAGGCGAATATTTTATAAGTGGGTAAACCGACGCAGCCAGAGGAAGTCTTTTAATTGGGGCAAGTTTAGCCTATTTGTAAAACGATTTCCGATGCCAAAGGCTAAAGTATGTCACAAGTTCTTTTAATTCATATAGACAAGTGAAAGTAATTATCTTGAGCCTATTGCCTTAATTGGGCACGATGGGTTCTAACGAGGGGTTGATCTTGTGAAAGATCAGCCTACTCTCTATTTCAGATCTCGACCAAATGTATGTAAAGCGGCGAAAATACCAATGACAAGGCCTTTCTTCTTTGCGGTTTCTAGTAACGTATTGGCTGCGGTCCTAAAGATTATATTGAGTAATTCACGATTGAATAAGAAAAATGCCCAGAATTTTCTAGGCATAGTAAATGTGATGTGTTGCCATTTGCACTGTGGGAGAGTGGCGTTTTGCT	NA	NA	NA	NA
WP_075273820.1|128078_129161_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_016212255.1|129347_129518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|129514_129718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|130054_130279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|130298_130571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|130728_131703_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_129556717.1|132357_133584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|133909_134746_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_016212398.1|135008_135470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|135636_136017_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|136817_137183_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|137128_137704_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_129556702.1|138687_139841_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075275159.1|139861_140569_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.0	3.8e-12
WP_129556701.1|140977_141502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126739.1|141748_142081_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080728342.1|142395_142899_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_054300148.1|142938_144000_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|144105_144561_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_155062493.1|144520_144829_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|144942_145671_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_016212413.1|146004_146433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|146480_147221_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_032126346.1|147287_147530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|147621_147846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|147954_148479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211872.1|148599_149403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|149957_150221_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|150786_151122_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|151115_151316_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|151623_151848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|151877_152606_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155049901.1|152711_153233_-	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	34.4	6.9e-19
WP_016212412.1|153638_153803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|153795_154245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|154492_154666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212499.1|154870_155245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|156243_156537_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377914.1|156653_156983_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377915.1|157127_157685_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	2.9e-47
>prophage 3
NZ_CP013779	Piscirickettsia salmonis strain PM51819A plasmid p1PS5, complete sequence	165427	162109	164137	165427	protease,transposase	Acinetobacter_phage(66.67%)	4	NA	NA
WP_075275161.1|162109_162466_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	54.5	1.2e-09
WP_081377916.1|162670_163195_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	2.5e-29
WP_155764128.1|163461_163605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377917.1|163792_164137_-|protease	Clp protease ClpP	protease	F8J1B3	Lactobacillus_phage	39.4	1.7e-13
>prophage 1
NZ_CP013780	Piscirickettsia salmonis strain PM51819A plasmid p2PS5, complete sequence	122750	3811	84907	122750	portal,capsid,transposase,tail,head,protease,terminase	Erysipelothrix_phage(10.0%)	117	NA	NA
WP_016211132.1|3811_4135_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|4131_4443_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_075275171.1|4396_4594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764130.1|4632_4818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275173.1|4872_5697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275174.1|5753_5963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377919.1|6371_6968_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	46.7	6.6e-42
WP_081377920.1|6961_7564_-|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	29.8	5.9e-14
WP_080664855.1|7621_8293_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_075275175.1|8240_9482_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	45.8	2.7e-85
WP_075275176.1|9478_11161_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	45.7	6.9e-137
WP_016212234.1|11163_11643_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_075275177.1|12389_12683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275178.1|12679_13147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275210.1|13435_13801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275179.1|13945_14416_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	7.6e-33
WP_016210966.1|14645_14993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377921.1|14985_15348_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_075275182.1|15316_15853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275183.1|15893_16901_-	helix-turn-helix domain-containing protein	NA	A0A1W6JQ30	Staphylococcus_phage	42.7	1.6e-16
WP_054300682.1|16939_17242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211079.1|17396_17702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275184.1|17714_17933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275185.1|18269_18941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275186.1|18960_19449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275187.1|19453_19855_-	VUT family protein	NA	NA	NA	NA	NA
WP_081377930.1|19863_19977_-	VUT family protein	NA	NA	NA	NA	NA
WP_155764131.1|20116_20899_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_075275188.1|21095_22091_+	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	32.7	2.3e-23
WP_016212427.1|22092_22494_+	GTP cyclohydrolase I family protein	NA	NA	NA	NA	NA
WP_075275189.1|22499_23213_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211672.1|23384_23540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126620.1|23546_23831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211674.1|23814_24096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300686.1|24337_24772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036781101.1|24818_25052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377923.1|25094_25256_-	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_075274955.1|25279_26254_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_081377924.1|26714_26966_+|transposase	transposase zinc-binding domain-containing protein	transposase	NA	NA	NA	NA
WP_081377925.1|26949_27918_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075275191.1|28276_29668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300689.1|29684_30677_-	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	1.7e-10
WP_075275192.1|31744_31984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274955.1|31980_32955_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.4e-25
WP_054300691.1|33361_33790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778352.1|34227_34881_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_075275193.1|34890_36030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275194.1|36029_39317_-	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
WP_054300696.1|39313_39871_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_016210666.1|40574_41246_-|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_036776958.1|41242_41584_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_075275195.1|41576_43655_-	hypothetical protein	NA	A0A1J0GWA6	Alteromonas_phage	33.4	2.5e-56
WP_016211142.1|43658_43925_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075275196.1|43981_44305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211141.1|44306_44729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211129.1|44728_45079_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016211139.1|45075_45471_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
WP_016211132.1|45463_45787_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211137.1|45783_46095_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211133.1|46285_47620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211140.1|47739_48933_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	40.1	2.7e-66
WP_080664855.1|48990_49662_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	44.8	3.0e-43
WP_016211136.1|49609_50851_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	46.0	3.1e-86
WP_081377926.1|50847_51930_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	1.2e-89
WP_080743047.1|51948_52305_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	61.3	5.4e-23
WP_016212231.1|52320_52530_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	43.1	1.3e-08
WP_016212234.1|52533_53013_-|terminase	P27 family phage terminase small subunit	terminase	NA	NA	NA	NA
WP_032126134.1|53100_53484_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	47.2	5.6e-26
WP_016212235.1|53784_54150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046773.1|54196_54376_+	phosphatase	NA	NA	NA	NA	NA
WP_129556724.1|54520_54703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210977.1|54920_55214_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_129556725.1|55392_56073_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	39.3	3.3e-37
WP_016210974.1|56189_56597_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_016210972.1|56605_56833_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_129556726.1|56980_57373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210960.1|57487_57961_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	63.4	4.9e-32
WP_036794070.1|57962_58247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036794065.1|58243_58531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210963.1|58626_58866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210966.1|58862_59210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210959.1|59202_59565_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	53.8	2.9e-24
WP_016210973.1|59533_60094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210962.1|60116_60932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210976.1|60978_61278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210958.1|61431_61737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210967.1|61745_61955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210971.1|62117_62873_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075275197.1|62907_63675_+	ester cyclase	NA	NA	NA	NA	NA
WP_016210964.1|63695_64349_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275198.1|64416_64956_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.2	8.4e-12
WP_052104629.1|64982_66008_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_032126713.1|66477_67515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212089.1|67613_67844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275199.1|68199_68619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212087.1|68786_69215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212090.1|69214_69394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|69437_70412_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212539.1|70408_70558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212541.1|70617_70842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556729.1|70828_71059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307358.1|71342_71726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211444.1|71874_72381_-	antirestriction protein ArdA	NA	A0A222YZE5	Mycobacterium_phage	33.7	2.8e-17
WP_032126541.1|73573_73966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211437.1|73972_74599_+	zinc-ribbon domain-containing protein	NA	A0A1S5XYQ1	Kurlavirus	28.2	4.4e-12
WP_016211445.1|74615_74966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211434.1|75142_75334_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211436.1|75306_76245_-	Fic family protein	NA	S4TP71	Salmonella_phage	37.2	5.2e-25
WP_016211439.1|76289_76844_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	40.6	1.0e-20
WP_016211443.1|76847_77534_-	Fic family protein	NA	NA	NA	NA	NA
WP_075275200.1|78557_79424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275201.1|79713_80442_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_075275202.1|80444_81146_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	6.0e-10
WP_016212135.1|81389_82574_-	3-methylitaconate isomerase	NA	NA	NA	NA	NA
WP_016212133.1|82831_83056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212131.1|83012_83360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923779.1|84070_84907_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	36.3	1.2e-41
