The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	3718	57904	3046533	tRNA,protease,transposase	Staphylococcus_phage(14.29%)	52	NA	NA
WP_054300271.1|3718_4693_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|5040_6912_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|7003_8749_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|8828_9278_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|9330_9546_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|9792_10809_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|10857_11487_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|11837_13049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|13276_13549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|13712_14774_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210569.1|15098_15713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|15827_17162_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|17289_17931_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|18236_18659_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|19015_19978_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_081007068.1|20016_21192_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155046983.1|21280_22981_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_054300273.1|22980_24519_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210562.1|24547_26200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|26273_27029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|27309_28196_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|28606_29896_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|30091_31279_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|31596_31806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|31789_32389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|32463_33813_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|33895_36097_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|36113_36929_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|36908_37628_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|37795_38371_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|38316_38682_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|38856_39519_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|39549_39918_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|39928_41245_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|41527_42103_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|42178_42358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|42530_42824_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|43013_43367_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|43421_45695_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|45754_46000_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|46124_47000_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|47077_47839_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|47822_48779_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|49041_51546_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|51549_52290_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|52629_52995_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|53051_53216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|53205_53505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126933.1|53508_54810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|54978_55953_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209411.1|56158_56953_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|57115_57904_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	97264	222189	3046533	tRNA,protease,transposase	Staphylococcus_phage(23.08%)	104	NA	NA
WP_016209432.1|97264_98974_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|99231_100563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300279.1|101004_102477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273506.1|102962_103232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|103192_103558_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|103798_104665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|105177_105522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|105674_105866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007014.1|106109_106505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|106465_107351_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046982.1|108576_108741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|108797_109163_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|109403_110045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|110513_111488_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300284.1|111845_113234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|113469_115407_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|116420_117140_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|117253_120793_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|120859_121678_+	ZipA protein	NA	NA	NA	NA	NA
WP_075274647.1|121664_123704_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.7	1.1e-125
WP_016210522.1|123719_124772_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|124782_125313_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|126950_127127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|127303_127687_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|127762_128056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|128222_129182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|129912_130068_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|130332_131703_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|131695_132649_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|132629_135434_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|135513_136110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|136499_137255_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|137454_138096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|138356_139682_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|139678_141736_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|141713_142286_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|142341_142701_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|142765_143800_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|144057_144909_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|145003_145987_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|146143_147811_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_075274733.1|148749_149067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|149085_149661_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|149606_149972_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|149993_150323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300288.1|150731_151421_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_105962623.1|151429_152583_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081007015.1|153075_153501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|153712_153970_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|153969_154977_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|155231_156233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|156688_156841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|156813_156987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|156976_157141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|157197_157563_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|157834_158896_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|159639_162108_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|162121_163090_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|163076_164336_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|164387_165773_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|166583_166808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274649.1|167088_167946_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|168558_169680_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|169729_170926_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|171114_172179_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|172162_172909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|172898_173627_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|173623_174283_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|174266_175214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|175213_175729_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|175771_177205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|177298_179500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|179988_181581_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|181805_183383_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|183494_183920_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|184030_185416_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|185441_185879_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|185883_186225_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|186239_188231_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|188256_188931_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|188927_191102_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|192310_193864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|193947_194757_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|194884_195118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|195418_196921_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|197224_199918_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|199914_203316_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|203407_204490_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|204552_205620_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|206555_207212_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|207315_208398_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|208737_209712_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|210339_211095_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|211461_212469_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|212468_212726_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|213090_214065_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273524.1|214105_215071_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|215226_216777_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|218978_220061_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|220150_220327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|220316_220616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|220605_220770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|220826_221192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|221325_222189_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	266593	368966	3046533	tRNA,transposase	Escherichia_phage(25.0%)	88	NA	NA
WP_033923708.1|266593_267469_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|267583_268729_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|268721_269117_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|269335_270091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|271446_271941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|272398_273763_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|273858_274518_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300306.1|274765_274990_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300307.1|275092_275821_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300308.1|275850_276081_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|276375_277935_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|278295_280266_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|280457_281537_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|281585_281792_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|281798_283280_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|283382_283946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|285707_286967_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|287087_287420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|287533_288508_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|288652_288823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|289021_290044_+	YHYH protein	NA	NA	NA	NA	NA
WP_075274652.1|290051_291734_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|291894_292713_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|292926_293910_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|293902_294124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|294151_294793_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_075274653.1|295324_296200_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|298662_299548_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|299552_299840_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|299892_300171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|300269_300617_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|300938_301178_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|301395_301983_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|301943_302279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|302466_303111_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|303445_304096_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|304628_305681_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075274654.1|305698_308779_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|309077_309893_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|310241_310970_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016209615.1|312237_312744_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|312761_314261_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|314282_314894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|314890_316063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|316094_318632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|318663_320556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|320923_321640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|321642_324516_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|324516_324921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|324935_326657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|326656_329605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|329607_331005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|331018_331759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|331739_332174_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|332218_332848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|332918_333833_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|333863_337166_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|337162_338986_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|339025_339424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|339544_340549_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|340981_342430_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|342516_345573_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|345555_345726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|345791_345929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274655.1|346225_346759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126753.1|347747_348212_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|348281_349802_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|349889_350492_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|350488_350836_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|350986_351970_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_054300318.1|352597_353575_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052104629.1|353722_354748_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052047087.1|355198_355417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274656.1|355588_356269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274657.1|356473_356902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|358047_358647_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|358864_359236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|360030_360177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|360410_361274_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|361482_362676_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|362755_364360_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|364375_365521_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|365725_365923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|365885_366224_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|366183_366639_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|366884_367151_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|367513_368275_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_081007023.1|368309_368966_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	374991	436393	3046533	transposase	Adoxophyes_honmai_entomopoxvirus(14.29%)	55	NA	NA
WP_052104629.1|374991_376017_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273534.1|376379_377261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|377454_377727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|377828_378293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|378706_379156_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|379275_379656_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|379793_380570_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155046974.1|380680_380842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274658.1|380993_382199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274659.1|382248_383310_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|383931_384510_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|384537_384933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|385038_386496_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|386557_388045_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|388795_389266_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|393220_394483_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|394570_396376_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|396859_397657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|397826_398288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|398586_400542_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155046973.1|400708_400867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212182.1|401223_401409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|401742_402732_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|406105_406420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|406677_406938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|406957_407446_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|408969_409560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|409819_410077_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|410076_411084_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300338.1|411108_412674_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|412880_413708_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|414074_414686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|414870_415131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|415304_416258_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|416680_416881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|417255_418062_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|418167_419139_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|419120_420092_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081007027.1|420414_420600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007028.1|421384_421840_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|421799_422138_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|422311_422752_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|423430_424369_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|424432_426427_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|426423_427026_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|427022_427361_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|427436_428663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|429220_430192_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|430407_430593_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|430719_431187_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|431183_432062_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|432312_433620_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|433772_434228_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|434187_434526_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|435487_436393_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	451140	559174	3046533	tRNA,transposase	Staphylococcus_phage(13.79%)	101	NA	NA
WP_054300271.1|451140_452115_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|452134_452572_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|452586_452952_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|453105_454083_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|454200_455649_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|455677_456682_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|456704_457376_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|457360_458614_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|458862_459417_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|460000_461185_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|461351_462950_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|463643_464615_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|464650_464878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|464881_465768_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|465855_466128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007032.1|466261_466531_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	63.2	9.3e-12
WP_016209794.1|466758_467382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300344.1|467427_469371_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|469492_470245_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144019182.1|470248_470755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556639.1|471050_471461_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|471477_471933_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|471929_472421_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|472417_473167_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|473196_473466_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_016209787.1|473481_474267_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|474280_475414_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|475448_477542_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|477572_479033_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|479013_479901_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|479897_480620_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|480706_481090_+	response regulator	NA	NA	NA	NA	NA
WP_016209769.1|481131_481875_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_036776682.1|481887_483912_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|483973_484267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|484403_485126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|485290_486013_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|486719_487175_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|487190_488639_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|488679_489435_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|489415_490816_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|490839_492057_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|492087_492462_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|492480_493032_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|494313_495288_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|495385_496447_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|497001_497976_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|498666_499242_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|499187_499553_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300345.1|499689_500769_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|500850_501933_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300346.1|502079_502955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126678.1|502965_503976_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.6	1.2e-22
WP_016211554.1|504302_504929_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.6e-33
WP_016211557.1|504974_506204_+	na+ dependent nucleoside transporter family protein	NA	B2YG43	Musca_hytrovirus	22.0	2.0e-08
WP_032126677.1|506398_506962_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211555.1|507036_508395_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_016211664.1|508931_509660_-	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_016211666.1|510032_512852_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.2	1.0e-311
WP_016211669.1|513006_513357_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|514181_515156_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|516466_517699_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|517905_519678_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|519813_520857_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|520870_521614_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032126682.1|521721_522048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|522364_523063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300347.1|523484_524876_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|524931_525756_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300161.1|526370_527432_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|527650_527791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|528058_528706_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|528986_529346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|529512_529968_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|529927_530266_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211482.1|530401_532675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|532663_533386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|533496_534129_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|534164_534341_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|534415_535558_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_032126825.1|535790_537104_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|537655_539380_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|540531_541417_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|541951_542140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|542090_543244_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046729.1|543461_544508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|544766_545573_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|545828_546650_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|546685_547540_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|547765_547930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066176.1|548283_548553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|548561_549715_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126362.1|550223_550589_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|550534_551110_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|551462_552821_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|553102_553462_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|553882_555517_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|555523_556360_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|556381_557659_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|557742_558063_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|558082_559174_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	578782	633788	3046533	integrase,protease,transposase	Staphylococcus_phage(36.36%)	55	604787:604846	631415:631704
WP_054300353.1|578782_579010_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046967.1|579060_579675_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300271.1|579813_580788_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046966.1|580860_581241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|581201_581567_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|581512_582088_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|582077_582263_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|582473_582635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|582667_583543_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|583708_587575_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|587656_587797_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|587778_588063_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|588327_589746_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|590654_591560_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|591800_591986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|592022_592559_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_054300271.1|594037_595012_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212012.1|595055_595733_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|595748_596132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|596353_597475_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274660.1|597708_598578_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300148.1|598535_599597_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211974.1|600021_601143_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|601242_601545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|601544_602225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|602803_603689_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155764063.1|603686_604532_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.2	8.0e-25
WP_081377865.1|604528_604813_-|transposase	transposase	transposase	NA	NA	NA	NA
604787:604846	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_080664876.1|605171_607034_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_054300359.1|607258_607831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274736.1|608189_609227_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377353.1|610052_610718_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|610757_611732_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|612288_612918_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|612901_613324_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|613330_615070_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|615070_616135_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|616138_616492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|616604_617561_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|617570_617882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|617897_618467_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|618730_620059_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|620230_621205_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|621418_621790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|621848_622622_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155046965.1|622773_625230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|625509_626271_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|626351_628097_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|628272_629400_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|629486_629717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|630331_631111_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|631585_632023_-	MFS transporter	NA	NA	NA	NA	NA
631415:631704	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
WP_155047262.1|632411_632528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|632919_633267_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046964.1|633212_633788_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	672703	741856	3046533	tRNA,protease,transposase	Klosneuvirus(22.22%)	60	NA	NA
WP_016211285.1|672703_673483_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211280.1|673482_673992_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|674027_674276_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211281.1|674587_674923_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211282.1|675217_676468_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126762.1|676549_678577_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016210148.1|679412_679631_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_016210147.1|680491_681664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777648.1|681676_683674_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016210142.1|683654_684635_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273562.1|684694_685564_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016210153.1|685563_685968_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075273564.1|685960_686380_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210157.1|686402_687032_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016210144.1|687574_689764_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210150.1|689775_690981_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081377354.1|690965_692816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664835.1|692803_694030_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210156.1|694022_695891_+	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_016210149.1|695924_697169_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210155.1|697174_697984_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210154.1|698022_698715_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210146.1|698836_699328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|699677_699851_+	phosphatase	NA	NA	NA	NA	NA
WP_075273565.1|699988_700879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046721.1|701059_701227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|701398_702373_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|702369_703227_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|703954_704344_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|704520_705279_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|705275_707675_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|709054_710353_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|710550_711444_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|711443_712658_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|712677_713964_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|713979_714234_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|714469_715837_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|716167_717190_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|717712_719188_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|719404_720301_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|720619_722179_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|722254_722449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|722668_723367_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|723645_723909_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|724215_726810_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|726806_727289_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|727266_728307_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|728479_728965_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|729072_731643_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_032126642.1|731678_732140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|732209_732416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|733619_734159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|734818_736303_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|736427_737963_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|738196_738562_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|738507_739083_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|739115_739979_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|739996_740329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300375.1|741135_741336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|741550_741856_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	762642	806394	3046533	tRNA,transposase	Acinetobacter_phage(22.22%)	39	NA	NA
WP_075273327.1|762642_763218_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|763221_763668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|764319_764820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|765235_765589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|765889_767617_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|767754_768411_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|768441_769170_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|769162_770401_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|770536_771574_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|771627_772530_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|772638_773892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|773949_777447_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|777506_778235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|778362_778911_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016210508.1|779519_781217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|781225_782379_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212482.1|782922_783066_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|783280_783481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046961.1|783600_784005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|784172_784538_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377355.1|785898_786267_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|786341_786908_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|786910_787999_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|788119_788932_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|789062_791048_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|791107_791761_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_105962623.1|792362_793516_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300380.1|793826_794483_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300381.1|794946_795594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|796988_798050_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|798909_799362_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|799479_800952_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|801110_801575_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|802045_802219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|802928_803294_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|803239_803815_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|803804_804464_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|804563_805835_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|805923_806394_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	810762	841420	3046533	tRNA,transposase	Wolbachia_phage(33.33%)	27	NA	NA
WP_075273327.1|810762_811338_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|811283_811649_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|811852_812509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|812779_813202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|813472_815953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|816048_816978_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|816984_818904_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|818968_820243_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|820661_821333_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|821341_822193_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|822370_823669_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016212040.1|825029_826379_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|826555_827113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|827301_827700_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_105962624.1|827755_829123_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300384.1|829531_830347_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|830508_831045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|831206_831860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764065.1|832000_832252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|832784_832967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|833316_834594_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_081377356.1|834590_834728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274667.1|835239_836841_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|836857_838000_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|838252_838990_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|839014_840286_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|840514_841420_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	877989	930082	3046533	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	51	NA	NA
WP_054300392.1|877989_879051_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300393.1|879594_880176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300394.1|880138_880501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|880631_881360_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|881479_881758_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_075273298.1|881761_882337_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|882282_882450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|882690_882936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047008.1|882993_883308_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|883325_886172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|886681_887632_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|887714_888494_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|888562_889270_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|889230_889482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|889504_889801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|890334_891108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|891140_891737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|891794_892676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273592.1|893051_894026_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_054300399.1|894124_894391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|894535_894778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|894834_895362_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|896027_896222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|896435_896789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|897120_897402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300402.1|898004_902150_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|902349_903483_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|903496_903685_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300403.1|903977_904952_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_075273594.1|904991_906362_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|906434_907328_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|907436_908354_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|908405_909161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|909228_910503_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|910637_911315_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|911515_912943_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|912917_913556_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|913765_914044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|914277_915222_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|915243_917112_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|917132_917486_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|917524_918640_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|918822_919863_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|919865_920900_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|920896_921958_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|922069_923542_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|923694_924138_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|924213_926985_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|927141_928371_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|928397_929060_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|929581_930082_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	938355	980838	3046533	tRNA,transposase	Tupanvirus(28.57%)	38	NA	NA
WP_075274670.1|938355_939417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|939477_939819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|940123_941277_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212005.1|942177_943938_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|944327_944984_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|944996_946502_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|946523_947054_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|947133_948396_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|948570_949431_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|949532_950315_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|950405_951731_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|952098_953277_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|953453_954107_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|954242_956183_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|956179_956788_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|956967_957942_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|958132_961498_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|961564_962140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779996.1|962151_963708_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_036779999.1|963727_964159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780001.1|964145_964409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|964765_965137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274671.1|965503_966067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|966381_966540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|966577_968020_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_075273327.1|968009_968585_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|968530_968896_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274672.1|968933_969527_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|969819_970706_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|970851_973782_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|973914_975867_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|976059_976707_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|976762_978088_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|978117_978369_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|978326_978908_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|979244_979901_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|979951_980317_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|980262_980838_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1010283	1063100	3046533	tRNA,transposase	Acinetobacter_phage(14.29%)	56	NA	NA
WP_129556499.1|1010283_1011437_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|1011604_1012306_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|1012381_1013011_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|1013196_1014435_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|1014709_1015372_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|1015361_1016594_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_032126328.1|1016722_1016974_+	VOC family protein	NA	NA	NA	NA	NA
WP_144019383.1|1017328_1017547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|1017954_1018248_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|1018478_1019342_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1019475_1019841_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1019786_1020362_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|1021008_1022208_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|1022460_1022748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|1022803_1024813_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|1024867_1025827_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|1025974_1026757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|1026912_1027629_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|1027642_1029034_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|1029075_1032063_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|1032132_1032966_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|1033019_1034186_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|1034173_1034884_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|1034923_1035709_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|1035736_1036480_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1036577_1038773_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|1038848_1039532_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|1039542_1039974_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|1040013_1040412_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|1040784_1041492_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|1041556_1041859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|1041914_1042391_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|1042445_1042967_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|1043048_1044143_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|1044379_1044694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1044838_1045249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300414.1|1045519_1046005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|1046668_1047370_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|1047503_1048220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|1048356_1049604_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|1049982_1050594_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|1050690_1051557_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|1051560_1052322_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|1052485_1053391_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|1053613_1054444_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|1054613_1055003_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300416.1|1055135_1056086_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|1056380_1056701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1056812_1057787_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1058156_1058732_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1058677_1059043_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|1059003_1060002_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274674.1|1059979_1060825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300422.1|1060875_1061313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|1061583_1061964_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300423.1|1062038_1063100_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1080672	1124108	3046533	transposase	Staphylococcus_phage(40.0%)	48	NA	NA
WP_105962625.1|1080672_1081558_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556489.1|1081562_1082759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1083004_1084066_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|1084043_1084283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1084803_1085379_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1085324_1085690_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1086728_1087592_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1087610_1088497_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047109.1|1088558_1088972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1089118_1090093_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556488.1|1090151_1091002_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274679.1|1091150_1092212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|1093661_1094012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|1094156_1094993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1095046_1096339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1096574_1099331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|1099800_1099965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|1100486_1100666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1100907_1101609_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1101869_1102076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|1102305_1102611_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|1102789_1104787_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|1104770_1105817_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|1106537_1107389_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|1107389_1108310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|1108720_1109005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1108996_1109452_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1109411_1109750_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|1109962_1110892_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|1111048_1111477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|1111557_1112094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1112063_1112969_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1113137_1113746_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1113786_1114362_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|1114307_1114475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1114580_1115733_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|1116227_1116839_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|1116859_1118056_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|1118152_1118293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|1118305_1118710_-	SufE family protein	NA	NA	NA	NA	NA
WP_155046954.1|1118864_1119038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|1119144_1119462_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|1119421_1119724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1119868_1120054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|1120623_1121205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|1121232_1122366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|1122629_1123157_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081377359.1|1123478_1124108_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1145269	1244284	3046533	tRNA,protease,transposase	Staphylococcus_phage(31.25%)	96	NA	NA
WP_016209884.1|1145269_1145893_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|1145969_1146170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|1146311_1147010_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|1147156_1147726_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|1148040_1148664_-	porin family protein	NA	NA	NA	NA	NA
WP_059372667.1|1148872_1149586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1150655_1151542_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|1151621_1151798_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|1151921_1152455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|1153786_1154371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274681.1|1154921_1155797_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|1155845_1156262_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|1156548_1157391_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|1157441_1157789_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|1157979_1158867_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|1158981_1159584_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|1159580_1160300_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_054300435.1|1160368_1162081_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_036777098.1|1162228_1164166_+	AsmA family protein	NA	NA	NA	NA	NA
WP_016210461.1|1165325_1165601_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|1165681_1166230_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_054300436.1|1166546_1169138_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016210459.1|1169302_1169821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285947.1|1170025_1171144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|1171391_1172315_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|1172328_1173252_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|1173199_1173856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|1174158_1174986_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|1175426_1175798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|1175990_1177523_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|1177585_1178923_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|1179065_1180532_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|1180528_1181578_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_054300438.1|1181701_1183816_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|1183980_1184385_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|1184445_1185171_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|1185256_1186147_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|1186187_1186808_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|1186868_1187075_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|1187096_1189250_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|1189256_1191239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046953.1|1191510_1191651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1191659_1192813_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300440.1|1193109_1194321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274682.1|1194465_1194897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300442.1|1195108_1197205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|1197899_1198823_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|1199061_1199340_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1199392_1199641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|1199598_1200660_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|1201080_1201233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|1201655_1201829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|1202001_1202163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212205.1|1203848_1204028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|1204167_1205613_+	MFS transporter	NA	NA	NA	NA	NA
WP_036781320.1|1206459_1206687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|1206673_1207000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|1207001_1207433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1207961_1209023_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274683.1|1209117_1209681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|1209950_1210970_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|1210956_1211379_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|1211380_1211854_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|1211969_1212593_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|1212622_1213297_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|1213302_1214451_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|1214447_1214909_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|1214984_1216235_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|1216361_1218041_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|1218150_1219017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300446.1|1220447_1221182_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_036781250.1|1221277_1222063_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155046951.1|1222869_1223133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211002.1|1223214_1223613_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|1223776_1224082_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|1224159_1224414_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|1224567_1226229_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|1226288_1226972_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|1226971_1228060_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_054300447.1|1228108_1230745_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|1231157_1232219_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|1232408_1234778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1234821_1235796_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300449.1|1235815_1236595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1236724_1237063_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1237022_1237478_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300450.1|1237803_1239123_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1239126_1239843_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|1239839_1240481_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|1240473_1240572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007049.1|1240549_1240846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|1240856_1241312_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|1241366_1241711_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|1241740_1242784_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|1243198_1243408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1243397_1244284_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1332757	1380186	3046533	tRNA,transposase	Acinetobacter_phage(16.67%)	43	NA	NA
WP_087910645.1|1332757_1333910_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_051307322.1|1333980_1334160_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016212612.1|1335007_1335241_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|1335334_1335700_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1335714_1336221_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|1336278_1336671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|1336800_1337166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274691.1|1337222_1337531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1337622_1338198_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1338143_1338509_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1338661_1338934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|1339542_1339878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|1340037_1341570_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|1341602_1342442_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|1342438_1342936_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|1342939_1343932_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|1344046_1345393_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|1345616_1346678_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|1346756_1347902_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|1353713_1354571_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|1354557_1355481_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|1355677_1357069_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|1357115_1358159_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|1358201_1358645_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|1358777_1359968_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|1360022_1360169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|1360719_1361637_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|1361904_1362198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|1362274_1362469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|1363487_1364405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|1364870_1365713_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|1365780_1366431_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|1366445_1367486_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|1367608_1368694_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|1368720_1369830_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|1369846_1370164_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|1370160_1370520_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|1373851_1374805_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|1374877_1375939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|1376702_1377260_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|1377453_1378137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|1378855_1379098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300464.1|1379124_1380186_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1468443	1556916	3046533	tRNA,integrase,transposase	Escherichia_phage(39.29%)	85	1493753:1493812	1556376:1556984
WP_054300202.1|1468443_1469172_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210945.1|1469365_1469956_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|1470082_1471468_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|1471562_1471760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|1471853_1472672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|1473178_1473556_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|1473568_1473805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|1473804_1474011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|1474193_1474913_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|1475001_1476786_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|1476884_1477139_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|1477495_1478107_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|1478594_1479323_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211812.1|1479404_1481018_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|1481059_1481413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|1481941_1482670_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|1482846_1483944_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|1483977_1485228_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|1485367_1486096_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|1486218_1486557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|1486624_1487011_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|1487007_1487253_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|1487661_1488390_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|1488873_1489743_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|1489739_1491089_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|1491201_1492842_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300477.1|1493564_1494293_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
1493753:1493812	attL	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGA	NA	NA	NA	NA
WP_054300478.1|1494572_1496309_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|1496648_1497377_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|1497535_1498036_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|1498010_1498520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|1499119_1499848_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|1499998_1501039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|1501236_1502262_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|1502369_1503575_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|1503834_1504248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|1504376_1504946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|1504949_1505282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|1505274_1506114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|1506201_1507836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|1508197_1508701_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|1508663_1509371_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|1509439_1510300_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|1510280_1511054_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|1511084_1512338_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|1512337_1513300_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|1513343_1514096_+	ComF family protein	NA	NA	NA	NA	NA
WP_032126362.1|1515631_1515997_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1515942_1516518_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210615.1|1517424_1517895_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|1517940_1518180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|1518198_1518648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|1518868_1520293_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|1520357_1521407_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|1521673_1522453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|1522496_1523399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|1523457_1524204_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|1524452_1527263_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|1527497_1528358_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_054300481.1|1528459_1529188_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|1529277_1529484_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|1529646_1530879_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|1531394_1532684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|1532713_1533442_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_036780093.1|1533545_1534367_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|1534376_1537679_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211323.1|1539107_1540205_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|1540194_1541715_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|1541777_1542368_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_054300483.1|1542903_1543458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|1543954_1544902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|1545126_1545276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|1545420_1545666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|1545803_1545971_-	phosphatase	NA	NA	NA	NA	NA
WP_016212294.1|1546400_1546745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|1546758_1547211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|1547207_1547426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|1547732_1547942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|1548243_1548453_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|1549780_1550197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|1550254_1551407_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|1551463_1552912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|1554445_1554634_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|1556035_1556311_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|1556313_1556916_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
1556376:1556984	attR	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 17
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1602205	1653646	3046533	tRNA,transposase	Microbacterium_phage(12.5%)	52	NA	NA
WP_105962625.1|1602205_1603092_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556590.1|1603775_1604171_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|1604167_1604962_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|1605140_1605866_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|1606111_1607299_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|1607875_1608418_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|1608414_1609101_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|1609104_1609716_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|1609762_1610782_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|1610883_1611678_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|1611699_1612506_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|1612584_1613634_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|1613831_1615091_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|1615137_1615815_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|1615900_1616182_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|1616273_1617428_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|1617697_1618639_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|1619142_1619367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|1619658_1620363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|1620784_1621423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|1621757_1622288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|1622284_1623817_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|1623813_1624764_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|1625184_1625817_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|1626059_1626257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|1626606_1627035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|1627112_1627811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1627788_1628850_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|1629074_1629371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|1629475_1630132_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|1630355_1630853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1632062_1632518_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1632477_1632816_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|1632873_1634412_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|1634523_1635622_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|1635859_1637059_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|1637088_1637727_+	ribonuclease T	NA	NA	NA	NA	NA
WP_016210983.1|1637742_1639926_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_032126304.1|1640163_1640508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|1641553_1641760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|1643258_1644386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|1644509_1645172_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|1645263_1645509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|1646582_1647242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|1647343_1647994_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|1648106_1648427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1648485_1649460_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|1649710_1649932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|1649954_1650176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|1650220_1651177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|1651671_1652634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|1652760_1653646_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1714338	1747724	3046533	tRNA,protease,transposase	Stx2-converting_phage(20.0%)	35	NA	NA
WP_054300173.1|1714338_1715400_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|1715490_1716237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|1716505_1717225_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|1717468_1717831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|1718017_1718545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|1718689_1719106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|1721188_1722100_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|1722151_1723000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|1723444_1724155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|1724246_1725215_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|1725202_1725850_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|1725878_1726730_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|1726744_1728022_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|1728062_1728578_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|1728656_1729718_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|1729739_1730828_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_036777788.1|1730872_1732708_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|1732750_1733221_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|1733257_1733593_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|1733605_1734322_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|1734258_1735275_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|1735271_1735751_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|1735834_1738315_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|1738377_1738743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1739081_1739420_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1739379_1739835_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|1739849_1740140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|1740205_1741804_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|1741934_1742270_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|1742297_1743962_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|1743958_1744603_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|1744602_1745346_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|1745404_1745644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|1745794_1747162_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|1747172_1747724_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 19
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1900881	1966435	3046533	transposase	Erwinia_phage(18.18%)	56	NA	NA
WP_054300168.1|1900881_1901745_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075274701.1|1902041_1903094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|1903382_1903790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|1904003_1904495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|1904550_1905801_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|1905903_1906122_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|1906579_1907434_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|1907488_1907959_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|1908265_1909645_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|1909672_1910131_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|1910108_1911326_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|1911517_1911754_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|1911767_1911923_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_075274702.1|1912003_1912966_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|1913125_1914442_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|1914451_1915120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|1915482_1917297_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_054300166.1|1917414_1918203_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211543.1|1918783_1920535_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|1920545_1921346_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|1921448_1921937_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|1922110_1922425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|1923445_1923790_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|1929483_1930446_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|1930632_1931892_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|1932115_1932442_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|1932636_1933587_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|1933644_1935711_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|1935716_1936712_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|1937297_1938878_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|1939034_1940444_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|1940503_1941637_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|1941776_1942601_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|1942828_1943458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|1943794_1944166_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|1944469_1944757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|1944908_1945757_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|1945884_1946925_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|1946997_1948575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|1949218_1949878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1950032_1951007_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|1951082_1952102_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155047000.1|1952149_1952296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047001.1|1952500_1952686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1953584_1954667_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|1954714_1955776_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|1955856_1956165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|1956279_1957596_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|1958057_1959344_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|1959416_1960313_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|1960399_1961398_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|1961506_1962031_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_129556668.1|1962278_1963517_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_016212222.1|1964064_1964538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|1964534_1964930_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1965859_1966435_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	1976509	2082863	3046533	tRNA,transposase	Staphylococcus_phage(28.57%)	110	NA	NA
WP_081007000.1|1976509_1977598_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|1977821_1979102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1979934_1980300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1980245_1980821_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1981103_1981469_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|1981483_1982089_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|1982459_1983857_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|1983976_1984924_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|1984920_1985436_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|1985422_1986622_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|1986618_1986942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|1986943_1988173_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|1988172_1989216_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|1989215_1989899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|1989895_1992385_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|1992401_1992656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|1992656_1993013_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_081377360.1|1993792_1994956_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|1994975_1998083_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|1998084_1999590_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|1999617_1999899_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2000047_2000389_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2000508_2002389_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_155053506.1|2002473_2003991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2004089_2005205_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2005332_2006331_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2006334_2007093_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2007094_2008294_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2008277_2008949_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209710.1|2008970_2009747_-	indole-3-glycerol-phosphate synthase	NA	NA	NA	NA	NA
WP_016209717.1|2009750_2010749_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2010750_2011329_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2011325_2012795_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2012838_2013126_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2013257_2014232_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2014432_2015029_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2015055_2015421_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2015477_2015633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2015777_2016230_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2016267_2016600_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2018088_2018974_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2019160_2019382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2019497_2020130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2020107_2021169_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2021608_2022148_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2022232_2022769_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_016211866.1|2023420_2023723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2024172_2024481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|2024801_2025251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2025533_2026244_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2026470_2026869_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2027736_2028687_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2028686_2030765_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211228.1|2030912_2031428_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211234.1|2031436_2032000_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211229.1|2031980_2032727_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211230.1|2032866_2033319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210351.1|2033454_2034291_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016210335.1|2034287_2035184_+	EamA family transporter	NA	NA	NA	NA	NA
WP_016210345.1|2035216_2036284_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2036302_2036671_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_129556609.1|2036696_2038145_-	potassium transporter	NA	NA	NA	NA	NA
WP_016210336.1|2038154_2039534_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_051307328.1|2039574_2040906_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_032126694.1|2040877_2041837_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2041929_2042433_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|2042567_2043719_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2043715_2044195_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|2044341_2046663_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|2046607_2047234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|2047238_2048138_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|2048210_2048789_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|2049089_2049347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|2049355_2049727_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|2049931_2050387_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_075274757.1|2050503_2050857_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	1.3e-05
WP_155046758.1|2051644_2051776_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|2052403_2053177_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032126148.1|2053718_2053901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2054504_2055479_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007065.1|2056639_2057479_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|2057691_2057991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2057980_2058145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2058201_2058567_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|2059871_2060567_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_075274707.1|2060563_2061991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211791.1|2062016_2062280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2062352_2063327_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|2063385_2064236_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|2064273_2064618_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|2064614_2065451_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|2065451_2065793_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|2065794_2066400_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|2066396_2068391_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|2068410_2069352_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|2069579_2071004_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|2071516_2072491_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|2072549_2073206_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|2073252_2073936_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|2074481_2074796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|2074690_2075686_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211924.1|2075841_2076000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942409.1|2076359_2076791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556614.1|2076928_2077081_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211852.1|2077666_2078380_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_075273625.1|2078438_2079191_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211851.1|2079387_2080044_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273397.1|2080732_2081128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377361.1|2081443_2082193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047007.1|2082257_2082863_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2142258	2191994	3046533	transposase	uncultured_Caudovirales_phage(16.67%)	49	NA	NA
WP_155047004.1|2142258_2142765_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211577.1|2143117_2145811_-	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.8	2.6e-69
WP_129556616.1|2145842_2146430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664863.1|2146474_2147515_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_016211572.1|2147636_2147861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2148102_2148678_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2148623_2148989_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|2149187_2149949_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|2150250_2151777_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|2152148_2152988_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|2153027_2154335_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|2154309_2155479_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|2155533_2156259_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|2156537_2156927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2157114_2158020_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|2158067_2158211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|2158258_2159062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2159089_2160243_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|2161137_2163084_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|2163738_2166801_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|2166797_2167862_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|2168217_2169171_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|2169202_2170366_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|2170371_2170971_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|2171158_2171659_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|2171676_2172765_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|2172903_2174148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|2174144_2174987_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|2174966_2175776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|2175954_2176182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|2176182_2177133_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|2177188_2177740_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|2177866_2178289_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|2178281_2179028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|2179070_2179769_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|2179779_2180604_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|2180933_2181302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2181296_2182358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|2182407_2182638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|2182767_2183982_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|2184282_2185344_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_054300547.1|2185357_2187079_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|2187118_2187850_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_016211247.1|2187849_2188638_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_155066175.1|2188763_2189366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|2189685_2189898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|2190053_2190626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300362.1|2190878_2191403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300546.1|2191397_2191994_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2254150	2303147	3046533	protease,transposase	Bacillus_phage(50.0%)	57	NA	NA
WP_054300545.1|2254150_2255212_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|2255606_2256002_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|2256023_2256389_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|2256445_2256610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2256599_2256899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|2256989_2257436_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|2257931_2258498_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|2258509_2259295_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|2259926_2260850_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|2260901_2261897_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|2261928_2262423_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|2262514_2262772_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|2262861_2263284_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|2263602_2264319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|2264362_2264614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|2264618_2266055_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|2266082_2267525_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|2267612_2267951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|2268035_2268566_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|2268626_2270819_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|2270861_2271347_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|2271616_2272048_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|2272065_2272896_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|2272910_2273054_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|2273084_2273969_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|2273940_2274162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|2274335_2274614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|2275294_2275531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2275556_2276462_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|2276892_2277774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2278007_2278583_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2278528_2278894_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|2279221_2280001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|2280534_2281335_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|2281553_2282312_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|2282388_2282676_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|2282679_2283255_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2283200_2283566_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|2283629_2283902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|2284169_2284394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|2285409_2286753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210775.1|2287045_2287639_+	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_017377589.1|2287607_2288261_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|2288438_2289410_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|2289432_2290329_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|2290487_2290934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|2290930_2291572_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|2291681_2292260_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|2292735_2293173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|2293497_2294838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|2295101_2296496_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|2297944_2299012_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|2299064_2299487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|2299727_2300171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|2300225_2300483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|2300460_2301087_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|2301164_2303147_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 23
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2319032	2374289	3046533	tRNA,tail,transposase	Acinetobacter_phage(42.86%)	46	NA	NA
WP_016209854.1|2319032_2320019_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2320011_2320254_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|2320375_2321920_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_032126611.1|2321966_2323253_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209864.1|2323295_2324690_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|2324713_2324893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2324889_2325465_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2325410_2325776_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|2328781_2329279_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|2329449_2330145_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|2330247_2331810_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|2332125_2333919_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|2334004_2334277_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|2334282_2334909_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|2334895_2336326_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|2336658_2337714_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|2337682_2338360_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|2338349_2339186_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|2339345_2339639_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|2339745_2340552_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|2340856_2341711_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|2341865_2342915_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|2342965_2343622_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|2343639_2344920_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|2345193_2346555_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_155046933.1|2346828_2347506_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|2352942_2354214_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|2354270_2355254_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|2355250_2356036_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2356732_2357098_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|2357043_2357619_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|2357622_2358342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|2358486_2358687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|2358734_2359196_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|2359619_2361101_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|2361163_2362273_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|2362370_2364332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|2364861_2365266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2365318_2366380_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|2366505_2366661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2367034_2368117_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_105962623.1|2369619_2370772_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075274709.1|2370843_2372550_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_032126861.1|2372753_2373068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046703.1|2373261_2373399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046937.1|2373402_2374289_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2534537	2644245	3046533	tRNA,integrase,transposase	Escherichia_phage(41.18%)	112	2583038:2583097	2617000:2617288
WP_054300513.1|2534537_2535401_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|2535617_2537177_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|2537198_2538233_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|2538281_2538851_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|2538986_2539958_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|2539969_2541547_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|2541612_2542599_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|2542930_2544040_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|2544145_2545330_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|2545407_2547396_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|2547604_2547760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|2548017_2548317_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|2548587_2548770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2548826_2549192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|2550108_2551515_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|2551532_2552519_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|2552521_2553676_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|2553672_2554368_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|2554502_2555993_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|2556013_2557063_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|2557129_2558524_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|2559402_2561334_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|2561338_2561869_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|2561903_2562098_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|2562140_2562500_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|2562919_2563915_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_036777440.1|2563927_2566309_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|2566314_2566602_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|2566873_2567350_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|2567494_2567692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2567816_2568791_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|2569691_2569790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|2570274_2571564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|2571800_2572493_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|2572534_2573308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|2573309_2574251_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|2574383_2575961_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|2576170_2577928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274711.1|2578476_2579235_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_032126625.1|2579442_2580015_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|2580118_2580667_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|2580968_2581214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|2581242_2581539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|2581806_2582730_-	hypothetical protein	NA	NA	NA	NA	NA
2583038:2583097	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_054300506.1|2583208_2583616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2583687_2584416_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_032126799.1|2584496_2585309_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_129556452.1|2586429_2586777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|2586779_2588519_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|2588920_2589184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|2589855_2590584_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|2590613_2591291_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|2591463_2591709_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300501.1|2591920_2592649_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|2593009_2593786_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|2593997_2594165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|2594139_2594739_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|2595508_2596237_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|2596311_2599656_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|2600272_2601001_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|2601296_2602025_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|2602181_2602766_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|2602769_2603453_-	Fic family protein	NA	NA	NA	NA	NA
WP_054300201.1|2603934_2604663_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155764079.1|2604692_2605367_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	6.8e-27
WP_054300202.1|2605569_2606298_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2606600_2606780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047061.1|2606924_2607191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2607451_2608186_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2608182_2609175_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2609661_2609880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2609879_2610479_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2610475_2610724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2610807_2611536_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|2612242_2613523_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|2613522_2614491_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|2614862_2615102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|2615094_2615448_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|2615748_2616351_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|2616355_2616814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377362.1|2617121_2617724_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.8	1.5e-09
2617000:2617288	attR	AAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTGTGATTTGGTATTTATATGGATTAAATAAGAATAAATAGAACTCTGTTAAGTGGTAAGATAATGAATATTATATCATCTTTATTTAGATTTTCAGATACTAGTGATAGTATTTTTTCTAAAAATAGAAAAGATACTTACAAATACTCTGGATTACTTCTCACTATTTATATTTCAACAGTGATCATTACTCAAGTCTTAGCTGTTAGAATTACTAGCCTGGCTGGAGT	NA	NA	NA	NA
WP_036781052.1|2618190_2618793_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|2619172_2619475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|2619589_2619856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|2619963_2620407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2620468_2621354_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|2621454_2622516_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104771.1|2622869_2623208_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|2623200_2623548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|2623544_2623775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274718.1|2623778_2624249_+	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	64.3	1.3e-32
WP_075274740.1|2624393_2624759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|2624903_2625158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|2625141_2625498_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|2625803_2626670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|2627155_2627356_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_054300202.1|2627470_2628199_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|2628693_2629131_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|2629560_2630949_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|2631391_2632885_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|2633086_2633836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|2633879_2634848_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|2634801_2635497_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_054300202.1|2635898_2636627_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211663.1|2636720_2637386_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_016211661.1|2637450_2638407_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	1.4e-33
WP_032126810.1|2638665_2639364_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211662.1|2639406_2640519_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075273327.1|2641123_2641699_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2641644_2642010_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|2642097_2642448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2643183_2644245_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2705035	2806316	3046533	tRNA,plate,protease,transposase	Prochlorococcus_phage(16.67%)	107	NA	NA
WP_016209523.1|2705035_2706385_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|2706435_2706873_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_075274721.1|2707134_2708646_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|2708651_2709878_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2709871_2710900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2710877_2711570_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|2711574_2713044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|2713036_2713525_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|2713530_2715003_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|2715002_2715401_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|2715397_2717086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|2717067_2718024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|2718066_2718582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|2718686_2719619_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|2719838_2720225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|2720241_2720886_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|2721066_2721906_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|2721981_2722584_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|2722584_2723439_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|2723795_2724107_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|2724131_2725523_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|2725678_2726410_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_054300558.1|2726406_2726934_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|2726965_2727523_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|2727528_2728509_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|2728648_2729449_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|2729452_2730220_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|2730216_2730681_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|2730703_2731357_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|2731360_2731708_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|2731741_2731993_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|2732068_2733337_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|2733339_2734098_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|2734159_2735050_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|2735100_2735784_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|2735869_2736127_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075274722.1|2736399_2738553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|2738544_2739417_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|2739584_2741414_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|2741576_2742218_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|2742459_2742990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|2743007_2743181_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|2743239_2744289_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|2744295_2745246_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|2745299_2746244_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|2746271_2747009_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|2747097_2747340_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|2747414_2748638_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|2748669_2749518_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|2749514_2750567_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|2750687_2751308_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_054300218.1|2751323_2752355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2752398_2753373_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007004.1|2753526_2753982_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2753941_2754280_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2755072_2755978_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|2756024_2757086_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|2757135_2757345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|2758579_2759026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2759029_2759605_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2759550_2759916_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|2760036_2760222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|2760325_2761360_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|2761356_2762067_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|2762541_2763060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|2763177_2763510_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_054300220.1|2763539_2766494_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054300221.1|2766539_2767037_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|2767096_2767513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|2767604_2768465_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|2768547_2769114_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|2769146_2770001_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_054300222.1|2770042_2772949_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|2773009_2773207_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|2773213_2774224_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|2774220_2775279_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|2775272_2776073_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|2776075_2776894_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|2776905_2777853_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|2777860_2779162_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|2779340_2780444_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|2780440_2780833_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|2780844_2782221_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|2782214_2783684_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_054300223.1|2783875_2784847_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_155046715.1|2785111_2785357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2786319_2786739_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|2786845_2787019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|2787245_2787980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2788104_2789166_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|2789488_2790193_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|2790286_2791000_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|2791082_2792174_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_054300226.1|2792245_2792827_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|2792832_2793459_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|2793555_2794491_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|2794850_2795522_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|2795663_2796323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|2796491_2797751_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|2797747_2798833_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|2798825_2799707_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|2799695_2800946_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046988.1|2802231_2802600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764083.1|2802615_2803293_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300228.1|2803270_2804524_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|2805429_2805795_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2805740_2806316_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2841680	2887123	3046533	tRNA,transposase	Staphylococcus_phage(42.86%)	35	NA	NA
WP_054300232.1|2841680_2843132_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|2843167_2844697_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300233.1|2845272_2846916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2847457_2848399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|2848749_2849565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|2849856_2852547_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|2852795_2854016_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2854183_2855890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|2856488_2857715_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|2858285_2859260_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273456.1|2859382_2859682_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2859641_2860097_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300559.1|2860977_2861526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2862241_2862607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2862552_2863128_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2863154_2864216_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273458.1|2864268_2864484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300238.1|2864756_2865035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2865331_2865832_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|2866034_2867291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|2867647_2868061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274726.1|2868370_2869255_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|2869511_2869715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2870014_2870989_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2871291_2872764_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2872783_2873758_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|2873908_2874184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2874349_2874970_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|2875288_2877265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|2877420_2878878_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|2878946_2880527_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|2880567_2881104_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|2881149_2885046_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|2885052_2885376_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|2886061_2887123_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013773	Piscirickettsia salmonis strain PM37984A, complete genome	3046533	2903804	3029010	3046533	integrase,protease,transposase	Staphylococcus_phage(13.33%)	110	2951519:2951578	2966606:2966781
WP_054300245.1|2903804_2904680_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|2904935_2905580_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|2905610_2907416_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2907439_2908015_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|2908559_2909570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2909867_2910842_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155046989.1|2911074_2912139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274727.1|2912231_2913194_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	2.6e-27
WP_155046989.1|2913426_2914491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2914981_2915347_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2915361_2915868_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|2915857_2916517_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|2916935_2917955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|2918413_2919379_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|2919423_2919999_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|2920029_2921304_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|2921949_2922663_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|2922742_2923480_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|2923600_2924956_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|2925132_2925804_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|2925919_2926795_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|2927398_2928703_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2928815_2929421_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|2929502_2930804_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|2930871_2933304_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|2933407_2933680_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|2933762_2935661_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|2935692_2936577_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|2936585_2936981_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|2937408_2939556_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|2939527_2940877_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|2940873_2942994_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|2942990_2944694_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|2944812_2945955_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|2946019_2947048_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_075274728.1|2947174_2948689_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|2948778_2949264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274729.1|2949596_2950664_+|transposase	transposase	transposase	NA	NA	NA	NA
2951519:2951578	attL	GTTCCAACGTAATAGGTGTCTTGGGAGCCGAGATAGCCTGGGTGTTCAGTCTCAATTTCT	NA	NA	NA	NA
WP_051307360.1|2951719_2952649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|2953740_2954547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2954889_2956782_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|2957068_2957473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|2958336_2959035_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|2959015_2959321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2961175_2962126_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_155764084.1|2962112_2962253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274730.1|2962327_2962621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|2962626_2963523_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|2963876_2964557_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|2964620_2965211_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|2965413_2965692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|2965684_2965957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2966049_2967132_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
2966606:2966781	attR	GTTCCAACGTAATAGGTGTCTTGGGAGCCGAGATAGCCTGGGTGTTCAGTCTCAATTTCTCCATGTGCTTCTTTTTCTTGTTTTGCTTTCTCAAGTGCTTGCAGTTGCTCTTCCGTCAGCAAAATTCCATCTTGTGCTGATTTGGCTTCAAGCGCTTTGAGCCTCTTCTTGAACGT	NA	NA	NA	NA
WP_036780532.1|2967234_2968275_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|2968786_2974261_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|2974481_2974781_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_105962625.1|2974965_2975851_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2976040_2977102_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|2977121_2977511_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|2977781_2978864_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|2979074_2979560_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|2979627_2980536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300257.1|2980812_2981622_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_075273486.1|2981598_2982573_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|2982807_2983365_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_054300258.1|2983426_2984206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2984303_2984657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2984723_2984918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|2984933_2985278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2985347_2985923_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2985868_2986234_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273488.1|2986318_2986954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|2987009_2987408_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|2988219_2989338_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|2989759_2989906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2990603_2991158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2991594_2991777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2991841_2992069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|2992299_2993046_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|2993272_2993566_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|2993637_2994243_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|2994391_2995369_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_054300261.1|2995465_2996908_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|2996934_2997588_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|2997712_2998279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|2998633_3000412_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|3000483_3002190_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|3002181_3002472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307332.1|3002519_3002726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|3002934_3003300_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3003245_3003821_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|3003824_3004199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3004574_3005549_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300263.1|3005620_3006061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|3006048_3006387_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|3006531_3006792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|3006751_3007090_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|3007562_3009023_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|3009366_3010809_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|3011791_3013084_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300560.1|3013557_3016230_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.2	4.1e-75
WP_032126554.1|3016249_3017335_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|3017776_3018214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|3018210_3019095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|3019184_3019715_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|3019785_3020964_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_054300267.1|3021112_3024961_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|3024947_3026450_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|3027000_3027636_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_054300173.1|3027948_3029010_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013774	Piscirickettsia salmonis strain PM37984A plasmid p1PS4, complete sequence	138636	0	107807	138636	transposase,integrase	Streptococcus_phage(23.81%)	119	32788:32847	90547:91499
WP_016211912.1|891_1482_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|1754_2015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|2018_2291_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|2616_3738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|4170_4569_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|4577_5731_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212499.1|6729_7104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|7308_7482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|7729_8179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|8171_8336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|8636_9263_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_075273790.1|9252_9555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|10099_11125_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300590.1|11741_11966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556699.1|12273_12474_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|12467_12803_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|13368_13632_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_075273796.1|14186_14990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|15744_15969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|16369_17110_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|17157_17586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273802.1|17919_18648_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_075273804.1|18732_19071_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|19030_19486_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273806.1|19591_20155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273808.1|20416_20941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|20980_21484_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081377348.1|21798_22548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273810.1|22855_23563_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_129556718.1|23549_24735_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_054300276.1|25872_26847_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_075273812.1|26843_27401_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.6e-08
WP_032126362.1|27346_27712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273814.1|29059_29521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|29783_30620_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|30945_32172_+	hypothetical protein	NA	NA	NA	NA	NA
32788:32847	attL	AACCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTC	NA	NA	NA	NA
WP_054300271.1|32826_33801_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
32788:32847	attL	AACCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTC	NA	NA	NA	NA
WP_016212260.1|33958_34231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|34250_34475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|34811_35015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|35011_35182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|35368_36451_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|36607_37108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|37209_37467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047012.1|37535_38543_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	6.5e-58
WP_032126362.1|38503_38869_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|38814_39390_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075273824.1|39393_39648_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273826.1|39607_40735_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|40955_41102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|41431_42247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|42492_43083_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|44037_45057_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|45069_45951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|45980_46709_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075274743.1|46911_49488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047021.1|49782_49938_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|49961_50690_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273830.1|50719_51052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047014.1|51122_51464_-	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_054300202.1|51619_52348_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075274744.1|52554_53388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273836.1|53463_54525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046765.1|55402_55597_+	hypothetical protein	NA	NA	NA	NA	NA
54526:55480	attR	AACCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCC	NA	NA	NA	NA
WP_155047015.1|55977_56301_-|transposase	transposase	transposase	NA	NA	NA	NA
54526:55480	attR	AACCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCC	NA	NA	NA	NA
WP_016212122.1|57177_57879_+	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_016212121.1|57832_58756_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_105962625.1|59189_60075_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
WP_016212151.1|60677_61640_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016212150.1|61663_61978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|62041_63016_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_033923686.1|63140_64190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211885.1|64298_65339_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_129556706.1|65352_65982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211884.1|66072_66372_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211886.1|66368_66797_-	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_052104769.1|67794_68718_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_129556707.1|69032_70052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|70433_71587_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300202.1|71653_72382_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_016212014.1|72479_72893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|73296_73524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927838.1|73553_73799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|73795_74095_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_016212019.1|74251_74947_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_081377351.1|75760_76540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|76623_76776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126739.1|76728_77061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|77225_77603_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_016212152.1|77909_78293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273842.1|78762_79491_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_036781349.1|79606_79933_-	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_016212365.1|79934_80177_-	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_075274745.1|80889_81618_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	1.2e-37
WP_075274746.1|81900_83511_+	protein kinase	NA	NA	NA	NA	NA
WP_129556709.1|83722_83812_+	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_129556710.1|83892_84363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|84516_85251_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_016212404.1|86315_86549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273881.1|86669_88856_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_036779532.1|88865_89267_-	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_016212456.1|89263_89551_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_054300271.1|89594_90569_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212579.1|91168_91366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|92871_93072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274749.1|93841_95884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|96788_97154_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274751.1|97099_97675_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_075274752.1|97671_97971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556718.1|97994_99180_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273747.1|99383_99974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377367.1|100235_100535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|100588_100882_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081377368.1|100998_101430_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.5	5.7e-19
WP_075273741.1|101466_102201_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273749.1|102347_103073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|103562_103715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274753.1|103727_105458_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_081377369.1|107078_107807_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.4	4.6e-37
>prophage 2
NZ_CP013774	Piscirickettsia salmonis strain PM37984A plasmid p1PS4, complete sequence	138636	116708	123180	138636	head,transposase,capsid,tail	Acinetobacter_phage(16.67%)	9	NA	NA
WP_105962623.1|116708_117862_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273762.1|117927_119199_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-22
WP_052047108.1|119254_119653_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|119786_120077_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
WP_016210655.1|120090_120687_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273766.1|121137_122199_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273768.1|122202_122472_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.3	2.2e-05
WP_016210667.1|122468_122792_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|122784_123180_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
>prophage 1
NZ_CP013775	Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence	36081	0	412	36081		Yersinia_phage(100.0%)	1	NA	NA
WP_016211139.1|16_412_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
>prophage 2
NZ_CP013775	Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence	36081	4529	9747	36081	tail	Moraxella_phage(50.0%)	4	NA	NA
WP_016210666.1|4529_5201_+|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	32.7	3.0e-27
WP_032126911.1|5169_5916_+	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	42.9	1.7e-42
WP_054300696.1|5905_6463_+|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	1.3e-20
WP_054300695.1|6459_9747_+	host specificity protein J	NA	A0A0R6PIC0	Moraxella_phage	33.2	5.2e-112
>prophage 3
NZ_CP013775	Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence	36081	14051	17555	36081	transposase	unidentified_phage(50.0%)	3	NA	NA
WP_054300276.1|14051_15026_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_054300690.1|15231_15495_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_054300689.1|16562_17555_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	1.7e-10
>prophage 4
NZ_CP013775	Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence	36081	20828	23395	36081	transposase	Enterobacterial_phage(50.0%)	3	NA	NA
WP_054300685.1|20828_21182_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	8.5e-13
WP_081007088.1|21276_22086_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_054300162.1|22312_23395_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 5
NZ_CP013775	Piscirickettsia salmonis strain PM37984A plasmid p2PS4, complete sequence	36081	31072	35785	36081	transposase,tail,head	Staphylococcus_phage(50.0%)	5	NA	NA
WP_054300681.1|31072_31573_+	hypothetical protein	NA	A0A1W6JQ30	Staphylococcus_phage	42.7	8.1e-17
WP_155046942.1|31909_32796_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_054300680.1|32822_33503_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.0e-09
WP_016211133.1|33948_35283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|35473_35785_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
>prophage 1
NZ_CP013776	Piscirickettsia salmonis strain PM37984A plasmid p3PS4, complete sequence	36245	13315	21214	36245	transposase,terminase,tail,capsid,head,portal,protease	Enterobacteria_phage(28.57%)	9	NA	NA
WP_075274763.1|13315_13711_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|13703_14027_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|14023_14335_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|14654_15236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300591.1|15271_16465_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	39.5	2.6e-69
WP_081007077.1|16519_17191_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_054300593.1|17138_18380_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	43.6	2.7e-85
WP_054300392.1|18451_19513_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377377.1|19531_21214_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	46.0	6.3e-138
