The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	48130	100222	3042830	transposase,tRNA	uncultured_Mediterranean_phage(40.0%)	52	NA	NA
WP_054300392.1|48130_49192_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300393.1|49735_50317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300394.1|50279_50642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|50772_51501_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|51620_51899_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_075273590.1|51902_52478_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|52423_52591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|52831_53077_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047008.1|53134_53449_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|53466_56313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|56822_57773_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|57855_58635_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|58703_59411_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|59371_59623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|59645_59942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|60475_61249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|61281_61878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|61934_62816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273592.1|63191_64166_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_054300399.1|64264_64531_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|64675_64918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|64974_65502_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|66167_66362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|66575_66929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|67260_67542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|67921_68110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300402.1|68144_72290_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|72489_73623_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|73636_73825_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300403.1|74117_75092_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_075273594.1|75131_76502_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|76574_77468_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|77576_78494_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|78545_79301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|79368_80643_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|80777_81455_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|81655_83083_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|83057_83696_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|83905_84184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|84417_85362_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|85383_87252_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|87272_87626_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|87664_88780_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|88962_90003_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|90005_91040_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|91036_92098_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|92209_93682_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|93834_94278_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|94353_97125_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|97281_98511_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|98537_99200_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|99721_100222_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	108207	171517	3042830	transposase,tRNA	Acinetobacter_phage(15.38%)	50	NA	NA
WP_054300173.1|108207_109269_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|109329_109671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|109975_111129_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212005.1|112029_113790_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_016210592.1|114179_114836_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|114848_116354_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|116375_116906_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|116985_118248_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_016210587.1|118422_119283_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_032126176.1|119384_120167_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|120257_121583_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|121950_123129_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|123305_123959_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_036778626.1|124094_126035_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_129556498.1|126031_126640_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|126819_127794_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273597.1|128065_129910_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046942.1|129899_130786_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|130931_133862_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|133994_135947_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|136139_136787_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|136842_138168_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|138197_138449_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|138406_138988_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|139324_139981_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|140031_140397_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|140342_140918_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|142139_142583_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|143007_143496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|143602_144571_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209820.1|145272_148572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|148630_149668_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|149872_151786_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|151842_152490_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|152625_153750_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|153746_154343_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|154373_154706_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|154795_156619_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_054300409.1|157065_158778_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|159095_159635_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|160021_160438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|160533_161349_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|161481_162975_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|163153_163576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|163575_165630_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|165914_166730_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209824.1|166830_167649_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|167645_168014_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016212343.1|169318_170125_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|170363_171517_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 3
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	178034	224136	3042830	transposase,tRNA	Bacillus_phage(20.0%)	50	NA	NA
WP_032126637.1|178034_178328_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|178558_179422_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|179555_179921_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|179866_180442_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|181088_182288_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|182540_182828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|182883_184893_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|184947_185907_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|186054_186837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|186992_187709_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|187722_189114_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|189155_192143_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|192212_193046_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|193099_194266_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|194253_194964_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|195003_195789_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|195816_196560_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|196657_198853_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|198919_199603_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|199613_200045_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|200084_200483_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|200855_201563_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|201627_201930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|201985_202462_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|202516_203038_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|203119_204214_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|204450_204765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|204909_205320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300414.1|205590_206076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|206739_207441_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|207574_208291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|208427_209675_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|210053_210665_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|210761_211628_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|211631_212393_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|212556_213462_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|213684_214515_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|214684_215074_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300416.1|215206_216157_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|216451_216772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300417.1|216883_217858_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046958.1|218242_218803_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|218748_219114_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|219074_220073_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300421.1|220050_220896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300422.1|220946_221384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|221654_222035_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300423.1|222109_223171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|223218_223539_-	histidine kinase	NA	NA	NA	NA	NA
WP_052047048.1|223635_224136_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	254070	296307	3042830	transposase,protease,tRNA	Bacillus_thuringiensis_phage(20.0%)	44	NA	NA
WP_081007004.1|254070_254526_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|254485_254824_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|255036_255966_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|256122_256551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|256631_257168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|257137_258043_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|258211_258820_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|258860_259436_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|259381_259549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|259654_260807_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|261013_261625_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_017377024.1|262937_263078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|263090_263495_-	SufE family protein	NA	NA	NA	NA	NA
WP_155046954.1|263649_263823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|263929_264247_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|264206_264509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|264653_264839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|265408_265990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|266017_267151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|267414_267942_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|268263_268893_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300433.1|269192_269423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556650.1|269752_270727_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|271155_271869_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|272037_272529_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|272672_273164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|273366_274257_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|274423_275023_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|275103_276042_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|276093_277188_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104599.1|277312_278629_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|278683_283573_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|283665_283968_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|284078_286001_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|286022_287318_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|287314_288925_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|289031_289925_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|290034_290658_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|290734_290935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|291076_291775_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|291921_292491_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|292805_293429_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|293637_294240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|295420_296307_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	299686	419911	3042830	transposase,tRNA	Staphylococcus_phage(23.81%)	117	NA	NA
WP_054300357.1|299686_300562_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|300610_301027_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|301313_302156_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|302206_302554_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|302744_303632_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|303746_304349_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|304345_305065_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_054300435.1|305133_306846_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_036777098.1|306993_308931_+	AsmA family protein	NA	NA	NA	NA	NA
WP_016210461.1|310090_310366_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|310446_310995_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_054300436.1|311311_313903_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016210459.1|314067_314586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285947.1|314790_315909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|316156_317080_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075273319.1|317093_317348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126595.1|317963_318620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|318922_319750_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|320190_320562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|320754_322287_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|322349_323687_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|323829_325296_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|325292_326342_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_054300438.1|326465_328580_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|328744_329149_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|329209_329935_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|330020_330911_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|330951_331572_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|331632_331839_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|331860_334014_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|334020_336003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046953.1|336274_336415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|336423_337577_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300440.1|337873_339085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|339229_339592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155083637.1|339873_341955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|342664_343588_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|343826_344105_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|344157_344406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|344363_345425_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|345845_345998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|346420_346594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212174.1|346670_346928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212205.1|348613_348793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|348932_350378_+	MFS transporter	NA	NA	NA	NA	NA
WP_036781320.1|351224_351452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|351438_351765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|351766_352198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|352726_353788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|353882_354434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|354703_355723_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|355709_356132_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|356133_356607_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|356722_357346_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|357375_358050_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|358055_359204_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|359200_359662_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|359737_360988_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|361114_362794_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|362903_363770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300446.1|365200_365935_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_036781250.1|366030_366816_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155046951.1|367622_367886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211002.1|367967_368366_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|368529_368835_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|368912_369167_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|369320_370982_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|371041_371725_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|371724_372813_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_054300447.1|372861_375498_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|375910_376972_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|377161_379531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|379574_380549_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300449.1|380568_381348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|381476_381815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|381774_382230_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300450.1|382555_383875_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|383878_384595_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|384591_385233_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|385225_385324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007049.1|385301_385598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|385608_386064_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|386118_386463_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|386492_387536_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|387949_388159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|388148_389035_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126474.1|389416_389866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|390237_390399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|390455_390803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|390837_391500_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|391543_392149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|392378_393434_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|393437_396623_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|396703_397660_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|397708_398245_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|398241_399003_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|399108_401697_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|402159_402810_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|403029_403905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|404095_404497_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|404513_405065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|405376_406063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764027.1|406063_406657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273325.1|406884_408273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|408626_408980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|408937_409999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046950.1|410048_410303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|410292_410868_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|410813_411179_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300454.1|411280_411631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|411620_412127_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|412141_412507_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273329.1|412467_413769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|413816_414878_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|415065_416355_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|416515_417577_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|417847_419911_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 6
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	476882	531563	3042830	transposase,tRNA	Pseudomonas_phage(14.29%)	49	NA	NA
WP_075273298.1|476882_477458_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|477515_477908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|478037_478403_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|478459_478768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|478859_479435_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|479380_479746_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|479898_480171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|481067_481403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|481562_483095_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|483127_483967_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|483963_484461_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|484464_485457_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|485571_486918_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|487141_488203_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|488281_489427_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|495238_496096_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|496082_497006_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|497202_498594_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|498640_499684_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|499726_500170_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|500302_501493_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|501547_501694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|502244_503162_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|503429_503723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|503799_503994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|505012_505930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|506395_507238_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|507305_507956_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|507970_509011_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|509133_510219_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|510245_511355_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|511371_511689_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|511685_512045_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|515376_516330_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|516402_517464_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|518227_518785_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|518978_519662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|520380_520623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300464.1|520649_521711_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377041.1|522791_523121_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_032126658.1|523355_524060_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_016211063.1|524040_526269_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_016211066.1|526431_527445_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211065.1|527542_527764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126660.1|527768_529406_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211058.1|529544_530078_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|530198_530552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|530613_530979_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007050.1|531035_531563_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	609959	826851	3042830	transposase,integrase,protease,tRNA	Escherichia_phage(35.09%)	205	636887:636946	700625:701233
WP_054300202.1|609959_610688_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210945.1|612375_612966_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|613092_614478_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|614572_614770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|614863_615682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|616188_616566_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|616578_616815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|616814_617021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|617203_617923_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|618011_619796_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|619894_620149_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|620505_621117_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|621604_622333_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211812.1|622538_624152_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|624193_624547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|624559_624859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|625075_625804_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|625980_627078_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|627111_628362_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|628501_629230_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|629352_629691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|629758_630145_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|630141_630387_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|630795_631524_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|632007_632877_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|632873_634223_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|634335_635976_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300477.1|636698_637427_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
636887:636946	attL	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGA	NA	NA	NA	NA
WP_054300478.1|637706_639443_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|639604_639802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|639946_640675_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|640833_641334_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|641308_641818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|642417_643146_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|643296_644337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|644534_645560_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|645667_646873_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|647132_647546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|647674_648244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|648247_648580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|648572_649412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|649499_651134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|651495_651999_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|651961_652669_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|652737_653598_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|653578_654352_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|654382_655636_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|655635_656598_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|656641_657394_+	ComF family protein	NA	NA	NA	NA	NA
WP_155046731.1|658929_659814_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210615.1|660721_661192_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|661237_661477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|661495_661945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|662165_663590_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|663654_664704_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|664970_665750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|665766_666342_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|666287_666653_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556587.1|666752_667655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|667713_668460_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|668708_671519_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|671753_672614_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_054300481.1|672715_673444_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|673533_673740_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|673902_675135_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|675650_676940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|676969_677698_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_036780093.1|677801_678623_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_081007055.1|682179_683187_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|683360_684458_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|684447_685968_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|686030_686621_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_054300483.1|687156_687711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|688207_689155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|689379_689529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|689673_689919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|690056_690224_-	phosphatase	NA	NA	NA	NA	NA
WP_016212294.1|690653_690998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|691011_691464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|691460_691679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|691985_692195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|692496_692706_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|694030_694447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|694504_695657_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_075278605.1|695713_696289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764045.1|696252_697164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|698694_698883_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|700284_700560_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|700562_701165_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|701261_701516_+	hypothetical protein	NA	NA	NA	NA	NA
700625:701233	attR	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
WP_016211876.1|702060_703140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211874.1|703458_705177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|705220_706126_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046944.1|706596_706734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210068.1|707920_708496_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|708571_709447_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|709511_710033_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|710017_711100_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|711340_711745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|712169_712901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|713157_714459_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|714600_715269_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|715712_716309_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|716329_717526_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_016210064.1|717650_719015_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210075.1|719011_720103_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210065.1|720356_721016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210057.1|721156_721666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126424.1|721674_722499_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210061.1|722511_723156_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_036778098.1|723145_723985_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210074.1|723990_724617_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_016210053.1|724778_725321_+	septation protein A	NA	NA	NA	NA	NA
WP_016210060.1|725404_725707_+	YciI family protein	NA	NA	NA	NA	NA
WP_032126423.1|725703_725967_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210070.1|726060_726333_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_016210055.1|726371_727010_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_032126421.1|727277_728369_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300491.1|728572_730333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|731008_733333_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_016210675.1|733500_734217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210677.1|734296_734911_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210672.1|734903_736286_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_036778297.1|736294_736768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210671.1|736900_738160_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_016210676.1|738615_740697_+	kinase domain protein	NA	NA	NA	NA	NA
WP_054300492.1|741000_742011_+	protein kinase	NA	NA	NA	NA	NA
WP_054300493.1|742169_742382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|742443_742809_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|742754_743330_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211905.1|743660_744071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|744314_744737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046943.1|744769_744910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|746679_747566_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556590.1|748249_748645_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|748641_749436_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|749614_750340_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|750585_751773_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375910.1|752104_752833_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212269.1|753314_753998_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|754001_754586_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|754742_755471_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|755856_756742_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|757675_758404_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|759020_762365_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|762439_763168_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|764066_764795_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300500.1|765323_766052_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|766461_767061_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|767035_767203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|767414_768191_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|768551_769280_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|769291_769684_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|769680_769926_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300502.1|770098_770776_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_054300500.1|770805_771534_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_155046941.1|772205_772469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|772870_774610_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_129556452.1|774612_774960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126799.1|776080_776893_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_054300481.1|776973_777702_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300506.1|777773_778181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|778659_779583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|779850_780147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210487.1|780175_780421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210475.1|780722_781271_-	DUF2058 family protein	NA	NA	NA	NA	NA
WP_032126625.1|781374_781947_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210486.1|782154_782913_+	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_016210484.1|783461_785219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210482.1|785428_787006_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210485.1|787138_788080_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210472.1|788081_788855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|788896_789589_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_054300507.1|789825_791115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273615.1|791599_791698_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|792598_793573_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300509.1|793697_793895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133265.1|794039_794516_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|794787_795075_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_036777440.1|795080_797462_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211706.1|797474_798470_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_016210495.1|798889_799249_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016210493.1|799291_799486_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|799520_800051_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210489.1|800055_801987_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_016210496.1|802865_804260_+	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210494.1|804326_805376_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210500.1|805396_806887_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210502.1|807021_807717_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210490.1|807713_808868_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210501.1|808870_809857_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_032126128.1|809874_811281_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_032126362.1|812197_812563_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300510.1|812619_812802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|813072_813372_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210644.1|813629_813785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210649.1|813993_815982_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210650.1|816059_817244_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_054300512.1|817349_818459_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_129556624.1|818790_819777_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_122940481.1|821430_822402_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210643.1|822537_823107_-	elongation factor P	NA	NA	NA	NA	NA
WP_051307335.1|823155_824190_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_129556623.1|824211_825771_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_054300513.1|825987_826851_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	941287	1062248	3042830	transposase,tail,protease,tRNA	Acinetobacter_phage(29.41%)	110	NA	NA
WP_075273298.1|941287_941863_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|941808_941976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|942216_942462_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126495.1|942867_943752_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_016212128.1|943842_944589_-	solute symporter family protein	NA	NA	NA	NA	NA
WP_016210870.1|945502_946294_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|946445_946691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210861.1|946842_947073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210859.1|947098_947878_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210868.1|947909_948209_-	pilZ domain protein	NA	NA	NA	NA	NA
WP_032126490.1|948205_949171_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_129556441.1|949519_950746_+	MFS transporter	NA	NA	NA	NA	NA
WP_105962623.1|953796_954950_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212102.1|956460_958101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211029.1|958274_958637_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016211023.1|958850_959285_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211034.1|959295_959475_-	rubredoxin	NA	NA	NA	NA	NA
WP_032126377.1|959591_960593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|960758_962051_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_016211032.1|962162_962960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211031.1|963269_963749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300525.1|963913_966001_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_075273367.1|966009_966786_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|967078_967483_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_105962174.1|967581_967746_+	phosphatase	NA	NA	NA	NA	NA
WP_054300526.1|967894_968191_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|968299_969115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211607.1|969297_969522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|969550_970081_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211605.1|970297_970531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300527.1|970644_972831_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	3.5e-141
WP_016211609.1|972863_973172_-	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126362.1|974042_974408_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|974353_974929_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210634.1|975179_975911_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_016210629.1|975907_976444_-	tim44-like domain protein	NA	NA	NA	NA	NA
WP_032126367.1|976497_977262_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210636.1|977265_978843_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_016210637.1|978849_979326_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|979301_979757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210633.1|979762_980518_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|980692_980980_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210640.1|981365_981590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779423.1|982054_983218_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126366.1|983256_984234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|984227_984914_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_016210630.1|984852_985968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300529.1|986248_986650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046937.1|986821_987707_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046703.1|987711_987849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126861.1|988042_988357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278607.1|988560_990411_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_105962623.1|990481_991635_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046935.1|991927_992350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|992391_993545_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300162.1|995047_996130_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155046934.1|996503_996674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|997037_998099_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211359.1|998151_998556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211354.1|999085_1001047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211355.1|1001144_1002254_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211357.1|1002316_1003798_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211358.1|1004221_1004683_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_054300534.1|1004730_1004931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300535.1|1005075_1005795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|1005798_1006374_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1006319_1006685_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211800.1|1007381_1008167_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_036778206.1|1008163_1009147_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211802.1|1009203_1010475_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_155046933.1|1015907_1016585_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016210096.1|1016858_1018220_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_016210097.1|1018493_1019774_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_054300536.1|1019791_1020448_+	DedA family protein	NA	NA	NA	NA	NA
WP_016210082.1|1020498_1021548_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_016210083.1|1021702_1022557_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_122940784.1|1022861_1023668_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|1023774_1024068_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_016210084.1|1024227_1025064_-	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_032126605.1|1025053_1025731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210086.1|1025699_1026755_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_016210077.1|1027087_1028518_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210094.1|1028504_1029131_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210081.1|1029136_1029409_-	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210093.1|1029494_1031288_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_080664831.1|1031603_1033166_+	APC family permease	NA	NA	NA	NA	NA
WP_016210095.1|1033268_1033964_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016210079.1|1034134_1034632_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032126362.1|1037637_1038003_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1037948_1038524_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209867.1|1038520_1038700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209864.1|1038723_1040118_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_032126611.1|1040160_1041447_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209858.1|1041493_1043038_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_016209851.1|1043159_1043402_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209854.1|1043394_1044381_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209870.1|1044442_1045348_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209862.1|1045347_1046694_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209852.1|1046786_1047251_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_036776911.1|1047315_1047771_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209850.1|1047995_1048286_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209875.1|1048358_1050020_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209859.1|1050183_1050405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300537.1|1050683_1051091_-	glyoxalase	NA	NA	NA	NA	NA
WP_016209866.1|1051122_1052097_-	phospholipase A	NA	NA	NA	NA	NA
WP_016209860.1|1052242_1053664_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209857.1|1053833_1055753_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209874.1|1055776_1058446_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209869.1|1058712_1060056_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209871.1|1060265_1062248_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 9
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1140615	1203914	3042830	transposase,protease	Hokovirus(14.29%)	56	NA	NA
WP_129556618.1|1140615_1141713_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	5.3e-21
WP_032126222.1|1142078_1142957_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.5	1.2e-39
WP_016209597.1|1142964_1143195_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_122940232.1|1143248_1144229_-	OmpA family protein	NA	NA	NA	NA	NA
WP_122940262.1|1144459_1145275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126221.1|1145368_1146769_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_016209584.1|1147043_1148441_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	1.8e-50
WP_016209607.1|1148538_1149465_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.6	3.9e-57
WP_016209602.1|1149465_1150722_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016209596.1|1150721_1151813_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016209578.1|1151812_1153171_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_016209593.1|1153170_1154025_-	glycosyltransferase family 2 protein	NA	A0A167RG86	Powai_lake_megavirus	30.8	5.4e-05
WP_016209582.1|1154056_1155229_-	poly(glycerophosphate) glycerophosphotransferase	NA	NA	NA	NA	NA
WP_016209613.1|1155225_1156614_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_036776538.1|1156641_1157049_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	51.1	2.6e-29
WP_016209609.1|1157068_1158073_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.9	3.3e-78
WP_016209587.1|1158069_1158942_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.0	1.3e-91
WP_122940264.1|1158948_1159818_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.0e-67
WP_122940254.1|1159798_1162054_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_016209606.1|1162070_1163216_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209608.1|1163263_1163746_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126220.1|1163785_1164409_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016212244.1|1170086_1170839_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016212241.1|1170924_1171281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300546.1|1171414_1172011_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155046699.1|1172005_1172578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|1172782_1173355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|1173510_1173723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211251.1|1174042_1174666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211247.1|1174770_1175559_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211245.1|1175558_1176290_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_054300547.1|1176329_1178051_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|1178064_1179126_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211248.1|1179426_1180641_+	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_032126486.1|1180770_1181001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1181050_1182112_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211108.1|1182106_1182475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126370.1|1182804_1183629_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211103.1|1183639_1184338_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016211109.1|1184380_1185127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211105.1|1185119_1185542_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_032126371.1|1185668_1186220_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211100.1|1186275_1187226_-	TonB family protein	NA	NA	NA	NA	NA
WP_032126369.1|1187226_1187454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777711.1|1187643_1188453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|1188432_1189275_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211099.1|1189271_1190516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210706.1|1190654_1191743_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016210697.1|1191760_1192261_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_032126484.1|1192448_1193048_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210700.1|1193053_1194217_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_016210703.1|1194248_1195202_+	glutathione synthase	NA	NA	NA	NA	NA
WP_016210704.1|1200333_1202280_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_155468148.1|1202562_1202991_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377700.1|1203174_1203468_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_081007062.1|1203584_1203914_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
>prophage 10
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1264929	1353086	3042830	transposase,tRNA	Staphylococcus_phage(31.25%)	95	NA	NA
WP_016209326.1|1264929_1266309_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_016209346.1|1266423_1268316_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036776463.1|1268363_1268990_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_016209314.1|1269009_1269894_+	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	1.7e-17
WP_016209349.1|1269926_1270820_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_016209313.1|1270934_1271333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209354.1|1271337_1272153_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|1272204_1272609_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|1272663_1273134_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209332.1|1273145_1273673_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_016209323.1|1273689_1275231_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209322.1|1275256_1276117_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|1276147_1277539_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_016209335.1|1277563_1277992_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209325.1|1278085_1279450_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.5	6.6e-37
WP_036776458.1|1279505_1281341_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-124
WP_155047007.1|1281499_1282105_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075273393.1|1282169_1282877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273395.1|1283021_1283204_-	phosphatase	NA	NA	NA	NA	NA
WP_075273397.1|1283522_1283918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211851.1|1284606_1285263_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273625.1|1285459_1286212_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211852.1|1286270_1286984_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_129556614.1|1287569_1287722_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_122942409.1|1287859_1288291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211924.1|1288650_1288809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|1288964_1289960_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080664873.1|1289854_1290169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126480.1|1290714_1291398_+	methyltransferase	NA	NA	NA	NA	NA
WP_080743040.1|1291444_1292101_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1292159_1293134_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047006.1|1293387_1293528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104719.1|1293934_1295359_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211299.1|1295586_1296528_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032126720.1|1296547_1298542_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211298.1|1298538_1299144_+	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_016211294.1|1299145_1299487_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211297.1|1299487_1300324_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_081007064.1|1300320_1300596_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300271.1|1300635_1301610_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|1301808_1302658_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1302717_1303692_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211791.1|1303764_1304028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211793.1|1304053_1305481_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211790.1|1305477_1306173_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_054300144.1|1307477_1307843_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047004.1|1307857_1308364_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007065.1|1308576_1309416_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212335.1|1309432_1309771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1310865_1311840_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126148.1|1312443_1312626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212051.1|1313167_1313941_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046758.1|1314568_1314700_-	phosphatase	NA	NA	NA	NA	NA
WP_032126637.1|1315547_1315841_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081006998.1|1315957_1316413_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_081006999.1|1316617_1316989_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_016210347.1|1316997_1317255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556610.1|1317555_1318134_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210344.1|1318206_1319106_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080664839.1|1319110_1319737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126693.1|1319681_1322003_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_016210342.1|1322149_1322629_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_016210346.1|1322625_1323777_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210340.1|1323911_1324415_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_032126694.1|1324507_1325467_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_051307328.1|1325438_1326770_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_016210336.1|1326810_1328190_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_129556609.1|1328199_1329648_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|1329673_1330042_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_016210345.1|1330060_1331128_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210335.1|1331160_1332057_-	EamA family transporter	NA	NA	NA	NA	NA
WP_016210351.1|1332053_1332890_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016211230.1|1333025_1333478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211229.1|1333617_1334364_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211234.1|1334344_1334908_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211228.1|1334916_1335432_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211227.1|1335579_1337658_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211231.1|1337657_1338608_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211232.1|1339475_1339874_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_129556608.1|1340100_1340811_-	VUT family protein	NA	NA	NA	NA	NA
WP_129556607.1|1341093_1341543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|1341862_1342171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211866.1|1342620_1342923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126699.1|1343574_1344111_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_036776841.1|1344195_1344735_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_054300148.1|1345174_1346236_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212371.1|1346213_1346846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212372.1|1346961_1347183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047003.1|1347368_1348255_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|1349743_1350076_-	DMT family transporter	NA	NA	NA	NA	NA
WP_075273401.1|1350113_1350566_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046757.1|1350710_1350866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1350922_1351288_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209699.1|1351314_1351911_-	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|1352111_1353086_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 11
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1382485	1416361	3042830	transposase,tRNA	Powai_lake_megavirus(25.0%)	32	NA	NA
WP_036776867.1|1382485_1383883_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_155764046.1|1384253_1384919_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075278609.1|1384881_1385238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1385520_1386096_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1386041_1386407_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300157.1|1387239_1388520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007000.1|1388743_1389832_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1389895_1390261_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300159.1|1390317_1390599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1390602_1390782_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016212386.1|1390972_1391278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278610.1|1391342_1391861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278611.1|1392576_1394733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556603.1|1394916_1396932_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|1397052_1399383_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_032126362.1|1399647_1400013_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1399958_1400534_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556669.1|1401463_1401859_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_016212222.1|1401855_1402329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556668.1|1402876_1404115_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_032126430.1|1404362_1404887_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_016211203.1|1404995_1405994_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_016211205.1|1406080_1406977_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081007001.1|1407049_1408336_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211206.1|1408797_1410114_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211201.1|1410228_1410537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|1410617_1411679_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1411726_1412809_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_129556602.1|1413683_1413893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047000.1|1414097_1414244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300164.1|1414291_1415311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1415386_1416361_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 12
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1598439	1620634	3042830	transposase,protease,tRNA	Staphylococcus_phage(50.0%)	18	NA	NA
WP_054300148.1|1598439_1599501_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046997.1|1600075_1602598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046996.1|1603532_1606046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212310.1|1607076_1607532_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_052104637.1|1607561_1608098_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212085.1|1608153_1608627_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_032126534.1|1608668_1609184_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|1609183_1610200_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300271.1|1610481_1611456_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007003.1|1611828_1612290_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1612249_1612588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212327.1|1612841_1613627_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273416.1|1613687_1614302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210574.1|1614442_1614862_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_016210572.1|1615761_1617519_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|1617640_1618624_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|1618704_1619256_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|1619266_1620634_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
>prophage 13
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1682156	1734366	3042830	transposase,tRNA	Staphylococcus_phage(22.22%)	52	NA	NA
WP_016210756.1|1682156_1684970_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|1684962_1685472_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|1685475_1685919_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_155047233.1|1686007_1686649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273426.1|1686645_1687221_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1687166_1687532_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|1687593_1687776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|1688375_1689653_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|1689933_1690299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|1690290_1691013_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_054300148.1|1691566_1692628_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300188.1|1692873_1694433_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_016210175.1|1694746_1695076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|1695461_1695827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|1695951_1696812_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|1696798_1697578_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|1697653_1698337_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|1698497_1699028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|1699318_1699822_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|1700022_1700277_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|1700778_1701246_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|1701335_1701866_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|1701865_1702390_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_036776947.1|1702552_1703668_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|1703904_1705065_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|1705515_1707519_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|1707587_1708595_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|1708668_1709853_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|1709862_1711317_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|1711347_1712385_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155046995.1|1713069_1713956_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300190.1|1714082_1715045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|1715539_1716496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|1716540_1716762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|1716784_1717006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1717256_1718231_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|1718289_1718610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|1718722_1719373_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|1719474_1720134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|1721207_1721453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|1721544_1722207_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|1722330_1723458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|1724045_1724504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|1724668_1724875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126304.1|1725920_1726265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210983.1|1726502_1728686_+	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_016210981.1|1728701_1729340_-	ribonuclease T	NA	NA	NA	NA	NA
WP_016210987.1|1729369_1730569_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_098082804.1|1730806_1731904_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036778253.1|1732016_1733555_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_075273313.1|1733612_1733951_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1733910_1734366_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1737578	1785131	3042830	transposase,integrase	Escherichia_phage(47.06%)	53	1762457:1762516	1775192:1775451
WP_054300148.1|1737578_1738640_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300194.1|1738617_1739316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|1739393_1739822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|1740171_1740369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|1740611_1741244_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|1741664_1742615_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_054300195.1|1742611_1744144_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|1744140_1744671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|1745005_1745644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|1746058_1746763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|1747054_1747279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|1747782_1748724_-	DMT family transporter	NA	NA	NA	NA	NA
WP_155046994.1|1748993_1750148_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210937.1|1750239_1750521_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|1750606_1751284_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|1751330_1752590_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|1752787_1753837_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|1753915_1754722_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|1754743_1755538_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|1755639_1756659_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_036778484.1|1756705_1757317_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|1757320_1758007_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|1758003_1758546_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_017375910.1|1758932_1759661_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300198.1|1759811_1760141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|1760552_1761281_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212022.1|1761510_1761729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|1761728_1762328_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|1762324_1762573_+	hypothetical protein	NA	NA	NA	NA	NA
1762457:1762516	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046993.1|1762717_1763080_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_054300200.1|1763072_1763651_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_054300201.1|1763952_1764681_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212023.1|1765076_1766069_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|1766065_1766800_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_054300202.1|1767110_1767839_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|1768545_1769826_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|1769825_1770794_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|1771165_1771405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|1771397_1771751_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|1772051_1772654_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|1772658_1773117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1773599_1774175_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1774120_1774486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046992.1|1774446_1774986_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_155764047.1|1775452_1775731_-	hypothetical protein	NA	NA	NA	NA	NA
1775192:1775451	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTTTTAAGATTGCCTTTGATGGGTATTTTTGGAAAGTTATGATAGCTATAATAATATCATTTCCAATGTGGTATATGATAAAATGGCTAAAGAGATCTGAGAAAGTCGATGTTTATGATTACAATACAAACTATAATCCTTTTTCTATTAGAACAATGAAGACAAGTTGATTTGGTAGTTTGTCTTTTAAAAAGAATATG	NA	NA	NA	NA
WP_054300202.1|1775974_1776703_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|1777197_1777635_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|1778064_1779453_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|1779895_1781389_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|1781590_1782340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|1782383_1783352_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|1783305_1784001_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_054300202.1|1784402_1785131_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 15
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1789627	1832069	3042830	transposase,tRNA	Synechococcus_phage(50.0%)	47	NA	NA
WP_075273438.1|1789627_1790203_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1790148_1790514_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|1790601_1790952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1791687_1792749_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|1793960_1794776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|1794866_1795850_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|1796020_1796542_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|1796575_1796827_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|1796832_1798110_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|1798802_1799330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|1799449_1801762_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|1801890_1802706_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|1802903_1803368_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1803497_1804559_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|1804819_1805116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|1805398_1806862_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|1806864_1807917_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|1807906_1808362_+	arginine repressor	NA	NA	NA	NA	NA
WP_155046991.1|1808386_1808710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|1809057_1809369_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|1809498_1810290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1810267_1811329_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779278.1|1811448_1812402_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|1812515_1812713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126198.1|1812958_1813159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|1813269_1813386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|1813472_1813694_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1813720_1814086_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1814142_1814307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|1814296_1814467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|1814423_1814612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|1814749_1814914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|1815208_1816645_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|1816686_1818138_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|1818249_1818537_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|1818726_1819770_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|1819785_1820685_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|1820681_1821200_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_054300211.1|1821269_1821887_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|1821896_1823384_+	ribonuclease G	NA	NA	NA	NA	NA
WP_054300212.1|1823393_1827074_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|1827147_1827960_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|1827956_1828637_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|1829477_1830098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|1830147_1830438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|1831241_1831736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|1831730_1832069_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1853539	1955975	3042830	transposase,plate,protease,tRNA	Prochlorococcus_phage(16.67%)	109	NA	NA
WP_016209523.1|1853539_1854889_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|1854939_1855377_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|1855638_1857150_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|1857155_1858382_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|1858375_1859404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|1859381_1860074_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_016209516.1|1860078_1861548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|1861540_1862029_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|1862034_1863507_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|1863506_1863905_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|1863901_1865590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|1865571_1866528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|1866570_1867086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|1867190_1868123_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|1868342_1868729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|1868745_1869390_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|1869570_1870410_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|1870485_1871088_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|1871088_1871943_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|1872299_1872611_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|1872635_1874027_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|1874182_1874914_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_054300558.1|1874910_1875438_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|1875469_1876027_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|1876032_1877013_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|1877152_1877953_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|1877956_1878724_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|1878720_1879185_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|1879207_1879861_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|1879864_1880212_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|1880245_1880497_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|1880571_1881840_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|1881842_1882601_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|1882662_1883553_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|1883603_1884287_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|1884372_1884630_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075278612.1|1884902_1886975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|1887046_1887919_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|1888086_1889916_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|1890078_1890720_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|1890961_1891492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|1891509_1891683_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|1891741_1892791_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|1892797_1893748_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|1893801_1894746_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|1894773_1895511_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|1895599_1895842_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|1895916_1897140_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|1897171_1898020_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|1898016_1899069_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|1899189_1899810_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_054300218.1|1899825_1900857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1900900_1901875_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007004.1|1902028_1902484_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1902443_1902782_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1903574_1904480_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|1904526_1905588_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|1905637_1905847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|1907081_1907528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1907531_1908107_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1908052_1908418_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|1908538_1908724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|1908827_1909862_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|1909858_1910569_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|1911043_1911562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|1911679_1912012_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_054300220.1|1912041_1914996_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054300221.1|1915041_1915539_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|1915598_1916015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|1916106_1916967_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|1917049_1917616_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|1917648_1918503_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_155764048.1|1918544_1921205_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_155764049.1|1921201_1921450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209904.1|1921510_1921708_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|1921714_1922725_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|1922721_1923780_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|1923773_1924574_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|1924576_1925395_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|1925406_1926354_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|1926361_1927663_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|1927841_1928945_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|1928941_1929334_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|1929345_1930722_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|1930715_1932185_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_054300223.1|1932376_1933348_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|1933584_1934471_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|1934770_1935016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|1935978_1936398_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|1936504_1936678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|1936904_1937639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1937763_1938825_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|1939147_1939852_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|1939945_1940659_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|1940741_1941833_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_054300226.1|1941904_1942486_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|1942491_1943118_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|1943214_1944150_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|1944509_1945181_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|1945322_1945982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|1946150_1947410_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|1947406_1948492_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|1948484_1949366_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|1949354_1950605_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046988.1|1951890_1952259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046990.1|1952274_1952952_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300228.1|1952929_1954183_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|1955088_1955454_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1955399_1955975_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	1991344	2036797	3042830	transposase,tRNA	Staphylococcus_phage(42.86%)	35	NA	NA
WP_054300232.1|1991344_1992796_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|1992831_1994361_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300233.1|1994935_1996579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|1997120_1998062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|1998412_1999228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|1999519_2002210_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|2002458_2003679_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2003846_2005553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|2006151_2007378_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300276.1|2007960_2008935_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273456.1|2009057_2009357_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2009316_2009772_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300559.1|2010652_2011201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2011916_2012282_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2012227_2012803_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2012829_2013891_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273458.1|2013943_2014159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300238.1|2014431_2014710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2015006_2015507_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|2015709_2016966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|2017321_2017735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|2018044_2018929_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|2019185_2019389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2019688_2020663_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2020965_2022438_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2022457_2023432_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|2023582_2023858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2024023_2024644_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|2024962_2026939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|2027094_2028552_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|2028620_2030201_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|2030241_2030778_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|2030823_2034720_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|2034726_2035050_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|2035735_2036797_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2053478	2102346	3042830	transposase,protease	unidentified_phage(15.38%)	40	NA	NA
WP_054300245.1|2053478_2054354_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|2054609_2055254_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|2055284_2057090_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2057113_2057689_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|2058233_2059244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2059541_2060516_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155046989.1|2060748_2061813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|2061905_2062880_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|2063112_2064177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2064667_2065033_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2065047_2065554_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|2065543_2066203_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|2066621_2067641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|2068099_2069065_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|2069109_2069685_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|2069715_2070990_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|2071635_2072349_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|2072428_2073166_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|2073286_2074642_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|2074818_2075490_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|2075605_2076481_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|2077084_2078389_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2078501_2079107_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|2079188_2080490_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|2080557_2082990_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|2083093_2083366_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|2083448_2085347_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|2085378_2086263_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|2086271_2086667_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|2087094_2089242_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|2089213_2090563_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|2090559_2092680_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|2092676_2094380_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|2094498_2095641_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|2095705_2096734_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_054300251.1|2096860_2098375_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|2098464_2098950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046988.1|2099282_2099651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046987.1|2099666_2100350_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2101440_2102346_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2115335	2179724	3042830	transposase,integrase	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage(14.29%)	59	2112419:2112435	2177494:2177510
2112419:2112435	attL	ATTATATTGATGATGAT	NA	NA	NA	NA
WP_032126152.1|2115335_2115926_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|2116128_2116407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|2116399_2116672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2116764_2117847_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_036780532.1|2117949_2118990_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|2119501_2124976_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|2125196_2125496_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155046986.1|2125680_2126566_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2126755_2127817_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|2127836_2128226_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|2128496_2129579_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|2129789_2130275_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|2130342_2131251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300257.1|2131527_2132337_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_075273486.1|2132313_2133288_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|2133522_2134080_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_054300258.1|2134141_2134921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2135018_2135372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2135438_2135633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|2135648_2135993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2136062_2136638_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2136583_2136949_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273488.1|2137033_2137669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|2137724_2138123_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|2138934_2140053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|2140474_2140621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2141318_2141873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2142309_2142492_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2142556_2142784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|2143014_2143761_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|2143987_2144281_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|2144352_2144958_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|2145106_2146084_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_054300261.1|2146180_2147623_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|2147649_2148303_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|2148427_2148994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|2149348_2151127_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|2151198_2152905_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|2152896_2153187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2153649_2154015_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2153960_2154536_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|2154539_2154914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2155289_2156264_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300263.1|2156335_2156776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2156763_2157102_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2157246_2157507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2157466_2157805_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|2158277_2159738_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|2160081_2161524_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|2162506_2163799_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300560.1|2164272_2166945_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.2	4.1e-75
WP_032126554.1|2166964_2168050_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|2168491_2168929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|2168925_2169810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|2169899_2170430_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|2170500_2171679_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_016210422.1|2175661_2177164_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|2177714_2178350_+	peroxiredoxin C	NA	NA	NA	NA	NA
2177494:2177510	attR	ATTATATTGATGATGAT	NA	NA	NA	NA
WP_054300173.1|2178662_2179724_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2183598	2244072	3042830	transposase,tRNA	uncultured_Mediterranean_phage(11.11%)	54	NA	NA
WP_054300268.1|2183598_2184660_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|2184654_2184825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2184814_2184979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2185035_2185401_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|2185422_2185791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|2186702_2187053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2187141_2187432_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|2187906_2188209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|2188549_2189527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|2189605_2190943_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|2191061_2191433_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|2191653_2192304_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|2192346_2193429_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|2193482_2195366_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|2195864_2196770_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|2196844_2199325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|2200389_2200950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2200969_2201944_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|2202291_2204163_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|2204254_2206000_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|2206079_2206529_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|2206581_2206797_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|2207043_2208060_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|2208108_2208738_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|2209088_2210300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|2210527_2210800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2210963_2212025_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104774.1|2212072_2212705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|2212849_2213023_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|2213798_2214821_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|2214919_2216128_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|2216117_2217845_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|2218028_2219165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2219413_2220475_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210569.1|2220799_2221414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|2221528_2222863_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|2222990_2223632_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|2223937_2224360_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|2224716_2225679_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_081007068.1|2225717_2226893_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155046983.1|2226981_2228682_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_054300273.1|2228681_2230220_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210562.1|2230248_2231901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|2231974_2232730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2233010_2233897_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|2234307_2235597_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|2235792_2236980_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|2237297_2237507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|2237490_2238090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|2238164_2239514_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|2239596_2241798_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|2241814_2242630_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|2242609_2243329_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|2243496_2244072_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2302964	2427595	3042830	transposase,protease,tRNA	Staphylococcus_phage(25.0%)	102	NA	NA
WP_016209432.1|2302964_2304674_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300278.1|2304931_2306263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278615.1|2306703_2307633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278616.1|2307635_2308175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2308890_2309256_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|2309496_2310363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|2310875_2311220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|2311372_2311564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007014.1|2311807_2312203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2312163_2313049_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046982.1|2314274_2314439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2314495_2314861_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|2315101_2315743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2316211_2317186_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300284.1|2317543_2318932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|2319167_2321105_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|2322118_2322838_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|2322951_2326491_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|2326557_2327376_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|2327362_2329402_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210522.1|2329417_2330470_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_016210524.1|2330480_2331011_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|2332648_2332825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|2333001_2333385_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|2333460_2333754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047192.1|2333920_2334877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|2335609_2335765_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|2336029_2337400_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|2337392_2338346_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|2338326_2341131_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|2341210_2341807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|2342196_2342952_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|2343151_2343793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|2344053_2345379_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210007.1|2347409_2347982_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|2348037_2348397_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|2348461_2349496_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|2349753_2350605_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|2350699_2351683_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|2351839_2353507_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_054300285.1|2353956_2354493_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2354493_2355069_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2355014_2355380_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|2355401_2355731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300288.1|2356139_2356829_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_081007015.1|2358482_2358908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|2359119_2359377_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|2359376_2360384_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|2360638_2361640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|2362095_2362248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|2362220_2362394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2362383_2362548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|2362604_2362970_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|2363241_2364303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|2365046_2367515_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|2367528_2368497_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|2368483_2369743_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|2369794_2371180_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|2371990_2372215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781047.1|2372495_2373353_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|2373965_2375087_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|2375136_2376333_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|2376521_2377586_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|2377569_2378316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|2378305_2379034_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|2379030_2379690_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_155046736.1|2379667_2380621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|2380620_2381136_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|2381178_2382612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|2382705_2384907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|2385395_2386988_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|2387212_2388790_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|2388901_2389327_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|2389437_2390823_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|2390848_2391286_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|2391290_2391632_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_155764050.1|2391840_2393637_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210388.1|2393662_2394337_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|2394333_2396508_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|2397716_2399270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|2399353_2400163_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|2400290_2400524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|2400824_2402327_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|2402630_2405324_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|2405320_2408722_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|2408813_2409896_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|2409958_2411026_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|2411961_2412618_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|2412721_2413804_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|2414143_2415118_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|2415745_2416501_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|2416867_2417875_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|2417874_2418132_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2418496_2419471_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273524.1|2419511_2420477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|2420632_2422183_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|2424384_2425467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|2425556_2425733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|2425722_2426022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2426011_2426176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|2426232_2426598_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2426731_2427595_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2471998	2571079	3042830	transposase,tRNA	Escherichia_phage(25.0%)	86	NA	NA
WP_033923708.1|2471998_2472874_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|2472988_2474134_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|2474126_2474522_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|2474740_2475496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|2476851_2477346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|2477803_2479168_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|2479263_2479923_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300306.1|2480170_2480395_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300307.1|2480497_2481226_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300308.1|2481255_2481486_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300309.1|2481780_2483340_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|2483700_2485671_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|2485862_2486942_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|2486990_2487197_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_054300310.1|2488786_2489311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|2491112_2492372_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|2492492_2492825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|2492938_2493913_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|2494057_2494228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|2494426_2495449_+	YHYH protein	NA	NA	NA	NA	NA
WP_054300313.1|2495456_2497139_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_016211344.1|2497299_2498118_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|2498331_2499315_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|2499307_2499529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|2499556_2500198_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|2500729_2501605_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2504067_2504953_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|2504957_2505245_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|2505297_2505576_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|2505674_2506022_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|2506343_2506583_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|2506800_2507388_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|2507348_2507684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|2507871_2508516_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|2508850_2509501_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|2510033_2511086_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|2511103_2514184_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007021.1|2514482_2515049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2515041_2515770_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016209615.1|2517037_2517544_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|2517560_2519060_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|2519081_2519693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|2519689_2520862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|2520893_2523431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|2523462_2525355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278617.1|2525359_2525593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|2525721_2526438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|2526440_2529314_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|2529314_2529719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|2529733_2531455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|2531454_2534403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|2534405_2535803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|2535816_2536557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|2536537_2536972_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|2537016_2537646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|2537716_2538631_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|2538661_2541964_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|2541960_2543784_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|2543823_2544222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|2544342_2545347_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|2545779_2547228_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|2547314_2550371_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|2550353_2550524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|2550589_2550727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300317.1|2551023_2551557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126753.1|2552513_2552978_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|2553047_2554568_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|2554655_2555258_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|2555254_2555602_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|2555752_2556736_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_054300318.1|2557363_2558341_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052104629.1|2558488_2559514_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052047087.1|2559964_2560183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|2560160_2560760_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|2560977_2561349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|2562143_2562290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|2562523_2563387_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|2563595_2564789_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|2564868_2566473_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|2566488_2567634_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|2567838_2568036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2567998_2568337_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2568296_2568752_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|2568997_2569264_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|2569626_2570388_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_081007023.1|2570422_2571079_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2577103	2638532	3042830	transposase	Adoxophyes_honmai_entomopoxvirus(14.29%)	55	NA	NA
WP_052104629.1|2577103_2578129_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273534.1|2578491_2579373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|2579566_2579839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|2579940_2580405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|2580818_2581268_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|2581387_2581768_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|2581905_2582682_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155046974.1|2582792_2582954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274658.1|2583105_2584311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300330.1|2584360_2585422_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|2586043_2586622_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|2586649_2587045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|2587150_2588608_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|2588669_2590157_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|2590907_2591378_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|2595332_2596595_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|2596682_2598488_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|2598971_2599769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|2599938_2600400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|2600698_2602654_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155046973.1|2602820_2602979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212182.1|2603335_2603521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|2603854_2604844_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|2608217_2608532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|2608789_2609050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|2609069_2609558_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|2611081_2611672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|2611931_2612189_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|2612188_2613196_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300338.1|2613220_2614786_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|2614992_2615820_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|2616186_2616798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|2616982_2617243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|2617416_2618370_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|2618792_2618993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|2619367_2620174_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|2620279_2621251_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|2621232_2622204_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081007027.1|2622526_2622712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007028.1|2623496_2623952_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2623911_2624250_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|2624423_2624864_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|2625542_2626481_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|2626544_2628539_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|2628535_2629138_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|2629134_2629473_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|2629548_2630775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|2631331_2632303_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|2632518_2632704_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|2632830_2633298_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|2633294_2634173_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|2634423_2635731_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|2635883_2636339_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2636298_2636637_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2637626_2638532_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2653257	2704049	3042830	transposase	Staphylococcus_phage(25.0%)	49	NA	NA
WP_054300271.1|2653257_2654232_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046969.1|2654251_2655069_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|2655222_2656200_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|2656317_2657766_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|2657794_2658799_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|2658821_2659493_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|2659477_2660731_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|2660979_2661534_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|2662117_2663302_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|2663468_2665067_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|2665760_2666732_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|2666767_2666995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2666998_2667885_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|2667972_2668245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007032.1|2668378_2668648_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	63.2	9.3e-12
WP_016209794.1|2668875_2669499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300344.1|2669544_2671488_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|2671609_2672362_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144019182.1|2672365_2672872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556639.1|2673167_2673578_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|2673594_2674050_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|2674046_2674538_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|2674534_2675284_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|2675313_2675583_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_016209787.1|2675598_2676384_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|2676397_2677531_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|2677565_2679659_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|2679689_2681150_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|2681130_2682018_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|2682014_2682737_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|2682823_2683207_+	response regulator	NA	NA	NA	NA	NA
WP_016209769.1|2683248_2683992_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_036776682.1|2684004_2686029_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|2686090_2686384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|2686520_2687243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|2687407_2688130_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|2688836_2689292_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|2689307_2690756_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|2690796_2691552_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|2691532_2692933_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|2692956_2694174_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|2694204_2694579_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_054300271.1|2696429_2697404_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2697501_2698563_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2699117_2700092_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2700782_2701358_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2701303_2701669_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300345.1|2701805_2702885_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2702966_2704049_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 25
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2714836	2762669	3042830	transposase,tRNA	Acinetobacter_phage(16.67%)	47	NA	NA
WP_016211669.1|2714836_2715187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2716011_2716986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|2718296_2719529_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|2719735_2721508_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|2721643_2722687_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|2722700_2723444_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_155047160.1|2723578_2723878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|2723939_2724119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|2724194_2724893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300347.1|2725314_2726706_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|2726761_2727586_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300161.1|2728200_2729262_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|2729480_2729621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|2729888_2730536_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|2730816_2731176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2731342_2731798_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2731757_2732096_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211482.1|2732231_2734505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|2734493_2735216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|2735326_2735959_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|2735994_2736171_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|2736245_2737388_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049129.1|2737466_2737604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126825.1|2737620_2738934_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_155764051.1|2739485_2739644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278618.1|2739682_2741209_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.5e-05
WP_155046942.1|2742360_2743246_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|2743631_2744785_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046729.1|2745002_2746049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|2746307_2747114_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|2747369_2748191_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|2748226_2749081_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|2749306_2749471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2749634_2750210_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2750155_2750521_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066176.1|2750783_2751053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046968.1|2751061_2752215_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_032126362.1|2752723_2753089_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2753034_2753610_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|2753962_2755321_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|2755602_2755962_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_054300275.1|2756197_2757073_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210111.1|2757377_2759012_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|2759018_2759855_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|2759876_2761154_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|2761237_2761558_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|2761577_2762669_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2782277	2835687	3042830	transposase,protease,integrase	Staphylococcus_phage(40.0%)	54	2807127:2807186	2833787:2834076
WP_054300353.1|2782277_2782505_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046967.1|2782555_2783170_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_155047155.1|2783115_2783265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2783308_2784283_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046966.1|2784355_2784736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2784696_2785062_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2785007_2785583_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|2785572_2785758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|2785968_2786130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|2786162_2787038_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|2787203_2791070_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|2791151_2791292_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|2791273_2791558_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|2791822_2793241_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|2794149_2795055_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|2795295_2795481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|2795517_2796054_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_054300276.1|2797532_2798507_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016212012.1|2798550_2799228_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|2799243_2799627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|2799848_2800970_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|2801203_2802079_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|2802361_2803483_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|2803582_2803885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|2803884_2804565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2805143_2805509_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377865.1|2806868_2807153_-|transposase	transposase	transposase	NA	NA	NA	NA
2807127:2807186	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_080664876.1|2807511_2809374_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_054300359.1|2809597_2810170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273651.1|2810528_2811566_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300361.1|2812117_2812414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007035.1|2812391_2813057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2813096_2814071_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|2814627_2815257_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|2815240_2815663_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|2815669_2817409_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|2817409_2818474_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|2818477_2818831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|2818943_2819900_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|2819909_2820221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|2820236_2820806_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|2821069_2822398_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|2822602_2823577_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|2823790_2824162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|2824220_2824994_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155046965.1|2825145_2827602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|2827881_2828643_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|2828723_2830469_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|2830644_2831772_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|2831858_2832089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|2832703_2833483_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|2833957_2834395_-	MFS transporter	NA	NA	NA	NA	NA
2833787:2834076	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
WP_054300363.1|2834818_2835166_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046964.1|2835111_2835687_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2874602	2943758	3042830	transposase,protease,tRNA	Klosneuvirus(25.0%)	60	NA	NA
WP_016211285.1|2874602_2875382_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211280.1|2875381_2875891_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|2875926_2876175_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211281.1|2876486_2876822_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211282.1|2877116_2878367_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126762.1|2878448_2880476_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016210148.1|2881311_2881530_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_016210147.1|2882390_2883563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777648.1|2883575_2885573_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_075278619.1|2885553_2885865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278620.1|2885984_2886533_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273562.1|2886592_2887462_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016210153.1|2887461_2887866_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075273564.1|2887858_2888278_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210157.1|2888300_2888930_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016210144.1|2889472_2891662_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210150.1|2891673_2892879_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081007038.1|2892863_2894720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664835.1|2894707_2895934_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210156.1|2895926_2897795_+	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_054300372.1|2897828_2899073_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210155.1|2899078_2899888_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210154.1|2899926_2900619_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210146.1|2900740_2901232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|2901581_2901755_+	phosphatase	NA	NA	NA	NA	NA
WP_075273565.1|2901892_2902783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046721.1|2902963_2903131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2903302_2904277_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|2904273_2905131_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|2905858_2906248_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|2906424_2907183_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|2907179_2909579_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|2910958_2912257_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|2912454_2913348_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|2913347_2914562_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|2914581_2915868_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|2915883_2916138_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|2916373_2917741_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|2918071_2919094_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2919616_2921092_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|2921308_2922205_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|2922523_2924083_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|2924158_2924353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|2924572_2925271_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|2925549_2925813_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|2926119_2928714_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|2928710_2929193_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209840.1|2930382_2930868_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_054300374.1|2930975_2933546_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_075278621.1|2933581_2933923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|2934111_2934318_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|2935521_2936061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|2936720_2938205_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|2938329_2939865_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|2940098_2940464_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2940409_2940985_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|2941017_2941881_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|2941898_2942231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300375.1|2943037_2943238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|2943452_2943758_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP013762	Piscirickettsia salmonis strain PM21567A, complete genome	3042830	2964544	3009550	3042830	transposase,tRNA	Acinetobacter_phage(20.0%)	39	NA	NA
WP_075273327.1|2964544_2965120_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046962.1|2965123_2965570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|2967136_2967490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|2967790_2969518_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|2969655_2970312_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|2970342_2971071_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|2971063_2972302_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|2972437_2973475_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|2973528_2974431_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|2974539_2975793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|2975850_2979348_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|2979407_2980136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|2980263_2980812_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_054300378.1|2982667_2984365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2984373_2985527_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212482.1|2986070_2986214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|2986428_2986629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046961.1|2986748_2987153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2987320_2987686_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2989104_2989404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211467.1|2989478_2990045_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|2990047_2991136_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|2991256_2992069_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|2992199_2994185_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|2994244_2994898_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_105962623.1|2995499_2996653_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300380.1|2996981_2997638_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300381.1|2998101_2998749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2998759_2999842_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|3000144_3001206_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|3002065_3002518_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|3002635_3004108_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|3004266_3004731_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|3005201_3005375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|3006084_3006450_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3006395_3006971_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|3006960_3007620_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|3007719_3008991_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|3009079_3009550_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP013763	Piscirickettsia salmonis strain PM21567A plasmid p1PS2, complete sequence	120730	6179	103385	120730	integrase,transposase	Streptococcus_phage(25.0%)	110	19544:19603	87646:88748
WP_075273741.1|6179_6914_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273747.1|7043_7634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047048.1|7895_8396_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046767.1|8395_8557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|8887_9622_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_129556718.1|9830_11017_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_155047018.1|11050_11854_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.9e-55
WP_075274752.1|11889_12189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274751.1|12185_12761_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.1e-08
WP_032126362.1|12706_13072_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212061.1|14264_16307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274748.1|17076_17277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212579.1|18782_18980_+	hypothetical protein	NA	NA	NA	NA	NA
19544:19603	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_054300271.1|19579_20554_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
19544:19603	attL	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAA	NA	NA	NA	NA
WP_016212456.1|20597_20885_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	39.2	2.9e-11
WP_036779532.1|20881_21283_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.0	3.9e-22
WP_075273881.1|21292_23479_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.2	9.2e-73
WP_016212404.1|23599_23833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273857.1|24609_25344_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	8.4e-39
WP_155049833.1|25497_26001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556709.1|26048_26138_-	DUF1891 domain-containing protein	NA	NA	NA	NA	NA
WP_052047129.1|26349_27933_-	protein kinase	NA	NA	NA	NA	NA
WP_155047017.1|28411_28591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212365.1|29944_30187_+	antidote-toxin recognition MazE family protein	NA	NA	NA	NA	NA
WP_036781349.1|30188_30515_+	potassium ABC transporter ATPase	NA	A9D9Y1	Lactobacillus_prophage	36.6	1.1e-11
WP_075273842.1|30630_31359_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	5.4e-38
WP_016212152.1|31828_32212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212154.1|32518_32896_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	46.0	1.2e-17
WP_032126739.1|33060_33393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212156.1|33345_33498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377351.1|33581_34361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212019.1|35174_35870_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.9	2.2e-41
WP_016212018.1|36026_36326_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|36322_36568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047016.1|36597_36825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212014.1|37228_37642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|37739_38468_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_105962623.1|38534_39687_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556707.1|40069_41089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104769.1|41403_42327_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016211886.1|43324_43753_+	nucleotidyltransferase substrate-binding, HI0074 family protein	NA	NA	NA	NA	NA
WP_016211884.1|43749_44049_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_129556706.1|44139_44769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211885.1|44782_45823_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_033923686.1|45931_46981_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|47105_48080_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212150.1|48143_48458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212151.1|48481_49444_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_054300271.1|49534_50509_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_105962625.1|51152_52039_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.7	4.5e-10
49499:50601	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_016212121.1|52472_53396_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
49499:50601	attR	CGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAACCATCTCTACCCTCTAAGTCAAAAGGCGAACTAGAGAGTTTATCTGTATGAATATGAACTCTCTACTGAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
WP_016212122.1|53349_54051_-	ParA family protein	NA	J9Q7R7	Salmonella_phage	31.8	1.1e-19
WP_155047015.1|54927_55251_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046765.1|55631_55826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|56712_57441_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_054300162.1|57560_58643_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_075273836.1|58672_59734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273834.1|60076_60643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|60849_61578_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047014.1|61733_62075_+	hypothetical protein	NA	A0A1B1IQX9	uncultured_Mediterranean_phage	60.3	1.7e-21
WP_075273830.1|62145_62478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|62507_63236_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155047021.1|63259_63415_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016211890.1|63709_66286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|66489_67218_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273828.1|67247_68417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211879.1|68429_69449_-	ParA family protein	NA	NA	NA	NA	NA
WP_036780064.1|70403_70994_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_081377350.1|71239_72055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047013.1|72384_72531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273826.1|72751_73879_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_075273824.1|73838_74093_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273327.1|74096_74672_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_032126362.1|74617_74983_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047012.1|74943_75951_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	6.5e-58
WP_075274741.1|76019_76277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273822.1|76378_76879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|77035_78118_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_016212255.1|78304_78475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|78471_78675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|79011_79236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212260.1|79255_79528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|79685_80660_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_129556717.1|81314_82541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|82866_83703_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_075273814.1|83965_84427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047268.1|84593_84974_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|85774_86140_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273812.1|86085_86643_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.6e-08
WP_054300271.1|86639_87614_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_129556718.1|88750_89937_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_075273810.1|89923_90631_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_081377348.1|90938_91688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|92002_92506_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075273808.1|92545_93070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273806.1|93331_93895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|94000_94456_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273804.1|94415_94754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273802.1|94838_95567_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_016212413.1|95900_96329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|96376_97117_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_075273798.1|97517_97742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|97850_98375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764052.1|98316_98559_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
WP_075273796.1|98494_99298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126138.1|99852_100116_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_016211871.1|100681_101017_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_129556699.1|101010_101211_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300590.1|101518_101743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|102359_103385_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013767	Piscirickettsia salmonis strain PM21567A plasmid p5PS2, complete sequence	31920	8104	13525	31920	head,transposase,tail	Staphylococcus_phage(33.33%)	7	NA	NA
WP_054300681.1|8104_8605_+	hypothetical protein	NA	A0A1W6JQ30	Staphylococcus_phage	42.7	8.1e-17
WP_155046942.1|8941_9828_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_054300680.1|9854_10535_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.0e-09
WP_016211133.1|10980_12315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|12505_12817_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|12813_13137_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|13129_13525_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
