The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	130966	180710	4728107	plate,holin,transposase,tRNA,tail	Burkholderia_phage(34.78%)	51	NA	NA
WP_023994534.1|130966_132721_-|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	4.2e-52
WP_023993553.1|132723_133356_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_023993552.1|133348_134464_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_001093501.1|134454_134814_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_058649929.1|134977_136525_-	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_000703634.1|136524_137454_-	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000593182.1|137450_137813_-	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000679393.1|138140_138863_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000818147.1|138872_139916_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
WP_023993551.1|139903_140113_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	2.2e-16
WP_000271425.1|140112_141066_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_023993550.1|141065_143420_-|tail	tail protein	tail	A4JWL0	Burkholderia_virus	30.4	4.4e-65
WP_001728452.1|143516_143645_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001600578.1|143604_143922_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907494.1|143973_144498_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_023993549.1|144497_145925_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_023993548.1|145914_146112_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	50.0	1.3e-07
WP_023993547.1|146108_146564_-	Gp37 family protein	NA	NA	NA	NA	NA
WP_000777266.1|146723_147038_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_023993546.1|147050_147656_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	5.5e-60
WP_001226439.1|147658_147946_-|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_000615248.1|148522_148870_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_000136400.1|149000_150350_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790024.1|150694_152344_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_023994532.1|152787_153030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122821798.1|153063_153732_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_023993545.1|153728_154463_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000750804.1|154462_156559_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000982749.1|156701_157112_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001252085.1|157277_158168_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000382573.1|158182_159727_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695415.1|159858_161049_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179176.1|161410_162520_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000973678.1|162608_163967_+	maltoporin	NA	NA	NA	NA	NA
WP_000782497.1|164130_165048_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019219.1|165228_165726_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455249.1|165739_166612_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017360.1|166710_169131_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002900.1|169301_169670_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|169778_170387_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_001128112.1|170565_171891_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_001575282.1|171887_172001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|172022_172232_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416271.1|172330_172846_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001039342.1|173092_174403_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_001182224.1|174490_175489_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|175656_175899_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235550.1|176073_177057_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|177121_178537_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_001147297.1|178568_179648_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_023994022.1|179723_180710_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	1378330	1414998	4728107	coat,holin,integrase,lysis,terminase,portal,protease	Salmonella_phage(70.91%)	55	1378244:1378265	1418984:1419005
1378244:1378265	attL	CTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
WP_000533679.1|1378330_1379401_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
WP_001556007.1|1379378_1379597_-	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000509169.1|1379919_1380186_-	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_000582224.1|1381513_1382269_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_023993443.1|1382582_1382984_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	1.3e-70
WP_023993442.1|1382980_1383673_-	HNH endonuclease	NA	C6ZR31	Salmonella_phage	90.7	1.2e-114
WP_023993441.1|1383660_1383831_-	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_023993440.1|1383841_1384135_-	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	94.8	6.8e-48
WP_023993439.1|1384181_1384466_-	hypothetical protein	NA	E7C9P9	Salmonella_phage	96.8	2.0e-44
WP_023993438.1|1384465_1385173_-	hypothetical protein	NA	I6R0N0	Salmonella_phage	94.9	9.1e-131
WP_000902089.1|1385169_1385313_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_000156731.1|1385302_1385491_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|1385471_1385630_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_023233617.1|1385838_1386471_-	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	81.1	4.2e-79
WP_000843522.1|1386559_1387003_-	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_023233618.1|1387019_1387382_-	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000834179.1|1387749_1387959_+	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	7.2e-28
WP_000759585.1|1388105_1389125_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	36.0	3.5e-51
WP_000250476.1|1389360_1390071_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_001180316.1|1390148_1390376_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000424139.1|1390512_1390803_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
WP_023167632.1|1390824_1391085_+	hypothetical protein	NA	G9L679	Escherichia_phage	61.7	1.6e-21
WP_000431305.1|1391147_1392008_+	replication protein	NA	G9L680	Escherichia_phage	65.0	3.6e-89
WP_023167630.1|1392004_1393381_+	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_023993437.1|1393452_1393725_+	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	96.6	9.7e-41
WP_023993436.1|1393955_1394237_+	hypothetical protein	NA	I6R992	Salmonella_phage	64.2	9.4e-23
WP_001291852.1|1394239_1394440_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	98.5	1.4e-28
WP_023993435.1|1394442_1394865_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	99.3	1.1e-78
WP_001254236.1|1394872_1395049_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_000924596.1|1395051_1395453_+	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_000950998.1|1395445_1395622_+	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_001089628.1|1395614_1395851_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	93.6	1.3e-36
WP_001185533.1|1395831_1396302_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_000337150.1|1396289_1396472_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_000196508.1|1396468_1396711_+	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_001047569.1|1396868_1397648_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000286100.1|1398069_1398273_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001748050.1|1398250_1398748_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	7.9e-89
WP_001748051.1|1398744_1399203_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	78.8	4.3e-57
WP_023994441.1|1399412_1399934_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	98.3	1.8e-99
WP_023217190.1|1400407_1400650_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.8	1.9e-35
WP_058649961.1|1400652_1401057_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	3.4e-66
WP_000729924.1|1401060_1401549_+	DNA-packaging protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_017441431.1|1401526_1403026_+|terminase	terminase large subunit	terminase	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
WP_017441432.1|1403025_1405203_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
WP_017441433.1|1405216_1406128_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
WP_020899473.1|1406127_1407420_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_000538675.1|1407460_1408021_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
WP_010835893.1|1408004_1408505_+	packaged DNA stabilization gp4 family protein	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_023198766.1|1408464_1409883_+	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
WP_023198767.1|1409886_1410588_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	93.1	4.0e-70
WP_017441438.1|1410587_1411049_+	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	84.9	4.3e-73
WP_023198768.1|1411051_1411741_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	89.8	1.9e-88
WP_165398880.1|1411750_1413106_+	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	97.1	2.3e-239
WP_001029862.1|1413105_1414998_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	78.3	5.1e-245
1418984:1419005	attR	CTTTTTTATACTAAGTTGAACG	NA	NA	NA	NA
>prophage 3
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	1542365	1549678	4728107	protease,integrase	Dickeya_phage(16.67%)	7	1543616:1543630	1554870:1554884
WP_001201750.1|1542365_1543484_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_023993622.1|1543480_1545427_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
1543616:1543630	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1545556_1545778_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1546101_1546422_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1546452_1548729_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1548941_1549139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993623.1|1549300_1549678_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
1554870:1554884	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 4
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	2553605	2560856	4728107		Morganella_phage(33.33%)	8	NA	NA
WP_023993342.1|2553605_2555036_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_023993343.1|2555109_2555805_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	3.6e-07
WP_000107435.1|2555884_2556196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993344.1|2556844_2558041_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.6	4.3e-109
WP_024131109.1|2558299_2558488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2558498_2558711_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_023993345.1|2559165_2560434_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	9.3e-227
WP_000394197.1|2560436_2560856_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 5
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	2719262	2728433	4728107	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000195340.1|2719262_2721296_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|2721536_2721995_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023993390.1|2722166_2722697_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.8e-15
WP_000950413.1|2722753_2723221_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2723267_2723987_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|2723983_2725669_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|2725891_2726623_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023993392.1|2726682_2726790_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2726770_2727502_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2727485_2728433_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 6
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	2940406	3014271	4728107	capsid,terminase,tRNA,holin,integrase,head,lysis,protease,tail	Salmonella_phage(65.71%)	94	2938989:2939004	2978775:2978790
2938989:2939004	attL	CATTTTAGCCAGCGCC	NA	NA	NA	NA
WP_000016631.1|2940406_2941219_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289141.1|2941218_2942232_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699176.1|2942299_2943436_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
WP_000553395.1|2943539_2944541_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127721.1|2944537_2945716_-	MFS transporter	NA	NA	NA	NA	NA
WP_001051261.1|2945895_2946270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433425.1|2946442_2946691_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	6.2e-18
WP_000118256.1|2946859_2947228_+	C40 family peptidase	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000847535.1|2947227_2947746_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_001142900.1|2947812_2948469_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000817161.1|2948566_2949781_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023993415.1|2949940_2951941_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559749.1|2951992_2952268_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001066345.1|2952300_2952849_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_023993416.1|2952848_2953658_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000750429.1|2953657_2954482_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918457.1|2954485_2955571_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001650203.1|2955606_2956539_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730794.1|2956704_2957256_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001195808.1|2957355_2957841_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023993417.1|2958058_2960197_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_023993418.1|2960196_2961507_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030904.1|2961684_2961969_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001533060.1|2962339_2963647_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776787.1|2963707_2964463_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_023993419.1|2964751_2965693_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.3e-145
WP_023993420.1|2966006_2967176_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	98.7	1.5e-226
WP_023993421.1|2967247_2968546_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	96.8	7.5e-240
WP_023993422.1|2968556_2969516_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	3.6e-183
WP_023993423.1|2969524_2972245_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	96.0	0.0e+00
WP_023993424.1|2972244_2972643_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
WP_023993425.1|2972649_2973234_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.4	1.1e-105
WP_023993426.1|2973233_2973827_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.4	1.2e-107
WP_023993427.1|2973992_2974241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993428.1|2974343_2977682_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	69.5	0.0e+00
WP_023993429.1|2977740_2978082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993430.1|2978136_2978415_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	6.0e-38
WP_023993431.1|2978423_2978813_-|tail	phage tail assembly chaperone	tail	K7PKV6	Enterobacterial_phage	85.3	7.3e-58
2978775:2978790	attR	CATTTTAGCCAGCGCC	NA	NA	NA	NA
WP_023993432.1|2978840_2979545_-|tail	prophage major tail protein	tail	K7PHL2	Enterobacterial_phage	75.6	6.7e-94
WP_000133673.1|2979602_2979950_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	78.8	7.5e-46
WP_000573485.1|2979946_2980396_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	98.7	7.6e-75
WP_001007886.1|2980392_2980743_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	87.9	1.1e-49
WP_000571722.1|2980751_2981078_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	99.1	1.8e-54
WP_023242805.1|2983674_2985609_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	99.7	0.0e+00
WP_024134503.1|2985667_2987329_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	99.6	0.0e+00
WP_000954404.1|2987325_2987820_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_001096739.1|2988130_2988496_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	82.9	4.3e-52
WP_000983798.1|2988488_2989082_-	hypothetical protein	NA	S4TR53	Salmonella_phage	96.9	1.2e-112
WP_001124954.1|2989062_2989581_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	54.3	1.3e-46
WP_023993433.1|2989624_2991082_-	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	99.6	2.3e-290
WP_000004347.1|2991091_2991865_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	97.7	3.1e-124
WP_000509527.1|2991985_2992321_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	100.0	8.0e-61
WP_001034848.1|2992397_2992943_+	hypothetical protein	NA	S4TR57	Salmonella_phage	100.0	5.0e-97
WP_001283924.1|2993087_2993345_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_000644477.1|2993341_2993839_-	KilA-N domain-containing protein	NA	S4TSR0	Salmonella_phage	100.0	8.1e-94
WP_001748051.1|2994048_2994507_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	78.8	4.3e-57
WP_001748050.1|2994503_2995001_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	7.9e-89
WP_000286100.1|2994978_2995182_-|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047569.1|2995603_2996383_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000196508.1|2996540_2996783_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_000337150.1|2996779_2996962_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_001185533.1|2996949_2997420_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_001089627.1|2997400_2997637_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	94.9	4.3e-37
WP_000950998.1|2997629_2997806_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_000924596.1|2997798_2998200_-	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_001254236.1|2998202_2998379_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_023993435.1|2998386_2998809_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	99.3	1.1e-78
WP_001291852.1|2998811_2999012_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	98.5	1.4e-28
WP_023993436.1|2999014_2999296_-	hypothetical protein	NA	I6R992	Salmonella_phage	64.2	9.4e-23
WP_023993437.1|2999526_2999799_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	96.6	9.7e-41
WP_023167630.1|2999870_3001247_-	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_000431305.1|3001243_3002104_-	replication protein	NA	G9L680	Escherichia_phage	65.0	3.6e-89
WP_023167632.1|3002166_3002427_-	hypothetical protein	NA	G9L679	Escherichia_phage	61.7	1.6e-21
WP_000424139.1|3002448_3002739_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
WP_001180316.1|3002875_3003103_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3003180_3003891_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_000759585.1|3004126_3005146_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	36.0	3.5e-51
WP_000834179.1|3005292_3005502_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	7.2e-28
WP_023233618.1|3005869_3006232_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000843522.1|3006248_3006692_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_023233617.1|3006780_3007413_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	81.1	4.2e-79
WP_000141641.1|3007621_3007780_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3007760_3007949_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902089.1|3007938_3008082_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_023993438.1|3008078_3008786_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	94.9	9.1e-131
WP_023993439.1|3008785_3009070_+	hypothetical protein	NA	E7C9P9	Salmonella_phage	96.8	2.0e-44
WP_023993440.1|3009116_3009410_+	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	94.8	6.8e-48
WP_023993441.1|3009420_3009591_+	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_023993442.1|3009578_3010271_+	HNH endonuclease	NA	C6ZR31	Salmonella_phage	90.7	1.2e-114
WP_023993443.1|3010267_3010669_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	1.3e-70
WP_000582224.1|3010982_3011738_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_023993446.1|3012436_3012709_+	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	98.9	2.6e-38
WP_023993447.1|3012867_3013071_+	transcriptional regulator	NA	I6RSG8	Salmonella_phage	95.5	6.1e-32
WP_000716009.1|3013332_3014271_-|protease	omptin family outer membrane protease PgtE	protease	NA	NA	NA	NA
>prophage 7
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	3304987	3313963	4728107	integrase	Enterobacteria_phage(85.71%)	10	3302358:3302373	3309180:3309195
3302358:3302373	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_001604633.1|3304987_3306184_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
WP_001604631.1|3306220_3307630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993984.1|3308162_3308729_-	bacteriophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.2e-56
WP_000984209.1|3308745_3308988_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_000149860.1|3308984_3309722_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
3309180:3309195	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
WP_000556594.1|3310259_3310526_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_015701354.1|3310522_3311074_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_001216603.1|3311070_3311298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993983.1|3311294_3311615_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023993982.1|3311629_3313963_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
>prophage 8
NZ_CP016408	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 chromosome 1, complete sequence	4728107	4652227	4716593	4728107	terminase,plate,tRNA,holin,integrase,head,lysis,capsid,portal,tail	Escherichia_phage(56.52%)	77	4685142:4685188	4716705:4716751
WP_023993693.1|4652227_4652665_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001518251.1|4652709_4653651_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001259011.1|4653665_4654112_-	type II toxin-antitoxin system HigA family antitoxin	NA	NA	NA	NA	NA
WP_000558166.1|4654108_4654420_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_021294279.1|4654505_4655435_-	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	44.4	1.3e-07
WP_001159630.1|4655652_4655964_+	cytotoxic translational repressor of toxin-antitoxin stability system	NA	NA	NA	NA	NA
WP_000362050.1|4655964_4656255_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000027730.1|4656301_4657231_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829025.1|4657227_4657863_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331361.1|4657859_4658762_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077248424.1|4658774_4661825_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.1	4.6e-06
WP_001059746.1|4662019_4662856_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000710967.1|4663131_4664163_-	YiiG family protein	NA	NA	NA	NA	NA
WP_023994499.1|4664344_4665445_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_000527677.1|4665799_4666123_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_000683586.1|4666122_4666782_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_001517951.1|4666882_4667431_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000619478.1|4667519_4667834_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_023993691.1|4667830_4668979_-	lactaldehyde reductase	NA	NA	NA	NA	NA
WP_001179690.1|4669105_4669933_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_023993690.1|4670075_4671335_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_023993689.1|4671331_4672801_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217112.1|4673088_4673925_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000013290.1|4674077_4674926_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063533.1|4674922_4675957_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_000378721.1|4676575_4677259_+	oligogalacturonate-specific porin KdgM family protein	NA	NA	NA	NA	NA
WP_023993688.1|4677416_4678724_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_001091413.1|4678716_4679232_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_023993687.1|4679250_4680234_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000122632.1|4680562_4681183_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
WP_000559229.1|4681252_4681942_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000133440.1|4681953_4682349_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000580402.1|4682399_4683773_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_001033731.1|4683769_4684468_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001233463.1|4684618_4685119_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
4685142:4685188	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|4685304_4686285_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|4686354_4686648_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|4686784_4687057_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|4687226_4687727_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|4687790_4688015_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277898.1|4688014_4688314_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113277.1|4688316_4688541_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
WP_000027673.1|4688537_4688813_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001598736.1|4688802_4691079_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
WP_000119270.1|4692215_4692701_+	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	37.1	6.0e-09
WP_001389947.1|4692884_4693367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001161722.1|4693449_4694391_-	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	73.7	2.0e-133
WP_001620981.1|4694817_4695852_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.4	2.4e-201
WP_023993686.1|4695851_4697624_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_023993685.1|4697797_4698652_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	99.6	6.4e-139
WP_016237184.1|4698710_4699784_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_000203461.1|4699787_4700531_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	8.6e-124
WP_000988636.1|4700630_4701140_+|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000846409.1|4701139_4701343_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|4701346_4701628_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|4701627_4702125_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_023993684.1|4702139_4702565_+	hypothetical protein	NA	M1SV74	Escherichia_phage	98.6	5.5e-59
WP_023993683.1|4702552_4702978_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	6.1e-66
WP_000917182.1|4703085_4703553_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_023993682.1|4703545_4703998_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.9e-75
WP_001093731.1|4704064_4704700_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_001389961.1|4704696_4705044_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_023993681.1|4705048_4705957_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.7e-161
WP_023993680.1|4705949_4706561_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	98.5	2.4e-116
WP_075332800.1|4706557_4707895_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.3	1.9e-185
WP_006673255.1|4707894_4708497_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_006673257.1|4708468_4708909_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.2e-51
WP_075323717.1|4708911_4709310_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.3	1.6e-12
WP_023993658.1|4709337_4709931_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	3.9e-103
WP_001286698.1|4709990_4711181_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_001251408.1|4711193_4711712_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4711768_4712044_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4712076_4712196_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_023993657.1|4712188_4714636_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.8	0.0e+00
WP_000978896.1|4714650_4715130_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_001598749.1|4715129_4716293_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.4e-205
WP_000468308.1|4716374_4716593_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
4716705:4716751	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
>prophage 1
NZ_CP016409	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence	322518	83028	160098	322518	transposase,integrase	Tupanvirus(13.33%)	40	148935:148949	165938:165952
WP_088348988.1|83028_84127_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_020833646.1|84985_86101_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_020833650.1|90380_91208_-	streptomycin 3''-kinase	NA	NA	NA	NA	NA
WP_020833651.1|91344_91530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110613438.1|92529_92829_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020833652.1|92765_93980_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_020833653.1|94008_95307_-	transporter	NA	NA	NA	NA	NA
WP_020833654.1|95420_96617_-	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	28.4	9.3e-27
WP_024143068.1|97501_97759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833656.1|98257_99046_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.2	2.8e-08
WP_020833657.1|99381_101403_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_020833658.1|101533_103111_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	A0A2K9KZV5	Tupanvirus	22.8	2.0e-08
WP_023994194.1|103114_103918_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_023994193.1|103914_105015_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_020833661.1|105011_114509_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_020833662.1|114596_120704_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9KZV5	Tupanvirus	28.2	3.4e-40
WP_020833663.1|120894_121854_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_020833664.1|122311_124024_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.4	2.8e-32
WP_023994191.1|124010_125813_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.1	2.7e-22
WP_020833666.1|125805_127086_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_020833667.1|127113_128445_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_020833668.1|129102_129402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833669.1|129636_131124_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_020833670.1|131208_132069_+	alpha/beta fold hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.9e-07
WP_077914832.1|133150_133441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994189.1|133443_134457_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	36.7	4.4e-46
WP_139142178.1|134882_135011_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_139142176.1|134974_135142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994187.1|136553_136856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049885068.1|139361_140750_-	MFS transporter	NA	NA	NA	NA	NA
WP_023994181.1|141077_141446_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_023994180.1|141944_142970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023994221.1|144377_145355_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.9	3.7e-74
WP_023994222.1|145804_147142_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_023994223.1|147380_148454_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_058649965.1|148772_151040_-	arginine decarboxylase	NA	NA	NA	NA	NA
148935:148949	attL	AGGAATTCCCGGCGG	NA	NA	NA	NA
WP_023994225.1|152726_153035_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	68.6	9.6e-29
WP_078024491.1|155166_156018_+	3'-5' exoribonuclease	NA	K7RFY5	Vibrio_phage	37.3	4.3e-26
WP_001067855.1|158259_158964_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|159084_160098_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
165938:165952	attR	AGGAATTCCCGGCGG	NA	NA	NA	NA
>prophage 2
NZ_CP016409	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502916 plasmid pFSIS1502916, complete sequence	322518	236046	286174	322518	transposase,integrase	Escherichia_phage(28.57%)	57	229457:229471	272991:273005
229457:229471	attL	ATTTTGCTCTGATTT	NA	NA	NA	NA
WP_000038334.1|236046_236961_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.7e-66
WP_001247862.1|237025_237292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|237384_237819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117627.1|238547_239048_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.1	1.9e-05
WP_000978005.1|239510_240107_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	60.3	6.9e-15
WP_001276261.1|240103_240823_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845898.1|240819_241254_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_058649951.1|241308_243267_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	1.6e-20
WP_000006024.1|243325_243559_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_001276125.1|243616_244144_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001027516.1|244914_245106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271741.1|245102_245525_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198941.1|245571_245997_-	antirestriction protein	NA	NA	NA	NA	NA
WP_052980418.1|246414_247185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000274421.1|247229_247664_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|247677_247899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086137.1|247899_248583_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.3e-30
WP_001330417.1|248967_249870_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|250287_250536_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|250532_250970_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457496.1|250969_252241_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000340829.1|252245_252638_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103690.1|252642_253614_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|253842_254487_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|254480_254756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249540.1|254893_255679_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.6e-54
WP_000535297.1|255723_256503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302628.1|256555_256870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|257550_258546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|258549_259482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|259779_260868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253407.1|260869_261739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741348.1|261795_263361_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001261287.1|263668_263899_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|263895_264312_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_075322282.1|264473_266612_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|266965_267223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|267222_267813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058649952.1|268075_269632_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|269822_270440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502555.1|270732_271770_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|271874_272198_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024159726.1|272298_273009_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
272991:273005	attR	AAATCAGAGCAAAAT	NA	NA	NA	NA
WP_001286342.1|273017_273563_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011117603.1|273638_274001_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_023171140.1|274027_275779_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011117601.1|275852_276221_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|276865_277570_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002210551.1|277890_278019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013188475.1|278523_279399_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|279433_280402_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|282152_282857_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|283242_283659_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|283663_284182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|284181_284970_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049824851.1|284989_285460_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067855.1|285469_286174_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
