The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	7692	48917	5093052	transposase,protease	Ralstonia_phage(40.0%)	38	NA	NA
WP_012443554.1|7692_8529_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_011407165.1|8715_9522_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011257013.1|9798_10992_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_164994088.1|11145_11820_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257015.1|11904_12666_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010364790.1|12712_13135_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257016.1|13138_13552_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011257017.1|13847_14615_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_019301610.1|14625_14895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257019.1|14969_16430_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_162531722.1|16602_16767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257020.1|17076_18087_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	9.5e-49
WP_011257021.1|18358_19561_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_011407169.1|19702_21841_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	40.9	5.3e-65
WP_012443560.1|22051_22345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143698755.1|22527_23151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057752.1|23118_24106_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.5	1.3e-87
WP_011257025.1|24153_25320_-	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_012443565.1|27508_28726_+	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_012443568.1|29346_30369_-	sugar kinase	NA	NA	NA	NA	NA
WP_080493590.1|30949_32203_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_129215560.1|32276_33074_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_157724563.1|33061_34036_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_012443571.1|34920_35583_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_012443572.1|35736_36531_-	EcsC family protein	NA	NA	NA	NA	NA
WP_027704023.1|36698_37172_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_011409560.1|39397_40360_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_012443578.1|40846_41245_-	host attachment protein	NA	NA	NA	NA	NA
WP_011257042.1|41336_42029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704036.1|42198_42669_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_011257044.1|42784_42961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407233.1|44135_44447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407232.1|44701_45649_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	6.6e-44
WP_164994089.1|45789_46809_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011257048.1|46974_47256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407230.1|47308_47569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168735.1|47636_47846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994090.1|47966_48917_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.9	4.0e-97
>prophage 2
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	91904	132958	5093052	transposase	Ostreococcus_lucimarinus_virus(25.0%)	33	NA	NA
WP_109181945.1|91904_92667_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|92674_94399_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_011257102.1|94639_95581_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_041182540.1|95773_97138_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|97134_98763_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_041182541.1|99236_100820_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_044756187.1|100816_103051_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|103053_104811_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_094187819.1|104867_106757_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_012443627.1|106753_109363_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|109385_109571_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|109685_111848_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_027703730.1|111864_112497_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|112660_113158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|113298_114345_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_155297135.1|114462_115782_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115862254.1|116200_117166_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443633.1|117260_118274_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_164994091.1|118254_120657_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_080496167.1|120772_121231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|121230_121563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|121579_121840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407913.1|122790_124005_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_164994092.1|124029_124239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|124516_125926_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011407187.1|126274_126706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|126980_127316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407184.1|127755_129045_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_012443640.1|129052_129304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443641.1|129663_130644_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	55.0	1.0e-87
WP_012443642.1|131109_131433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443643.1|131374_131617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265413.1|131992_132958_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	162372	303968	5093052	transposase,tail,tRNA	Arthrobacter_phage(13.64%)	92	NA	NA
WP_133265458.1|162372_163749_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	5.6e-76
WP_027703863.1|165150_166209_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_103057315.1|166352_166448_-	xylosidase	NA	NA	NA	NA	NA
WP_041181912.1|166423_166951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|167773_169957_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_069960129.1|169968_173319_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|173315_176432_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_151420504.1|179391_180711_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|180910_181879_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_117231488.1|182028_183348_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_164994169.1|183432_183522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443686.1|183591_183705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069959772.1|183787_185263_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	1.6e-100
WP_012443690.1|186871_188392_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|188408_188687_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|188876_189215_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_012443692.1|189827_191813_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011409560.1|192444_193407_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011257188.1|193816_194629_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|194821_195433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|195849_196707_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_012443696.1|196944_198831_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_164994093.1|201162_203886_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	1.1e-70
WP_041182356.1|203953_206107_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.5	2.0e-27
WP_011257195.1|206103_207795_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443704.1|208328_210233_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_075239321.1|210493_210673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407290.1|210806_211274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257199.1|211431_212391_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_011407291.1|212375_212993_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011257200.1|213035_213455_+	SnoaL-like domain-containing protein	NA	NA	NA	NA	NA
WP_012443706.1|213707_214613_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	39.5	2.6e-37
WP_011257202.1|214861_215746_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_011257203.1|215809_216592_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407292.1|216636_217398_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_011257206.1|217561_217891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407293.1|218209_219301_+	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_011407294.1|219369_220968_+	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_011407295.1|221132_222377_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_011257210.1|222828_223458_-	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	3.3e-52
WP_075239962.1|223664_225641_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.2	1.1e-112
WP_011407298.1|227027_227693_-	YceH family protein	NA	NA	NA	NA	NA
WP_011257214.1|227965_228976_+	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_011257215.1|228972_229704_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_012443718.1|230057_231587_-	tryptophan 7-halogenase	NA	M4T1E3	Cyanophage	29.0	3.5e-47
WP_011407300.1|231696_234729_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012443720.1|235027_238066_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257219.1|238230_239283_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240491.1|239451_239697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008573820.1|245022_245226_-	YdcH family protein	NA	NA	NA	NA	NA
WP_099051259.1|245759_246861_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	2.5e-42
WP_109182027.1|249584_250550_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012443726.1|251228_252266_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_011260790.1|252773_253784_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_011409777.1|253972_254818_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.7	3.7e-06
WP_011260788.1|254977_256183_+	aminotransferase	NA	NA	NA	NA	NA
WP_011409775.1|256235_256568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409774.1|256616_257354_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	31.1	1.5e-19
WP_027704185.1|257350_258823_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011260784.1|259109_260291_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_011409772.1|260362_261646_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_012443732.1|261642_262629_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_011260781.1|262673_263951_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_011260780.1|263947_264568_-	helix-turn-helix transcriptional regulator	NA	A0A0K1LLP9	Caulobacter_phage	41.9	1.9e-07
WP_012443733.1|264710_268418_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_033013610.1|268612_268975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443735.1|269071_269248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260776.1|269509_270427_+	AEC family transporter	NA	NA	NA	NA	NA
WP_011409768.1|270779_271412_+	ParA family protein	NA	A0A142F1W4	Mycobacterium_phage	36.6	1.6e-09
WP_027704183.1|271427_271904_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011260773.1|271907_272480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260772.1|272476_274492_+	phospholipase D family protein	NA	NA	NA	NA	NA
WP_011260771.1|274790_275219_+	hotdog fold thioesterase	NA	NA	NA	NA	NA
WP_011409766.1|275338_276142_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_011260769.1|276201_277191_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011409765.1|277604_279677_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011409764.1|279871_280483_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_011260766.1|281636_282443_-	META domain-containing protein	NA	NA	NA	NA	NA
WP_011260765.1|282579_283377_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_011260764.1|283598_285008_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_011260763.1|285284_285623_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_027704182.1|285645_287088_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	32.2	2.0e-31
WP_011260761.1|287358_288414_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011409760.1|288406_289834_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_027704181.1|290332_290935_+	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
WP_027704180.1|291005_291638_+	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_115893000.1|291920_292886_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260755.1|292973_293510_-|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.1	1.2e-10
WP_011260754.1|293568_294096_-|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_011409756.1|294164_294710_-|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_044756255.1|301064_302300_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|302753_303968_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
>prophage 4
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	328690	395059	5093052	transposase,tRNA	Staphylococcus_prophage(16.67%)	42	NA	NA
WP_164994094.1|328690_329647_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.1e-41
WP_109182069.1|329749_331069_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182041.1|331197_331995_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260727.1|332028_332709_-	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_011409734.1|332801_333878_+	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260725.1|333887_335009_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_075240212.1|335074_336199_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|336192_336956_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010374782.1|337836_338013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187716.1|338888_339687_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260718.1|340103_341138_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409728.1|341169_342657_-	MFS transporter	NA	NA	NA	NA	NA
WP_011409727.1|342755_345689_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012443772.1|346150_347452_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409725.1|348868_349846_+	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_075240000.1|349886_351305_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_012443777.1|351531_352587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260709.1|353564_355037_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_012443780.1|355259_357974_-	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260707.1|357976_359677_-	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_011409724.1|359676_360936_-	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011409723.1|360947_362912_-	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_075240653.1|362908_365104_-	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_011409721.1|365279_366347_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259480.1|366572_367910_-	xylose isomerase	NA	NA	NA	NA	NA
WP_012443789.1|368513_369431_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011260701.1|369494_370400_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_011409719.1|371026_371812_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409718.1|372082_372541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240508.1|372621_373377_-	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409716.1|373474_374440_-	ferrochelatase	NA	NA	NA	NA	NA
WP_011409715.1|374594_375497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240507.1|375569_375797_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_044756277.1|375812_376454_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_011260694.1|376450_377206_+	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_012443793.1|377357_378257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409712.1|378316_379069_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_094187753.1|379612_380411_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_113328208.1|380551_389335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260689.1|389720_391535_-	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_012443796.1|391624_392533_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011409707.1|392821_395059_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	533972	597527	5093052	transposase,tRNA	Burkholderia_virus(14.29%)	41	NA	NA
WP_011409629.1|533972_534485_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	68.8	1.6e-44
WP_164994096.1|536173_540103_-	avirulence protein	NA	NA	NA	NA	NA
WP_011409622.1|543424_546112_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_125168769.1|546301_547207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_125168768.1|547266_547938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113101711.1|548043_549145_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	6.7e-40
WP_011409617.1|549503_549794_-	DUF2782 domain-containing protein	NA	NA	NA	NA	NA
WP_012443905.1|549870_552672_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	30.4	2.4e-65
WP_011407237.1|552751_553708_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011260560.1|554677_555577_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_164994097.1|556691_557834_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	2.4e-96
WP_011260556.1|561058_562897_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_011409612.1|563071_563338_+	proteinase inhibitor	NA	NA	NA	NA	NA
WP_011409611.1|563363_563909_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_012443910.1|564380_565688_+	MFS transporter	NA	NA	NA	NA	NA
WP_011409609.1|565826_567086_+	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_027703952.1|567514_568048_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260548.1|569669_569828_-	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_012443914.1|569892_570903_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A0E3FNQ3	Synechococcus_phage	32.2	4.5e-14
WP_075240670.1|571131_572802_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_011409606.1|573120_573504_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011260544.1|573725_574628_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_012443916.1|574624_577126_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_164994098.1|577901_579839_-|transposase	IS1595 family transposase	transposase	A0A2K5B2C1	Erysipelothrix_phage	37.3	5.3e-40
WP_011260541.1|579835_580999_-	Fic family protein	NA	NA	NA	NA	NA
WP_011260540.1|581070_582087_-	3-oxoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010370565.1|582188_582509_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_011409604.1|582894_583356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260538.1|583382_583859_+|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_011260537.1|584200_585424_-	MFS transporter	NA	NA	NA	NA	NA
WP_011260536.1|585528_586140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443920.1|586241_586985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260534.1|587175_588522_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260533.1|588506_589949_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011260531.1|592082_592679_+	Ax21 family protein	NA	NA	NA	NA	NA
WP_011409602.1|593001_594027_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_011260529.1|594042_594558_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_011260528.1|594667_595102_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_011409601.1|595177_595600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703675.1|595628_596099_-	thioesterase	NA	NA	NA	NA	NA
WP_154741244.1|596561_597527_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	612964	676359	5093052	transposase	Acinetobacter_phage(37.5%)	49	NA	NA
WP_075240727.1|612964_613771_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164994170.1|614302_618112_-	RHS repeat protein	NA	NA	NA	NA	NA
WP_069965005.1|621885_623262_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_027704002.1|623410_625123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704001.1|625312_627544_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_164994171.1|628147_629250_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.2e-42
WP_075240081.1|629298_629973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409581.1|630678_631260_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_011260499.1|631412_632042_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409580.1|632159_633197_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260497.1|633333_634131_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409579.1|634123_634840_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260495.1|635160_635853_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011260494.1|635990_636785_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011409578.1|636944_637259_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260492.1|637541_638195_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011260491.1|638380_638809_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005990700.1|638812_639205_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260490.1|639753_640371_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_027703893.1|640451_640667_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003483093.1|641009_641480_+	bacterioferritin	NA	NA	NA	NA	NA
WP_109182013.1|641492_642458_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187805.1|642536_643516_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	1.9e-38
WP_011260487.1|643675_646876_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_011409574.1|647152_647629_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_011260485.1|647645_648599_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011260484.1|648637_650242_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011409573.1|650222_650396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443948.1|650392_650989_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260481.1|651027_651903_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443949.1|652002_652221_-	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_012443950.1|652281_653001_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_011260478.1|653028_653604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260477.1|653614_654778_+	heme A synthase	NA	NA	NA	NA	NA
WP_011409570.1|654780_655677_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_044757138.1|656065_657646_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_033013369.1|657829_658876_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_059317500.1|659100_659367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443953.1|659366_659531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264539.1|659823_661038_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.4e-54
WP_012443955.1|662430_663399_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	2.5e-99
WP_164994099.1|663669_665058_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703945.1|665779_666109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240100.1|666137_667154_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075240099.1|667144_668545_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_012446194.1|669669_670950_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257545.1|670949_671216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257546.1|671184_671565_-	response regulator	NA	NA	NA	NA	NA
WP_133264952.1|675039_676359_-|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	758463	815258	5093052	transposase	Enterobacteria_phage(26.67%)	52	NA	NA
WP_115862296.1|758463_759429_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|760415_761651_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_027703991.1|761856_763128_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011407585.1|763335_765165_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.5	1.3e-133
WP_011257638.1|765546_766020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257639.1|766251_766827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|766859_767622_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407588.1|767873_768398_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_011257643.1|768554_769661_-	copper resistance protein B	NA	NA	NA	NA	NA
WP_069970174.1|769657_771466_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_011257645.1|771573_771990_-	CopL family metal-binding regulatory protein	NA	NA	NA	NA	NA
WP_011407590.1|772125_773229_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_075239273.1|773272_775297_+	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_033013277.1|775470_776292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257649.1|776405_777614_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_011407593.1|777613_778129_-	3-hydroxyacyl-[acyl-carrier-protein] dehydratase FabA	NA	NA	NA	NA	NA
WP_044757112.1|778474_779554_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_011407595.1|779695_780346_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011257653.1|780657_781056_-	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011407596.1|781052_781535_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_011407597.1|781859_782534_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_011407598.1|782648_782984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703598.1|783176_783530_-	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_011407600.1|783942_785325_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.3	1.4e-55
WP_019301777.1|785417_785543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257658.1|785704_786694_+	fumarylacetoacetate hydrolase	NA	NA	NA	NA	NA
WP_012446110.1|786737_787400_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_011407601.1|787738_788872_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_033003790.1|788970_789354_+	DUF4398 domain-containing protein	NA	NA	NA	NA	NA
WP_011257662.1|789350_790241_+	membrane protein	NA	NA	NA	NA	NA
WP_003484103.1|790582_790801_+	YdcH family protein	NA	NA	NA	NA	NA
WP_075239874.1|791042_792413_+	pyridoxal-phosphate dependent enzyme	NA	A0A1X9I5F1	Streptococcus_phage	38.8	3.4e-49
WP_075240432.1|792503_793697_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_011257666.1|793743_794544_+	FkbM family methyltransferase	NA	H8ZJI6	Ostreococcus_tauri_virus	28.0	3.5e-06
WP_011407605.1|794578_795655_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SG19	Hokovirus	21.8	4.9e-11
WP_011407606.1|796686_797613_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_024744691.1|797633_797924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257668.1|797914_799078_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257669.1|799083_800136_+	acyltransferase	NA	A9YX16	Burkholderia_phage	33.9	1.5e-41
WP_011407237.1|800163_801120_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_109182077.1|801281_802601_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_082323225.1|802916_804101_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	2.9e-41
WP_011407610.1|804630_805944_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011407611.1|805933_806752_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257674.1|806974_807916_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011257675.1|807915_808662_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011407612.1|808887_809943_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011407613.1|809998_810886_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407614.1|810882_811440_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407615.1|811436_812345_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_011257680.1|812461_813865_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407616.1|813911_815258_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
>prophage 8
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	827522	850876	5093052	transposase,tRNA	Ralstonia_phage(33.33%)	17	NA	NA
WP_011257693.1|827522_829217_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012446090.1|829328_829733_-	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_011407623.1|829864_830638_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|830648_831116_+	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_075240696.1|831112_831595_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011407913.1|832375_833590_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011258802.1|835045_836014_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_164994100.1|836163_837483_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027704044.1|837787_839761_+	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_011257702.1|840027_841068_-	pectate lyase	NA	NA	NA	NA	NA
WP_164994101.1|841387_842707_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_129215559.1|842843_843812_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	3.9e-100
WP_117231489.1|844024_845344_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239157.1|845394_845712_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_099051304.1|845894_846997_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	6.5e-43
WP_027704099.1|847623_847926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257710.1|847933_850876_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
>prophage 9
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	892237	958235	5093052	transposase,protease	Staphylococcus_prophage(10.0%)	51	NA	NA
WP_164994102.1|892237_893194_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.0	1.8e-41
WP_011257741.1|899349_899640_-	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407655.1|899654_900689_-	type I-C CRISPR-associated endonuclease Cas1	NA	NA	NA	NA	NA
WP_011257743.1|900691_901324_-	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011257744.1|901343_902210_-	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257745.1|902206_904051_-	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257746.1|904047_904722_-	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_011257747.1|904849_907141_-	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_154741240.1|907252_908218_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257750.1|908608_909184_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_011407659.1|909296_909806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239764.1|909904_910099_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011257752.1|910188_911166_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_011257753.1|911395_911836_+	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257754.1|912113_913058_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_011407660.1|913140_913884_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_010368407.1|914088_914328_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407661.1|914469_915705_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_075239763.1|915875_917231_+	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011257758.1|917291_918365_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_075239762.1|918361_919321_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257760.1|919317_919671_+	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_075240501.1|920360_921002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703726.1|921515_921842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703727.1|922078_923677_-	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011257763.1|923822_924719_+	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_012446045.1|924794_925949_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257765.1|926129_928721_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012446043.1|928804_928972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407669.1|929043_929181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257767.1|929453_930653_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407672.1|931152_933369_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703871.1|933447_934446_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011257770.1|934555_934738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964984.1|935717_938705_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182786.1|938879_939827_+	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_075243014.1|940325_940862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445794.1|941107_942343_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|943040_943838_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182785.1|944768_945731_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	1.5e-43
WP_012446027.1|945870_946431_-	bacterioferritin	NA	NA	NA	NA	NA
WP_011257779.1|946473_946956_-	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	36.2	3.1e-21
WP_011407679.1|947118_947595_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_075239834.1|948005_948905_+	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	4.5e-18
WP_011257782.1|949144_949531_+	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011407680.1|950160_951288_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_027703756.1|951287_952151_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011257785.1|952445_952631_+	DUF2065 family protein	NA	NA	NA	NA	NA
WP_012446024.1|952968_954261_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	37.7	6.4e-74
WP_012446023.1|954586_957259_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	28.0	3.4e-77
WP_011257788.1|957452_958235_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	971078	1136205	5093052	transposase,integrase,protease	Ralstonia_phage(11.54%)	112	1105784:1105800	1142461:1142477
WP_115862292.1|971078_972044_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027703665.1|973035_973920_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257806.1|974040_975489_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_011257807.1|975556_976204_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_075240515.1|977020_978094_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_011407690.1|978424_979987_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011407691.1|979983_981108_-	threonine dehydratase	NA	NA	NA	NA	NA
WP_011257810.1|981183_981441_-	acetolactate synthase	NA	NA	NA	NA	NA
WP_011257811.1|981424_983146_-	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257812.1|983189_984191_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011407693.1|985467_987345_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_041182781.1|987770_990122_+	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_011407695.1|990232_991126_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027703666.1|991174_994141_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011257817.1|994755_995904_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011257818.1|996017_996554_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011407697.1|996750_997233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240516.1|997525_999430_-	sodium-translocating pyrophosphatase	NA	NA	NA	NA	NA
WP_133265471.1|999480_1000437_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182120.1|1000433_1000607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446005.1|1000891_1001383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257827.1|1003062_1004319_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_011257828.1|1004478_1005042_+	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_075240718.1|1005408_1006767_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_053501459.1|1006766_1007363_+|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257831.1|1007509_1008394_+	membrane protein	NA	NA	NA	NA	NA
WP_099051302.1|1009366_1010165_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|1011602_1012366_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164994103.1|1012376_1013558_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	6.7e-54
WP_164994104.1|1013624_1014387_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|1014455_1016033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877379.1|1016334_1017300_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|1017388_1018152_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182069.1|1019148_1020468_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187763.1|1020563_1021362_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|1021549_1022473_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_164994105.1|1023217_1024537_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012445986.1|1028994_1029135_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|1029224_1030115_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_069959761.1|1030728_1031964_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407706.1|1034287_1034806_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_075240541.1|1035334_1037458_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257841.1|1037705_1039088_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_011257840.1|1039188_1040316_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_075240540.1|1041238_1041709_-	DUF2127 domain-containing protein	NA	NA	NA	NA	NA
WP_011257837.1|1041727_1043557_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_014502175.1|1043800_1044295_+	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.1	8.5e-27
WP_014502176.1|1044410_1045397_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_164994106.1|1046337_1047135_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164994107.1|1048240_1049455_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_011258802.1|1049876_1050845_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407721.1|1051105_1051567_-	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012445975.1|1052115_1052358_-	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_094187715.1|1052351_1053115_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_103057581.1|1053147_1053876_-	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
WP_011409312.1|1055108_1055750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260131.1|1057520_1058891_-	MFS transporter	NA	NA	NA	NA	NA
WP_012445971.1|1058989_1061029_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_011260129.1|1061236_1062259_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011409308.1|1062674_1063772_+	OmpA family protein	NA	NA	NA	NA	NA
WP_014502190.1|1063964_1064474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260126.1|1064493_1065354_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_011260125.1|1065699_1066908_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.5	1.3e-20
WP_011260124.1|1066998_1068096_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011260123.1|1068099_1068960_+	sulfate ABC transporter permease subunit CysT	NA	NA	NA	NA	NA
WP_011260122.1|1068956_1069910_+	sulfate ABC transporter permease subunit CysW	NA	NA	NA	NA	NA
WP_027703808.1|1069917_1070952_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	3.4e-25
WP_011260120.1|1071305_1072019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409305.1|1072088_1073111_-	L-threonine 3-dehydrogenase	NA	NA	NA	NA	NA
WP_012445964.1|1073625_1075959_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409302.1|1078170_1080321_+	S46 family peptidase	NA	NA	NA	NA	NA
WP_041182256.1|1080412_1081057_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012445958.1|1082028_1083327_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_027703645.1|1083394_1084477_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011409299.1|1084691_1085438_+	CvpA family protein	NA	NA	NA	NA	NA
WP_011409298.1|1085468_1086935_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	39.7	1.8e-85
WP_069965093.1|1087073_1087898_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011260109.1|1089001_1089421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069970147.1|1089600_1090344_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_011260107.1|1090991_1091534_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011260106.1|1091514_1092651_-	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_011409293.1|1092855_1094382_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_011260104.1|1094553_1096656_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_012445946.1|1096771_1098100_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	33.8	3.8e-29
WP_011260102.1|1098172_1098862_-	phosphate regulon transcriptional regulatory protein PhoB	NA	W8CYM9	Bacillus_phage	36.2	3.4e-34
WP_027703647.1|1099042_1100749_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445944.1|1100838_1101147_+	glutaredoxin 3	NA	A0A2L0UZG6	Agrobacterium_phage	43.2	4.7e-07
WP_012445943.1|1101143_1101539_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_094187737.1|1101689_1102442_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|1102443_1103409_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257874.1|1103672_1104680_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_011257875.1|1104823_1105585_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
1105784:1105800	attL	TCGGGGGTTCGAATCCC	NA	NA	NA	NA
WP_012445939.1|1108902_1110195_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|1110287_1110914_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|1111038_1112325_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|1112468_1114940_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|1115153_1115426_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|1116257_1118228_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_041182774.1|1118940_1120119_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|1120115_1120883_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1120895_1121552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1121579_1122032_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1122040_1122775_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_012445930.1|1123210_1123915_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_011407730.1|1124741_1125371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1126263_1126464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075250438.1|1126859_1129583_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.3	9.7e-72
WP_059317525.1|1129650_1131801_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	2.0e-27
WP_044757078.1|1131797_1133495_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_011257899.1|1133814_1134372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264549.1|1134454_1135420_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1135518_1136205_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
1142461:1142477	attR	GGGATTCGAACCCCCGA	NA	NA	NA	NA
>prophage 11
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	1228731	1381044	5093052	transposase	Xanthomonas_phage(33.33%)	111	NA	NA
WP_094187796.1|1228731_1229529_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407791.1|1229677_1229977_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_011257986.1|1230105_1232277_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	38.8	2.8e-13
WP_011257987.1|1232356_1232737_+	RidA family protein	NA	NA	NA	NA	NA
WP_011257988.1|1232757_1234911_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_012445867.1|1235036_1235975_+	inosine-uridine preferring nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005911911.1|1236046_1236289_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_011407793.1|1236502_1237792_+	citrate synthase	NA	NA	NA	NA	NA
WP_011407794.1|1238166_1238817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257992.1|1239126_1241556_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_011407795.1|1241771_1242830_+	pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_011257994.1|1242829_1243588_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_011257995.1|1243584_1244250_+	type 4a pilus biogenesis protein PilO	NA	NA	NA	NA	NA
WP_011257996.1|1244246_1244780_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_011407796.1|1244799_1246749_+	type IV pilus secretin PilQ family protein	NA	NA	NA	NA	NA
WP_115862288.1|1246894_1247929_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445859.1|1248551_1249571_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_011258001.1|1249591_1250554_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|1250556_1251018_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_011258003.1|1251014_1252022_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_027703586.1|1252018_1253836_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1253832_1255590_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1255885_1256203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445856.1|1256451_1257681_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011258007.1|1257907_1259908_+	transketolase	NA	NA	NA	NA	NA
WP_011258009.1|1260726_1261443_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_080496166.1|1261445_1262438_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_075239970.1|1262757_1265472_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_075239969.1|1265601_1266777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703582.1|1269045_1269693_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_027703581.1|1269689_1271189_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407814.1|1271185_1271860_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_011407815.1|1271859_1272699_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1273365_1274064_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1274081_1275443_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1275542_1275908_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240387.1|1275897_1277220_+	TonB family protein	NA	NA	NA	NA	NA
WP_011407822.1|1277216_1277801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1278143_1278758_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1278757_1279450_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075239967.1|1279460_1280237_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1280307_1281138_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012445839.1|1281151_1281925_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_011407587.1|1283329_1284364_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_153296750.1|1286114_1286255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1286911_1287913_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_094187715.1|1288300_1289063_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115877377.1|1289152_1290118_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1290227_1291547_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1292009_1292687_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1292766_1293156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|1293380_1294179_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407835.1|1294221_1295109_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_012445831.1|1295542_1296523_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.5	3.7e-98
WP_011407838.1|1296697_1298785_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1298936_1299596_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_094187758.1|1299676_1300474_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240398.1|1300496_1300676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258045.1|1300694_1301099_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258046.1|1301132_1301492_+	DUF3829 domain-containing protein	NA	NA	NA	NA	NA
WP_011258047.1|1301735_1302608_-	ion transporter	NA	NA	NA	NA	NA
WP_011258048.1|1302680_1303907_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	25.1	4.0e-17
WP_011407842.1|1304153_1304771_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_041182545.1|1306766_1307723_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258050.1|1308969_1309395_+	cytochrome c	NA	NA	NA	NA	NA
WP_011407846.1|1309419_1309923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407850.1|1311365_1311815_+	azurin	NA	NA	NA	NA	NA
WP_011258802.1|1315068_1316037_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_027703881.1|1316365_1317655_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_027703880.1|1317940_1321120_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_164994108.1|1321616_1322486_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.8	5.5e-29
WP_012445821.1|1322507_1323179_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	36.8	3.1e-24
WP_012444927.1|1323175_1323352_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_164994109.1|1323570_1327698_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407856.1|1327921_1328221_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_041182100.1|1328224_1328419_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_041182761.1|1331913_1332213_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	92.4	1.9e-45
WP_133265475.1|1332216_1332411_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	4.3e-19
WP_133265476.1|1332679_1336174_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408491.1|1336314_1336614_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_164994110.1|1336617_1336812_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	90.2	1.3e-18
WP_011407856.1|1341747_1342047_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	93.5	9.9e-47
WP_012445814.1|1342050_1342245_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	8.8e-20
WP_164994111.1|1342513_1346227_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182004.1|1347401_1347635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258066.1|1347698_1348763_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_011407864.1|1348777_1349029_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_011258068.1|1349330_1350443_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_011258069.1|1350439_1350982_-	shikimate kinase	NA	NA	NA	NA	NA
WP_011258070.1|1351148_1351748_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_012445807.1|1351928_1352345_+	YjfI family protein	NA	NA	NA	NA	NA
WP_011258072.1|1352357_1353131_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_027703610.1|1353156_1354239_+	potassium channel protein	NA	NA	NA	NA	NA
WP_027703609.1|1354235_1354913_+	YjfK family protein	NA	NA	NA	NA	NA
WP_011407869.1|1354950_1355355_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_011407870.1|1355367_1355940_+	DUF1190 domain-containing protein	NA	A0A191ZBZ0	Erwinia_phage	27.7	1.1e-09
WP_011258077.1|1355941_1357108_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	42.1	5.8e-74
WP_011258079.1|1359087_1359534_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_011407873.1|1359753_1361760_+	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_027703605.1|1362806_1365965_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703604.1|1366296_1367049_+	SapC family protein	NA	NA	NA	NA	NA
WP_012445799.1|1367059_1368106_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011258084.1|1368146_1369664_+	tryptophan 7-halogenase	NA	A0A1D7SEI2	Cyanophage	32.3	8.1e-52
WP_011258085.1|1369701_1370706_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012445797.1|1370850_1371249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258087.1|1371811_1373209_-	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_011407881.1|1373648_1375031_-	APC family permease	NA	NA	NA	NA	NA
WP_011407882.1|1375223_1375988_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011258090.1|1376301_1377243_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_011258091.1|1377998_1379387_+	amino acid permease	NA	NA	NA	NA	NA
WP_012445794.1|1379808_1381044_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	1410229	1455899	5093052	transposase,tRNA	Ralstonia_phage(16.67%)	34	NA	NA
WP_164994112.1|1410229_1411261_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407897.1|1411580_1413074_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_005919170.1|1413273_1413606_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_164994113.1|1415383_1415734_+	HutD family protein	NA	NA	NA	NA	NA
WP_011258802.1|1415828_1416797_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258133.1|1419538_1421122_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_027704032.1|1421369_1422419_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|1422706_1423498_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_109181928.1|1423783_1424749_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407905.1|1425050_1426427_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_012445764.1|1427999_1429070_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011407908.1|1429060_1429858_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|1429967_1430225_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407909.1|1430268_1430781_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011407910.1|1430853_1431633_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005989873.1|1431756_1432164_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011407911.1|1432789_1434280_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407912.1|1434620_1435028_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011407913.1|1435447_1436662_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407915.1|1437987_1438263_-	glutathione transferase	NA	NA	NA	NA	NA
WP_011258151.1|1438292_1438598_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_011407916.1|1439043_1441629_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.4	3.8e-126
WP_041182015.1|1441753_1442665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181892.1|1442695_1442845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994172.1|1442939_1444041_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.1e-42
WP_075240592.1|1445900_1447778_+	TonB-dependent vitamin B12 receptor	NA	A0A0P0I887	Acinetobacter_phage	29.5	4.9e-06
WP_011258160.1|1449550_1450144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703819.1|1450143_1450743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258162.1|1450739_1451351_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011258163.1|1451864_1452386_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_011407923.1|1452382_1453429_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258165.1|1453425_1454016_+	fructose 2,6-bisphosphatase	NA	NA	NA	NA	NA
WP_011258166.1|1454012_1454747_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_011407237.1|1454942_1455899_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 13
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	1484440	1552152	5093052	transposase	Acidithiobacillus_phage(14.29%)	53	NA	NA
WP_164994114.1|1484440_1485916_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.1	5.9e-100
WP_075239369.1|1486967_1487759_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012445725.1|1488214_1488385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182747.1|1488520_1489951_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012445723.1|1490163_1492032_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	1.5e-15
WP_075240033.1|1492056_1494381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408522.1|1497170_1498355_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_075239694.1|1498446_1499799_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011258198.1|1499864_1500800_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_075240153.1|1500866_1501466_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011407947.1|1501500_1502361_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407948.1|1502378_1503419_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_075240393.1|1503445_1504768_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075240152.1|1504767_1505922_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_133265479.1|1506199_1506451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258205.1|1510009_1510339_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011258206.1|1510335_1510875_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011258207.1|1511083_1512328_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258208.1|1512324_1513587_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011407952.1|1513586_1514351_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	28.9	1.6e-11
WP_011258210.1|1514608_1516066_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407954.1|1516081_1516540_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1516711_1517179_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407955.1|1517283_1517502_+	peptidase	NA	NA	NA	NA	NA
WP_099051294.1|1517608_1517989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|1518106_1518703_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_011407957.1|1518758_1519301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407958.1|1519358_1519700_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_042464628.1|1519757_1520399_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258216.1|1520504_1520930_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_164994115.1|1521574_1522894_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407961.1|1522964_1523825_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011407962.1|1523868_1524561_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011258220.1|1524924_1525962_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011407963.1|1526075_1527206_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_027703695.1|1527477_1528152_+	YitT family protein	NA	NA	NA	NA	NA
WP_011407966.1|1528775_1529348_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_011258225.1|1530623_1531190_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_011407969.1|1531182_1531650_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_011258227.1|1531663_1532611_+	aspartate carbamoyltransferase catalytic subunit	NA	NA	NA	NA	NA
WP_011258228.1|1533057_1533492_+	OsmC family protein	NA	NA	NA	NA	NA
WP_027703692.1|1533644_1534244_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_012445697.1|1534531_1535413_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_027703691.1|1536512_1539122_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_011258234.1|1539105_1539564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258235.1|1539560_1540916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240383.1|1540896_1542303_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258237.1|1542619_1543414_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258238.1|1543598_1544597_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011258239.1|1544872_1545409_+	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_041182545.1|1546200_1547157_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_109181945.1|1548306_1549070_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182741.1|1551186_1552152_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	1573692	1639097	5093052	plate,transposase	uncultured_virus(12.5%)	45	NA	NA
WP_011408522.1|1573692_1574877_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_131824951.1|1576565_1577168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240692.1|1577164_1579333_-	peptidoglycan DD-metalloendopeptidase family protein	NA	Q5ZGC9	Flavobacterium_phage	38.6	2.1e-16
WP_164994174.1|1581882_1582671_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_075240701.1|1583655_1584735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994116.1|1584731_1586165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240699.1|1586173_1587253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994175.1|1587249_1588737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994176.1|1588796_1591529_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075250819.1|1591635_1592424_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_011259947.1|1592423_1593758_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_075240219.1|1593909_1594518_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_012445672.1|1594904_1595393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003467601.1|1595439_1595940_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_011259943.1|1595943_1597440_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003467612.1|1597581_1598079_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_011259942.1|1598226_1598715_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_014502420.1|1598717_1600553_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_012445670.1|1600516_1601608_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_075240732.1|1601693_1604426_+	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.6	5.5e-91
WP_011259938.1|1604456_1604810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133264720.1|1604902_1607665_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.5	1.7e-44
WP_080493548.1|1607606_1608512_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164994117.1|1608530_1611398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704271.1|1611406_1612423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994177.1|1612907_1614917_+	DUF3784 domain-containing protein	NA	NA	NA	NA	NA
WP_041182737.1|1614925_1615957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994178.1|1616404_1618417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143701103.1|1618494_1619457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994086.1|1619721_1619913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182735.1|1620668_1621424_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_011259930.1|1622152_1622416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240669.1|1622422_1622731_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_113124214.1|1622764_1623271_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_075240667.1|1624166_1625711_-	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.4	8.9e-14
WP_075240666.1|1625757_1626756_-	Abi family protein	NA	NA	NA	NA	NA
WP_075240665.1|1626895_1630369_-	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	22.2	2.5e-08
WP_075240664.1|1630678_1630942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240663.1|1630948_1631257_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075240002.1|1631335_1633717_+	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_075240662.1|1633780_1634416_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075240661.1|1634415_1635138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240660.1|1635142_1636612_+	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.6	1.6e-28
WP_075240659.1|1636608_1638150_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_041182545.1|1638140_1639097_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 15
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	1678335	1747048	5093052	transposase,tRNA	Prochlorococcus_phage(14.29%)	42	NA	NA
WP_133264714.1|1678335_1679337_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_033013623.1|1679474_1682315_+	DUF2339 domain-containing protein	NA	NA	NA	NA	NA
WP_011409146.1|1682311_1683670_+	DUF3999 domain-containing protein	NA	NA	NA	NA	NA
WP_027704219.1|1684003_1685179_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_011259886.1|1685175_1685820_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409145.1|1686076_1687543_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_012445622.1|1688139_1689144_+	fructose-bisphosphate aldolase class I	NA	A0A0K0KVJ8	Prochlorococcus_phage	48.5	1.0e-79
WP_012445621.1|1689345_1689885_-	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	42.6	2.9e-28
WP_027704220.1|1690080_1690587_-	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_011259881.1|1690902_1691862_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	49.0	3.8e-79
WP_075240596.1|1691878_1693084_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_044756573.1|1693251_1694235_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075240597.1|1694245_1694527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445617.1|1695596_1696793_-	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_012445616.1|1697115_1697553_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_041182223.1|1697747_1699751_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_012445614.1|1699750_1701343_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_075240494.1|1701478_1702204_-	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_075240493.1|1702200_1703922_-	assimilatory sulfite reductase (NADPH) hemoprotein subunit	NA	NA	NA	NA	NA
WP_011409142.1|1704030_1705878_-	assimilatory sulfite reductase (NADPH) flavoprotein subunit	NA	NA	NA	NA	NA
WP_011259870.1|1706058_1706967_+	sulfate adenylyltransferase subunit CysD	NA	NA	NA	NA	NA
WP_011409141.1|1706966_1708943_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	30.6	5.6e-29
WP_011409140.1|1709377_1710448_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259867.1|1710444_1713570_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.8	7.0e-74
WP_042465131.1|1713921_1716591_+	M1 family metallopeptidase	NA	A0A0P0IY26	Acinetobacter_phage	48.5	9.6e-242
WP_109182027.1|1717470_1718436_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409134.1|1719783_1720695_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_094187715.1|1723768_1724531_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445603.1|1724663_1725086_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_011409129.1|1725146_1725860_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011259856.1|1728906_1729182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409127.1|1729441_1729783_+	Rieske (2Fe-2S) protein	NA	NA	NA	NA	NA
WP_011259854.1|1729840_1731703_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_011259853.1|1731778_1732537_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_011409125.1|1732838_1733633_-	thiazole synthase	NA	NA	NA	NA	NA
WP_011259851.1|1734168_1734369_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_012445601.1|1734559_1736344_+	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_027704094.1|1740809_1741202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409118.1|1741292_1741685_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_133264712.1|1741717_1742468_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|1742468_1743425_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_094187728.1|1746250_1747048_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	1952519	2050521	5093052	transposase,tRNA,protease	Acidithiobacillus_phage(15.0%)	84	NA	NA
WP_011408249.1|1952519_1954106_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_012445254.1|1954286_1956077_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1956183_1956984_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1957014_1957392_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_075239775.1|1957381_1958062_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1958058_1958958_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1959181_1959904_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_011408250.1|1960052_1960775_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_027703339.1|1960933_1962268_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.7e-29
WP_011258607.1|1962442_1962940_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_154741248.1|1963035_1964271_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_044756425.1|1964499_1965876_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	63.2	1.9e-79
WP_041182416.1|1965995_1966679_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_012445246.1|1966695_1967730_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_012445245.1|1967910_1969488_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_075239886.1|1969604_1970609_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_011408257.1|1970608_1971163_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_041182080.1|1971248_1972001_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1972087_1972294_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_011258616.1|1973828_1974473_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_011258617.1|1974462_1976964_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_011258618.1|1976960_1978565_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_011258619.1|1978561_1978795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445237.1|1978791_1979814_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1980150_1980516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408267.1|1980512_1981103_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011408268.1|1981200_1982910_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1983018_1983345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1983574_1983919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258625.1|1984041_1985217_-	thiolase family protein	NA	NA	NA	NA	NA
WP_011258626.1|1985372_1988201_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1988261_1989362_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_041182081.1|1989829_1990357_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258629.1|1990758_1990932_+	DUF1328 domain-containing protein	NA	NA	NA	NA	NA
WP_011258630.1|1991092_1991347_-	DUF2789 domain-containing protein	NA	NA	NA	NA	NA
WP_094187763.1|1991368_1992167_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|1992406_1993375_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011258631.1|1993533_1993800_+	DksA/TraR family C4-type zinc finger protein	NA	A0A193GYU8	Escherichia_phage	54.5	1.5e-17
WP_011407237.1|1994673_1995630_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_094187763.1|1996402_1997200_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_099051302.1|1997905_1998703_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1999681_1999867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445232.1|2000056_2001433_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_069964916.1|2001572_2002046_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_154741230.1|2002221_2003457_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408279.1|2003704_2004754_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|2004868_2005204_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|2005492_2005783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239735.1|2006673_2007792_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|2008012_2009224_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|2009786_2010242_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_011408284.1|2010515_2011118_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|2011153_2011762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|2011821_2012016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258647.1|2012085_2013456_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_012445224.1|2014079_2016644_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|2017624_2017972_+	RidA family protein	NA	NA	NA	NA	NA
WP_012445221.1|2018134_2019205_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011258653.1|2019222_2020005_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258654.1|2020001_2020547_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|2020543_2021839_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011408295.1|2021835_2022720_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_027704227.1|2022719_2023970_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011408297.1|2023966_2024965_-	acyl-CoA desaturase	NA	G4YAW5	Emiliania_huxleyi_virus	30.6	2.3e-18
WP_012445217.1|2025190_2026024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258659.1|2026020_2026584_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|2026642_2027011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258660.1|2027096_2027879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445213.1|2028497_2028926_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_012445212.1|2028927_2029524_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258663.1|2029727_2031812_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|2032036_2032486_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_164994118.1|2033249_2034302_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	41.4	1.7e-64
WP_012445208.1|2034580_2035978_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|2035974_2036952_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|2037133_2039071_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|2039491_2040268_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|2040272_2040947_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_117231565.1|2042570_2043947_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011408311.1|2043986_2044382_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_164993844.1|2044424_2045900_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_011408313.1|2046697_2047114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|2047127_2047298_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_109181970.1|2049555_2050521_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2072080	2143007	5093052	transposase,coat,protease	Flavobacterium_phage(12.5%)	56	NA	NA
WP_094187763.1|2072080_2072879_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445188.1|2073001_2075368_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_012445187.1|2075451_2076798_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|2076824_2078015_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|2078017_2078845_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|2078841_2079603_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|2079620_2080178_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|2080358_2081081_-	UMP kinase	NA	NA	NA	NA	NA
WP_011408325.1|2081137_2081515_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2081642_2082521_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2082690_2083494_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2083869_2084595_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2084597_2084930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258703.1|2084976_2086011_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_012445179.1|2086007_2088359_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_075240497.1|2088375_2089146_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2089154_2089679_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011258707.1|2089998_2090775_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011408332.1|2090771_2093381_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_012445174.1|2093397_2094594_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408334.1|2095056_2095413_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_011408335.1|2095409_2095910_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_011408336.1|2095914_2097045_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011258712.1|2097339_2099034_+	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_027703366.1|2099102_2100155_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_075240052.1|2100585_2102712_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012445169.1|2104109_2106527_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_033013399.1|2106622_2107159_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011258717.1|2107614_2109858_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.7	1.1e-81
WP_011258718.1|2109918_2110770_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012445167.1|2110891_2111332_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012445166.1|2111328_2112846_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_027703877.1|2112856_2114050_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258722.1|2114056_2115637_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_027703878.1|2115687_2116422_+	serine hydrolase	NA	NA	NA	NA	NA
WP_099051283.1|2116418_2117182_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258724.1|2117376_2117625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258728.1|2121136_2121400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240557.1|2121642_2122635_+	glycosyl transferase	NA	NA	NA	NA	NA
WP_011258730.1|2122671_2124588_-	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_075239812.1|2124985_2125675_-	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	5.4e-11
WP_075239811.1|2125947_2127741_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258733.1|2127778_2128255_-	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_011258734.1|2128967_2129471_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	42.6	3.4e-23
WP_011258735.1|2129531_2129963_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_011408349.1|2129976_2130252_+	RnfH family protein	NA	NA	NA	NA	NA
WP_011258737.1|2130598_2130994_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_011408351.1|2131098_2131509_+	ferric iron uptake transcriptional regulator	NA	NA	NA	NA	NA
WP_012445154.1|2131951_2133616_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_012445153.1|2133753_2134785_+	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_011258741.1|2134885_2135404_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_075240558.1|2135545_2137471_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.0	7.6e-148
WP_011258743.1|2137630_2138761_+	molecular chaperone DnaJ	NA	Q8QNB4	Ectocarpus_siliculosus_virus	30.0	1.4e-24
WP_075240559.1|2139291_2140200_+	pyridoxal kinase	NA	NA	NA	NA	NA
WP_053503592.1|2140196_2141318_+	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_109182117.1|2141687_2143007_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2163140	2219038	5093052	transposase,tRNA	Ralstonia_phage(16.67%)	40	NA	NA
WP_094187736.1|2163140_2163903_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408367.1|2165355_2166759_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_027703710.1|2166881_2167304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703709.1|2167936_2168773_-	DUF4097 family beta strand repeat protein	NA	NA	NA	NA	NA
WP_044756884.1|2168782_2169769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445132.1|2169765_2170641_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.9	3.3e-13
WP_014502778.1|2170637_2171000_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042464800.1|2171002_2171251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408372.1|2171386_2171944_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_027703707.1|2172035_2173001_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011258776.1|2173026_2174376_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	40.6	1.4e-79
WP_011258777.1|2174368_2174605_+	protein SlyX	NA	NA	NA	NA	NA
WP_011258778.1|2174605_2175358_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_027703705.1|2175691_2176537_+	transporter	NA	NA	NA	NA	NA
WP_027703704.1|2176677_2177853_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258781.1|2177866_2179177_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_012445125.1|2179173_2180160_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_011258783.1|2180156_2181362_+	AGE family epimerase/isomerase	NA	NA	NA	NA	NA
WP_154741193.1|2181458_2182415_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	1.4e-41
WP_012445124.1|2182806_2185560_-	methionine synthase	NA	NA	NA	NA	NA
WP_011258785.1|2185702_2186842_-	5-methyltetrahydrofolate--homocysteine methyltransferase	NA	A0A140XBC7	Dickeya_phage	66.7	2.2e-17
WP_011258786.1|2186838_2187834_-	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	46.9	3.7e-05
WP_027703703.1|2187922_2189104_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011258788.1|2189103_2189244_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_041182915.1|2189615_2191061_+	acetylhydrolase	NA	M1HKG7	Acanthocystis_turfacea_Chlorella_virus	25.8	1.8e-08
WP_012445121.1|2191627_2194156_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	34.0	3.1e-64
WP_012445119.1|2195383_2196151_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_011258442.1|2196203_2197439_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_164994120.1|2197623_2198592_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.1e-99
WP_011258799.1|2202560_2202743_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_011258800.1|2202891_2204091_-	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_133264696.1|2205912_2207127_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	34.0	2.8e-55
WP_109181957.1|2207930_2208896_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187738.1|2210912_2212015_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.6e-36
WP_027704061.1|2212201_2212669_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445101.1|2213029_2213689_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_011258822.1|2213800_2215150_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_094187728.1|2215299_2216098_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_133264694.1|2216537_2217857_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2218069_2219038_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 19
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2236995	2303560	5093052	transposase,tRNA	uncultured_Mediterranean_phage(38.46%)	46	NA	NA
WP_164994123.1|2236995_2238384_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_164994124.1|2238508_2239538_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408651.1|2239626_2241531_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_075240370.1|2241771_2242392_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011259147.1|2242388_2242895_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_024743916.1|2242941_2243439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240711.1|2243497_2243680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014502923.1|2243670_2243955_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_075240710.1|2243951_2245745_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_164994125.1|2245751_2246783_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|2247062_2247826_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259142.1|2248222_2248855_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011259140.1|2251739_2252861_+	phytase	NA	NA	NA	NA	NA
WP_041182545.1|2254309_2255266_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011408814.1|2256780_2257095_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_157724569.1|2257027_2257981_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182637.1|2258141_2258531_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_164994126.1|2263415_2266178_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.8	4.6e-45
WP_012444637.1|2266186_2267116_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011407237.1|2269445_2270402_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_109182069.1|2270685_2272005_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2272217_2273186_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011259129.1|2275353_2276061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408639.1|2276131_2276446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259128.1|2276405_2277902_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|2278025_2278457_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|2278636_2279707_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|2279776_2280922_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259124.1|2281053_2281407_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_012444775.1|2281603_2283448_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259122.1|2283542_2284511_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_027703909.1|2284591_2284900_-	recombinase	NA	NA	NA	NA	NA
WP_155297139.1|2287572_2288961_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407609.1|2289210_2290395_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_044756859.1|2290445_2291507_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181923.1|2291743_2293063_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259117.1|2293133_2293769_-	ribonuclease T	NA	NA	NA	NA	NA
WP_012444782.1|2294052_2294448_-	RcnB family protein	NA	NA	NA	NA	NA
WP_011408630.1|2294580_2295291_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259114.1|2295419_2296250_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011259113.1|2296272_2297142_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_011259112.1|2297141_2298116_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_012444785.1|2298228_2299320_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_012444786.1|2299505_2300525_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	2.1e-48
WP_012444787.1|2300713_2301964_-	porin	NA	NA	NA	NA	NA
WP_094187715.1|2302797_2303560_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2393043	2523550	5093052	transposase,protease	uncultured_Caudovirales_phage(17.86%)	94	NA	NA
WP_164994127.1|2393043_2394420_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.7	7.1e-63
WP_075240550.1|2396980_2398165_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_011408568.1|2398202_2399123_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011259034.1|2399738_2401106_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
WP_011259033.1|2401109_2401595_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011259032.1|2401630_2402446_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
WP_011259031.1|2402442_2403285_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259030.1|2403463_2403844_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_011259029.1|2403840_2405355_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011259028.1|2405513_2405858_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011408563.1|2406718_2408674_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_069965084.1|2409107_2411720_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_075240030.1|2411712_2411970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408561.1|2411979_2413542_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_011259023.1|2413786_2415643_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041182436.1|2416969_2419159_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_012444858.1|2419287_2421066_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_011408557.1|2422266_2422875_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_044756845.1|2423208_2423397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2423580_2423895_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_075239902.1|2423945_2424779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444862.1|2424845_2425346_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703344.1|2425437_2426016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2426177_2426678_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011259011.1|2428202_2428916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703343.1|2429167_2429407_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|2431863_2432349_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|2432499_2433279_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|2433467_2435348_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011259006.1|2435681_2437199_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_011408550.1|2437517_2437970_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_042464880.1|2441018_2441228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239903.1|2442000_2442210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259000.1|2442973_2443948_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_027704049.1|2444114_2444348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704112.1|2448153_2448672_+	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	40.7	6.8e-27
WP_115862273.1|2450407_2451727_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_128415445.1|2451777_2452284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994128.1|2452716_2453925_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	32.3	2.8e-15
WP_011258802.1|2453935_2454904_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258802.1|2456311_2457280_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_044756833.1|2458506_2459721_-|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.1e-54
WP_069959772.1|2459971_2461447_+|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	1.6e-100
WP_012444885.1|2461497_2462517_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027703901.1|2462800_2464381_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_027703900.1|2465591_2465939_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012444889.1|2465935_2466466_+	arsenate reductase ArsC	NA	A0A2H4J8A6	uncultured_Caudovirales_phage	42.6	1.8e-27
WP_012444890.1|2466476_2466890_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	68.2	8.6e-41
WP_012444891.1|2466886_2467612_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	3.1e-86
WP_012444892.1|2467630_2468935_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	59.2	8.3e-130
WP_026144156.1|2469198_2469555_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_012444894.1|2470550_2473511_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_044756830.1|2474505_2477901_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_011258994.1|2478115_2478496_-	response regulator	NA	NA	NA	NA	NA
WP_164994129.1|2478763_2478940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239633.1|2479125_2479515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703995.1|2479511_2479715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|2479757_2480520_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444902.1|2482157_2482817_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_011258990.1|2482872_2484789_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_011258989.1|2484891_2485611_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_011258988.1|2485607_2486615_-	glucokinase	NA	NA	NA	NA	NA
WP_011408534.1|2486611_2488042_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	34.5	2.2e-67
WP_011258986.1|2488463_2489561_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.1	2.2e-22
WP_011408533.1|2489689_2490562_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_005929790.1|2490601_2490772_+	DUF1674 domain-containing protein	NA	NA	NA	NA	NA
WP_011258985.1|2490831_2491227_+	succinate dehydrogenase, cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_011258984.1|2491223_2491610_+	succinate dehydrogenase, hydrophobic membrane anchor protein	NA	NA	NA	NA	NA
WP_012444909.1|2491644_2493435_+	succinate dehydrogenase flavoprotein subunit	NA	NA	NA	NA	NA
WP_027703324.1|2493444_2493648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408532.1|2493664_2494447_+	succinate dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_011408531.1|2494557_2494806_+	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_014503500.1|2494756_2495209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010378794.1|2495232_2496474_+	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011258980.1|2496466_2497201_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	34.5	1.0e-31
WP_115862272.1|2498594_2499560_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|2499813_2502222_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|2502250_2502913_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|2502916_2503381_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|2503377_2505147_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|2505143_2506184_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258972.1|2506475_2507255_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|2507251_2507716_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012444920.1|2507739_2509158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258969.1|2509154_2511011_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|2511010_2511643_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444921.1|2512117_2512624_-	glyoxalase	NA	NA	NA	NA	NA
WP_115877396.1|2512790_2513777_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	4.0e-36
WP_164994130.1|2514741_2515698_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	1.4e-41
WP_011408520.1|2516755_2517427_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.9	5.2e-27
WP_012444927.1|2517423_2517600_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_011408930.1|2522058_2522358_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	90.2	3.2e-45
WP_012444931.1|2522361_2522556_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_094187715.1|2522786_2523550_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2529629	2597073	5093052	transposase,tRNA	Xanthomonas_phage(58.33%)	53	NA	NA
WP_041182117.1|2529629_2529815_+	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	93.4	8.6e-25
WP_012444935.1|2529814_2530018_+	hypothetical protein	NA	A0A1W6DXK4	Xanthomonas_phage	70.3	6.1e-16
WP_011258952.1|2530153_2531227_+	replication protein	NA	S0F3F7	Stenotrophomonas_phage	40.9	5.0e-64
WP_011408494.1|2531331_2531631_+	single-stranded DNA-binding protein	NA	S0F3B2	Stenotrophomonas_phage	54.2	3.4e-23
WP_011408495.1|2531994_2532234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057497.1|2532340_2533825_+	hypothetical protein	NA	A0A1D6ZIU5	Xanthomonas_phage	40.2	1.4e-40
WP_133264529.1|2533925_2535245_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075240566.1|2535345_2535624_+	DUF2523 domain-containing protein	NA	NA	NA	NA	NA
WP_011258954.1|2535620_2536805_+	hypothetical protein	NA	A0A1W6DXR3	Xanthomonas_phage	37.4	2.3e-54
WP_080493496.1|2536859_2537030_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	56.0	2.5e-10
WP_075240059.1|2538138_2538399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408511.1|2538878_2539061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168751.1|2539182_2539494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187742.1|2539527_2540273_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|2540273_2541230_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_012444939.1|2541614_2542340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033013458.1|2542329_2544195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057499.1|2544472_2545225_+	Type II secretory pathway, component ExeA	NA	NA	NA	NA	NA
WP_113022320.1|2545761_2546688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994132.1|2550107_2553821_+	avirulence protein	NA	NA	NA	NA	NA
WP_012444931.1|2554089_2554284_+	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	79.0	1.3e-18
WP_011408491.1|2554287_2554587_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_133264592.1|2554810_2558668_+	avirulence protein	NA	NA	NA	NA	NA
WP_011258948.1|2559253_2559874_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_011258947.1|2559863_2560640_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_011258946.1|2560633_2561368_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_011258945.1|2561364_2561967_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_011258944.1|2561963_2563091_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_027703958.1|2563087_2564179_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_011258942.1|2564175_2565471_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_011258941.1|2565467_2566382_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_011258940.1|2566391_2566718_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011257310.1|2567363_2568599_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_012444952.1|2569655_2571068_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.2	3.0e-40
WP_027703964.1|2572332_2573076_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_011258935.1|2573178_2574483_-	threonine synthase	NA	NA	NA	NA	NA
WP_024710669.1|2574644_2574959_+	EthD family reductase	NA	NA	NA	NA	NA
WP_011258933.1|2577894_2578863_-	homoserine kinase	NA	NA	NA	NA	NA
WP_011408482.1|2578859_2581367_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_044756815.1|2582669_2584202_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011408481.1|2584790_2585075_+	DUF4190 domain-containing protein	NA	NA	NA	NA	NA
WP_164994133.1|2585077_2585845_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011258927.1|2585850_2586906_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_011408479.1|2586902_2587955_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_012444967.1|2587948_2588860_+	DMT family transporter	NA	NA	NA	NA	NA
WP_012444969.1|2589050_2589185_+	aspartate racemase	NA	NA	NA	NA	NA
WP_041182545.1|2589744_2590701_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011258923.1|2590798_2591962_+	MFS transporter	NA	NA	NA	NA	NA
WP_011408475.1|2592102_2592834_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011408474.1|2592814_2594080_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011408473.1|2594200_2595427_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011258919.1|2595423_2595990_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_069964884.1|2596041_2597073_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2657891	2701420	5093052	transposase	Staphylococcus_prophage(16.67%)	36	NA	NA
WP_011407237.1|2657891_2658848_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_012445007.1|2662768_2663092_-	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703552.1|2663088_2663388_-	YciI family protein	NA	NA	NA	NA	NA
WP_010372932.1|2663739_2664645_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_012445010.1|2664658_2665858_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	4.0e-22
WP_011408433.1|2665850_2667491_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011258859.1|2667700_2668138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258858.1|2668253_2669072_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_109181928.1|2669234_2670200_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_075240103.1|2670220_2671024_-	amidohydrolase	NA	NA	NA	NA	NA
WP_075240104.1|2671163_2672312_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_075240105.1|2672538_2673183_+	heme ABC exporter ATP-binding protein CcmA	NA	G3M9Y6	Bacillus_virus	26.3	8.2e-14
WP_075240106.1|2673179_2673875_+	heme exporter protein CcmB	NA	NA	NA	NA	NA
WP_012445013.1|2673969_2674722_+	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_011258852.1|2674718_2674889_+	heme exporter protein CcmD	NA	NA	NA	NA	NA
WP_011258851.1|2674885_2675356_+	cytochrome c maturation protein CcmE	NA	NA	NA	NA	NA
WP_027703720.1|2675524_2677462_+	heme lyase CcmF/NrfE family subunit	NA	NA	NA	NA	NA
WP_011258849.1|2677454_2678057_+	DsbE family thiol:disulfide interchange protein	NA	NA	NA	NA	NA
WP_011258848.1|2678053_2678485_+	cytochrome c-type biogenesis protein CcmH	NA	NA	NA	NA	NA
WP_012445015.1|2678484_2679498_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_075240567.1|2679787_2681659_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_014503189.1|2681655_2681955_-	DUF2388 domain-containing protein	NA	NA	NA	NA	NA
WP_075240568.1|2681989_2683408_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011258842.1|2683616_2684858_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.7e-103
WP_027703722.1|2685006_2685594_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_033013325.1|2685739_2687212_+	amino acid permease	NA	NA	NA	NA	NA
WP_075240569.1|2687288_2688719_+	amino acid permease	NA	NA	NA	NA	NA
WP_011258838.1|2688807_2689485_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_044756804.1|2689496_2690063_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_075240570.1|2690065_2690764_+	acireductone synthase	NA	NA	NA	NA	NA
WP_044756803.1|2691089_2692175_+	peptidase C13	NA	NA	NA	NA	NA
WP_011258529.1|2694874_2695843_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_094187728.1|2695951_2696749_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2697567_2698725_+	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_115877372.1|2699001_2699967_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_133265498.1|2699944_2701420_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	53.7	1.3e-75
>prophage 23
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2824769	2960745	5093052	transposase,tRNA,protease	Staphylococcus_prophage(13.04%)	99	NA	NA
WP_041182719.1|2824769_2825726_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_155296426.1|2825700_2825904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240117.1|2828157_2832195_-	type IV secretion protein Rhs	NA	S5W9C6	Leptospira_phage	36.8	6.8e-13
WP_154741191.1|2833469_2838440_-	glutamate synthase	NA	NA	NA	NA	NA
WP_041182545.1|2838530_2839487_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_164994136.1|2840302_2841778_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	8.6e-99
WP_128415342.1|2842271_2842751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259260.1|2850884_2851277_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_011259261.1|2851285_2851747_+	cytochrome c	NA	NA	NA	NA	NA
WP_153296779.1|2852167_2852566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408705.1|2853300_2853477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_118886850.1|2854269_2855235_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408707.1|2855241_2856540_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408708.1|2856708_2858394_-	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_075239845.1|2858390_2860127_-	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	8.2e-16
WP_033013282.1|2860278_2861379_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259267.1|2861427_2861691_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011259269.1|2862069_2862180_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_012444741.1|2862400_2863666_+	MFS transporter	NA	NA	NA	NA	NA
WP_075240553.1|2863646_2865560_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_011408714.1|2865927_2867172_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011408715.1|2867357_2868512_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011259275.1|2868525_2868786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408716.1|2868785_2869151_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011408717.1|2869150_2870446_-	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_041182650.1|2870569_2871520_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_075240554.1|2872132_2873476_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_011259280.1|2873515_2874616_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_075240555.1|2874608_2875061_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2875302_2876544_-	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_011259283.1|2876615_2877641_-	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_027703614.1|2877953_2878448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444736.1|2878624_2880049_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_011408724.1|2880546_2880984_+	SufE family protein	NA	NA	NA	NA	NA
WP_011259287.1|2880980_2882231_+	MFS transporter	NA	NA	NA	NA	NA
WP_011259288.1|2882298_2883360_-	S41 family peptidase	NA	NA	NA	NA	NA
WP_075239838.1|2883502_2884531_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_033013281.1|2884615_2884903_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075239837.1|2884899_2886249_+	dihydroorotase	NA	NA	NA	NA	NA
WP_075240556.1|2886248_2887088_+	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259294.1|2887962_2888226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444728.1|2888597_2889086_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_129593080.1|2889309_2890629_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2890765_2891734_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187777.1|2892718_2893516_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444725.1|2894461_2895643_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_041182896.1|2897227_2898898_+	polygalacturonase	NA	NA	NA	NA	NA
WP_011259304.1|2899114_2899804_-	phytoene synthase	NA	NA	NA	NA	NA
WP_011408736.1|2899832_2900537_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259306.1|2900610_2901330_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_027703270.1|2901360_2902698_-	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_041182450.1|2902717_2903521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002802373.1|2903712_2904279_-	elongation factor P	NA	NA	NA	NA	NA
WP_075239847.1|2904380_2905409_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_011259310.1|2905627_2907745_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259311.1|2907741_2908671_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011408739.1|2908722_2909487_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011408740.1|2909605_2910439_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011259314.1|2910691_2911303_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011259315.1|2911557_2911998_+	ribonuclease	NA	NA	NA	NA	NA
WP_011259316.1|2911994_2912420_+	barstar family protein	NA	NA	NA	NA	NA
WP_027703271.1|2912868_2914764_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.8e-48
WP_011259318.1|2914853_2916230_+	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_012444712.1|2916332_2916893_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	2.7e-29
WP_011408741.1|2916990_2918547_-	YdiU family protein	NA	NA	NA	NA	NA
WP_011408742.1|2918830_2919706_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075240433.1|2919906_2920605_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014503077.1|2920776_2920986_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	60.7	1.1e-15
WP_011408745.1|2921254_2921740_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011259325.1|2921810_2922359_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_011259326.1|2922355_2923537_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_012444707.1|2923760_2925830_+	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_012444706.1|2925929_2926808_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012444705.1|2926905_2927805_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_011408747.1|2927892_2928633_+	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_027703272.1|2928792_2929368_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408749.1|2929541_2930513_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_027703274.1|2930546_2931500_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_011259334.1|2931499_2933377_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.4e-85
WP_011408751.1|2933514_2935248_-	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_011259336.1|2935300_2935801_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011259337.1|2935797_2937285_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_011408752.1|2937309_2938377_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011408753.1|2938522_2939860_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_011259340.1|2940155_2941418_-	virulence factor	NA	NA	NA	NA	NA
WP_113001983.1|2941634_2942382_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182165.1|2942698_2944534_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.1	5.6e-23
WP_011408756.1|2944805_2945897_+	ribonuclease D	NA	NA	NA	NA	NA
WP_011259345.1|2946989_2947391_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_015463309.1|2948254_2948434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703932.1|2949035_2949326_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011408759.1|2949313_2949592_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703931.1|2950076_2950277_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011407237.1|2950526_2951483_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011408397.1|2952095_2953280_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_109181970.1|2953860_2954826_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_042465594.1|2959390_2959735_+	DUF3301 domain-containing protein	NA	NA	NA	NA	NA
WP_011408764.1|2959945_2960272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259352.1|2960304_2960745_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	46.2	9.3e-25
>prophage 24
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	2967957	3148984	5093052	transposase,tRNA	uncultured_Caudovirales_phage(21.88%)	119	NA	NA
WP_041182646.1|2967957_2969412_+|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_011408767.1|2969835_2970822_+	PhoH family protein	NA	W8D063	Erwinia_phage	47.7	2.5e-46
WP_075240641.1|2971233_2971896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703624.1|2971950_2972436_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011408769.1|2972435_2972954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444677.1|2973048_2973927_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011259366.1|2973923_2975204_+	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_011259367.1|2975219_2976221_+	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_033013286.1|2976372_2977737_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_027703622.1|2977991_2978402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259369.1|2978557_2979388_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_075240166.1|2979701_2980949_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	9.0e-25
WP_075240640.1|2981094_2982588_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011408778.1|2982592_2984179_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011408779.1|2984175_2985378_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_115877355.1|2985884_2987204_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444669.1|2987507_2988893_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_012444667.1|2989800_2991180_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_075240386.1|2991179_2992496_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_011259379.1|2992578_2993877_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.4	2.7e-19
WP_027703942.1|2994184_2995465_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_011408785.1|2995770_2996049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259381.1|2996038_2998387_-	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_011259382.1|2998383_2999229_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_027703776.1|2999235_3000930_-	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_012444660.1|3001459_3002812_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_027703775.1|3002872_3006010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240385.1|3006176_3007031_+	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	39.8	6.4e-14
WP_027703774.1|3007201_3008506_+	DUF445 family protein	NA	NA	NA	NA	NA
WP_027703773.1|3008647_3012742_+	response regulator	NA	A0A1V0SGX0	Hokovirus	28.4	1.1e-55
WP_027703772.1|3012775_3013762_+	response regulator	NA	W8CYM9	Bacillus_phage	27.6	9.7e-06
WP_012444654.1|3013886_3014870_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	2.0e-96
WP_012444652.1|3015318_3020343_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_027703873.1|3020620_3021280_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444649.1|3021294_3022599_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_012444648.1|3022611_3025782_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011257851.1|3026757_3027723_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|3028429_3029425_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075239925.1|3029585_3032102_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|3032098_3033055_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|3033213_3034956_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|3035133_3036411_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011258802.1|3037077_3038046_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_164994137.1|3038188_3039577_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_164994138.1|3039816_3042162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115877351.1|3042315_3043635_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3043834_3044803_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182623.1|3044854_3045130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182297.1|3045133_3046096_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_041182624.1|3046643_3047381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994139.1|3047403_3049746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704080.1|3049763_3050495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444487.1|3050522_3053357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444488.1|3053353_3054283_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164994140.1|3058618_3061210_-	avirulence protein	NA	NA	NA	NA	NA
WP_075240580.1|3061249_3061639_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_157724569.1|3061799_3062753_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408814.1|3062685_3063000_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_011408815.1|3063227_3064547_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_155296585.1|3065113_3065410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240159.1|3066028_3066259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994141.1|3066516_3067485_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	3.6e-98
WP_041182294.1|3067740_3068703_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_075239854.1|3069648_3070065_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075240676.1|3070061_3070508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080496165.1|3070940_3071207_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	74.1	2.0e-30
WP_075240677.1|3071279_3071654_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.6	4.5e-28
WP_075240678.1|3071625_3072693_-	GNAT family N-acetyltransferase	NA	Q6SE88	Lactobacillus_prophage	36.1	5.5e-55
WP_075239856.1|3073082_3076184_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182176.1|3077173_3077626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182177.1|3077880_3079686_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|3079687_3080035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444621.1|3080110_3080818_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.0	1.4e-51
WP_011259416.1|3080969_3081362_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075239855.1|3081384_3081900_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|3081896_3082250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703782.1|3082338_3083079_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_012444616.1|3083085_3083946_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_011259419.1|3084061_3084844_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011259420.1|3084840_3085863_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|3085963_3086272_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|3086268_3086634_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259422.1|3086667_3088677_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011408830.1|3088844_3089099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_164994179.1|3090269_3090737_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_011407587.1|3090724_3091759_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_075240728.1|3091893_3092583_+	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	2.2e-12
WP_011408833.1|3092898_3093660_+	transporter	NA	NA	NA	NA	NA
WP_075243896.1|3093673_3096016_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	63.2	4.5e-09
WP_109181932.1|3096512_3097478_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_044756755.1|3097717_3099964_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_075240404.1|3100691_3102803_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_143701671.1|3103487_3105563_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_011259431.1|3106157_3108419_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_011259432.1|3108812_3111074_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_075240118.1|3112043_3112829_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3112964_3113447_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_094187763.1|3114295_3115093_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259437.1|3115336_3115660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|3115916_3116951_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408845.1|3119490_3120357_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011259439.1|3120353_3120950_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011259440.1|3120946_3122023_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011408846.1|3122131_3124375_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259442.1|3125030_3125846_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_075239232.1|3126199_3128791_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259444.1|3128856_3129267_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003486316.1|3129263_3129512_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011259446.1|3129659_3132428_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_011259449.1|3133077_3134760_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	7.1e-33
WP_011408848.1|3134936_3135806_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259451.1|3135817_3137995_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408849.1|3138359_3139496_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_044756749.1|3139637_3141155_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.9	2.3e-86
WP_014503214.1|3141358_3142484_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_044756748.1|3142737_3143685_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259457.1|3146493_3147195_+|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_011408855.1|3147355_3147733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|3148027_3148984_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 25
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3199989	3210194	5093052	tRNA	Pseudomonas_phage(28.57%)	9	NA	NA
WP_012444561.1|3199989_3200685_-	replicative DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_012444559.1|3200870_3201170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057523.1|3201557_3202085_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_003481884.1|3202687_3202900_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3203039_3205688_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3205789_3206278_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3206580_3207615_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3207787_3208429_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3208517_3210194_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 26
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3296132	3343065	5093052	plate,transposase	Acidithiobacillus_phage(25.0%)	29	NA	NA
WP_012444515.1|3296132_3297608_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.8	5.4e-101
WP_075246341.1|3297690_3300279_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011259580.1|3300335_3301448_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011259581.1|3301572_3302151_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033013403.1|3303636_3305724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069963868.1|3306110_3307208_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075241920.1|3307624_3310705_+	histidine kinase	NA	NA	NA	NA	NA
WP_033013236.1|3313562_3314270_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3314266_3315259_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_075240417.1|3315255_3317715_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3317828_3318809_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444505.1|3318817_3319846_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012444504.1|3320018_3320345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703483.1|3320341_3323245_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3323241_3323964_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041182189.1|3323960_3324608_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_075240418.1|3324604_3328063_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_075239804.1|3328066_3329383_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_027703478.1|3329384_3330722_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_012444498.1|3330718_3332131_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3332127_3332667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444497.1|3332675_3334613_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.6	3.4e-39
WP_011408952.1|3334877_3335336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168760.1|3335722_3336217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703476.1|3336282_3336780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240419.1|3336968_3339674_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.5e-80
WP_027703474.1|3339706_3340717_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_075238996.1|3340680_3342558_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011259603.1|3342561_3343065_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 27
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3347896	3398142	5093052	transposase	Ralstonia_phage(83.33%)	39	NA	NA
WP_011258529.1|3347896_3348865_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_044756703.1|3349013_3350249_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_154741207.1|3350252_3352211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|3352328_3353285_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075240761.1|3353259_3354033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3354389_3355358_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011258529.1|3355610_3356579_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_075240126.1|3359873_3361703_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
WP_012445381.1|3361716_3362316_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_012445382.1|3362403_3362760_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_012445383.1|3362756_3363179_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445384.1|3363194_3363428_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_103057594.1|3363478_3363715_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_027704270.1|3364063_3365848_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3365880_3366867_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_042465057.1|3367277_3370991_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187765.1|3371516_3372280_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3372383_3373031_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3373252_3374014_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408974.1|3374113_3374479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408975.1|3374537_3374969_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3374980_3376243_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011259626.1|3376226_3377519_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_069964822.1|3377888_3378659_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_117231573.1|3379415_3380651_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3381949_3382207_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3382646_3383630_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_044756692.1|3383882_3384845_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3385094_3385253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3385284_3385464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182196.1|3385828_3386794_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259636.1|3388001_3388979_+	siroheme synthase	NA	NA	NA	NA	NA
WP_012445407.1|3389787_3389982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3391375_3391738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3391721_3392291_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_012445412.1|3392328_3393582_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3393787_3394165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257031.1|3395544_3396513_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_133265483.1|3397344_3398142_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 28
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3447260	3558888	5093052	transposase,tRNA,head,plate,capsid,tail,holin,portal,integrase,terminase	Stenotrophomonas_phage(47.73%)	110	3492396:3492442	3535625:3535671
WP_133264775.1|3447260_3448637_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.1	3.3e-76
WP_011259678.1|3449205_3449715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259679.1|3450143_3450386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033013473.1|3451073_3451322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259680.1|3451401_3452325_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_011409027.1|3452321_3452921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259682.1|3453255_3453576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044756654.1|3453607_3454096_+	BrxE family protein	NA	NA	NA	NA	NA
WP_094187731.1|3454082_3454881_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187768.1|3455023_3456050_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_024743012.1|3457563_3458100_+	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	33.8	4.0e-14
WP_117231630.1|3460890_3461973_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075240564.1|3462090_3463071_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_011259690.1|3463180_3463642_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.0	6.3e-16
WP_075239602.1|3463676_3464471_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_075240563.1|3464475_3465270_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	35.6	3.9e-21
WP_011259693.1|3465306_3466503_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011409038.1|3466567_3468061_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_011259695.1|3468078_3469128_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011259696.1|3469124_3470267_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_094187837.1|3470334_3471411_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011259698.1|3471427_3472519_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_049756340.1|3472515_3473805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409041.1|3473899_3475354_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_075240013.1|3475597_3477037_-	GumC family protein	NA	NA	NA	NA	NA
WP_011259702.1|3477018_3477717_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_005995911.1|3478325_3478682_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002811076.1|3478662_3478962_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.7e-12
WP_011259703.1|3478983_3481362_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012445467.1|3481470_3482466_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	36.0	1.0e-31
WP_012445468.1|3482720_3483080_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|3483090_3483288_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_080098376.1|3483536_3484079_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_011409044.1|3484127_3486032_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	35.7	2.0e-124
WP_153296782.1|3487712_3487850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994146.1|3488099_3489335_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011259712.1|3489644_3491666_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_011259713.1|3491804_3492347_+	fimbrial protein	NA	NA	NA	NA	NA
3492396:3492442	attL	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_048484533.1|3493431_3494163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994147.1|3495356_3498191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024745590.1|3498187_3499114_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164994148.1|3500159_3500570_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_075241110.1|3500566_3501076_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	1.4e-08
WP_075241112.1|3501056_3501398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484937.1|3501411_3502122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080493798.1|3502129_3502891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048484935.1|3503318_3504020_-	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	76.2	1.2e-103
WP_053503138.1|3503937_3504183_-	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_075240423.1|3504208_3505231_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	2.6e-139
WP_164994149.1|3505230_3507015_-|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.5	3.1e-268
WP_047339951.1|3507136_3507979_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.9	1.5e-68
WP_075240426.1|3508025_3509042_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	70.5	5.5e-137
WP_011258475.1|3509045_3509765_+|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	63.4	2.0e-69
WP_012445486.1|3509864_3510332_+|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	49.7	9.2e-31
WP_011258473.1|3510331_3510541_+|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	3.5e-14
WP_011258472.1|3510545_3510902_+	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	56.1	3.5e-22
WP_041182057.1|3510894_3511170_+|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.9e-21
WP_011408146.1|3511169_3511808_+	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_069959805.1|3511807_3512296_+	hypothetical protein	NA	V9IQW8	Stenotrophomonas_phage	51.4	3.2e-26
WP_012445490.1|3512292_3512712_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.7	3.7e-39
WP_075240744.1|3512699_3513149_+	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	56.6	3.5e-35
WP_075240745.1|3513365_3515126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240434.1|3515499_3516390_+|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	53.0	4.4e-82
WP_075240435.1|3516382_3516928_+|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.0	1.6e-50
WP_075240436.1|3516937_3518443_+|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	47.8	5.0e-54
WP_075240437.1|3518450_3519029_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_011408138.1|3519089_3519653_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	44.3	8.2e-26
WP_069959797.1|3519649_3520009_+|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	66.1	5.6e-36
WP_075240438.1|3520020_3521187_+|tail	phage tail sheath protein	tail	E5FFG9	Burkholderia_phage	63.4	3.8e-134
WP_075240439.1|3521217_3521727_+|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_012445500.1|3521771_3522074_+|tail	phage tail assembly protein	tail	V9IQM4	Stenotrophomonas_phage	70.1	2.0e-26
WP_053502988.1|3522082_3522196_+|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	62.9	3.5e-05
WP_075240440.1|3522225_3525096_+|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	48.5	4.9e-199
WP_048483454.1|3525108_3525510_+|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.9	1.0e-38
WP_048483455.1|3525506_3526493_+	phage late control D family protein	NA	E5E3U4	Burkholderia_phage	53.1	2.1e-93
WP_012445504.1|3527100_3527532_-	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	36.4	1.5e-11
WP_041182707.1|3527604_3527865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182927.1|3527867_3528185_+	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	59.8	3.9e-25
WP_048483459.1|3528197_3528476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240441.1|3528693_3531378_+	bifunctional DNA primase/helicase	NA	V9IQW5	Stenotrophomonas_phage	70.6	0.0e+00
WP_012445510.1|3531701_3531920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012445511.1|3531916_3532195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047339974.1|3532184_3532457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182710.1|3532536_3532956_+	hypothetical protein	NA	V9IQL6	Stenotrophomonas_phage	47.4	4.0e-17
WP_041182711.1|3532948_3533131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182712.1|3533123_3533396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008572787.1|3533392_3533617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182713.1|3533613_3533886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182714.1|3533882_3534092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048483467.1|3534306_3535548_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	53.7	3.1e-118
WP_042465105.1|3535754_3536204_-	type IV pilin protein	NA	NA	NA	NA	NA
3535625:3535671	attR	TTGGCGCCCGAAGTTGGACTCGAACCAACGACCCCCTGATTAACAGT	NA	NA	NA	NA
WP_075240442.1|3536216_3540200_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_011259718.1|3540156_3540666_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_011259719.1|3540669_3541836_-	pilus assembly protein PilW	NA	NA	NA	NA	NA
WP_011259720.1|3541832_3542306_-	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_011259721.1|3542302_3542818_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1W6JT76	Pseudomonas_phage	42.5	1.1e-05
WP_011259722.1|3542987_3544373_-	LOG family protein	NA	NA	NA	NA	NA
WP_011259723.1|3544479_3547674_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409048.1|3548431_3549031_-	YhgN family NAAT transporter	NA	NA	NA	NA	NA
WP_011259725.1|3549027_3549771_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259726.1|3549767_3550088_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_011259727.1|3550209_3550788_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	39.1	5.5e-33
WP_011259728.1|3550929_3552075_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_027703386.1|3552071_3552575_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	38.7	3.6e-17
WP_027703385.1|3552633_3552903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024710844.1|3552899_3553787_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_075239927.1|3553850_3554891_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_011259733.1|3555264_3557379_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_003485583.1|3557544_3557805_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_011259734.1|3557961_3558888_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
>prophage 29
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3583067	3684927	5093052	transposase,tRNA,head,plate,capsid,tail,holin,portal,protease,terminase	Stenotrophomonas_phage(41.3%)	103	NA	NA
WP_094187736.1|3583067_3583831_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259756.1|3584854_3587221_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3587217_3587892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3588101_3589040_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3589162_3590512_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3590508_3591396_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_012445542.1|3591715_3592522_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_012445544.1|3592967_3594185_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_033013162.1|3594290_3595259_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	1.1e-09
WP_011259764.1|3595594_3596263_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_075240411.1|3596259_3597033_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075240410.1|3597606_3599559_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3600239_3601265_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3601349_3602423_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3602415_3603519_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_011259772.1|3603529_3604456_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3604536_3605187_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3605183_3606032_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3606582_3608166_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_082322897.1|3609376_3610240_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.3	5.3e-32
WP_153296738.1|3610757_3611045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3611155_3611662_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_075240636.1|3611783_3613154_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_075240637.1|3613083_3614874_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	63.0	5.2e-191
WP_131077961.1|3615741_3616710_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_075240458.1|3616938_3618666_+	DUF262 domain-containing protein	NA	K4JUV4	Caulobacter_phage	40.0	4.9e-05
WP_075240457.1|3618785_3619061_-	hypothetical protein	NA	A8YQQ5	Burkholderia_virus	53.4	1.9e-15
WP_075240455.1|3619326_3619551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240454.1|3619547_3619820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017116242.1|3619812_3619989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010364106.1|3619981_3620392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994087.1|3620480_3620621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258448.1|3620617_3620896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408133.1|3620892_3621111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408134.1|3621419_3624116_-	toprim domain-containing protein	NA	V9IQW5	Stenotrophomonas_phage	69.9	0.0e+00
WP_011258450.1|3624125_3624338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408135.1|3624334_3624613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408136.1|3624623_3624944_-	hypothetical protein	NA	V9IQW3	Stenotrophomonas_phage	57.6	7.4e-24
WP_053503015.1|3624946_3625204_-	DNA-binding protein	NA	A0A2H4JE67	uncultured_Caudovirales_phage	46.4	6.6e-07
WP_011258452.1|3625275_3625713_+	transcriptional regulator	NA	E5E3P4	Burkholderia_phage	32.0	5.4e-09
WP_011258453.1|3626373_3627360_-	phage late control D family protein	NA	V9IQM7	Stenotrophomonas_phage	54.8	2.5e-94
WP_011258454.1|3627356_3627758_-|tail	phage tail protein	tail	V9IQX3	Stenotrophomonas_phage	62.3	6.0e-39
WP_011258455.1|3627770_3630641_-|tail	phage tail tape measure protein	tail	V9IQL1	Stenotrophomonas_phage	49.2	6.4e-207
WP_011258456.1|3630673_3630787_-|tail	GpE family phage tail protein	tail	A0A0M4R2P3	Salmonella_phage	68.6	4.2e-06
WP_011258457.1|3630795_3631098_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	62.6	6.3e-25
WP_011258458.1|3631143_3631653_-|tail	phage major tail tube protein	tail	V9IQX1	Stenotrophomonas_phage	79.9	1.8e-72
WP_075240453.1|3631683_3632850_-|tail	phage tail protein	tail	E5FFG9	Burkholderia_phage	62.1	7.9e-132
WP_075240452.1|3632861_3633221_-|plate	baseplate assembly protein	plate	V9IQW0	Stenotrophomonas_phage	65.3	6.6e-37
WP_075240451.1|3633217_3633781_-|plate	phage baseplate assembly protein V	plate	V9IQH1	Stenotrophomonas_phage	60.0	7.4e-27
WP_075240450.1|3633841_3634420_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_075240449.1|3634429_3635935_-|tail	tail fiber protein	tail	V9IQX0	Stenotrophomonas_phage	46.2	4.0e-51
WP_075240448.1|3635944_3636490_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	54.6	2.1e-50
WP_075240447.1|3636482_3637373_-|plate	baseplate assembly protein	plate	V9IQV9	Stenotrophomonas_phage	52.7	4.4e-82
WP_143700599.1|3637649_3638282_-	DUF2026 family protein	NA	NA	NA	NA	NA
WP_075240753.1|3638557_3639004_-	phage virion morphogenesis protein	NA	V9IQH0	Stenotrophomonas_phage	60.1	1.9e-41
WP_075240752.1|3638991_3639411_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	63.0	6.3e-39
WP_011258469.1|3639407_3639896_-	hypothetical protein	NA	A0A1S5NQ26	Burkholderia_phage	52.8	3.2e-26
WP_011408146.1|3639895_3640534_-	glycoside hydrolase family 19 protein	NA	V9IQK6	Stenotrophomonas_phage	60.9	7.8e-49
WP_024745970.1|3640533_3640809_-|holin	phage holin family protein	holin	V9IQV8	Stenotrophomonas_phage	59.8	3.0e-21
WP_048484874.1|3640801_3641158_-	membrane protein	NA	V9IQG9	Stenotrophomonas_phage	55.3	1.7e-21
WP_048484873.1|3641162_3641372_-|tail	tail protein	tail	K4PAW7	Burkholderia_phage	58.0	5.9e-14
WP_048484872.1|3641371_3641839_-|head	head completion/stabilization protein	head	V9IQW6	Stenotrophomonas_phage	50.3	1.8e-31
WP_048484871.1|3641938_3642658_-|terminase	terminase endonuclease subunit	terminase	Q9ZXM2	Pseudomonas_virus	62.9	7.7e-69
WP_075246015.1|3642661_3643678_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	71.4	2.2e-138
WP_075240425.1|3643724_3644567_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	52.6	1.7e-67
WP_075246298.1|3644688_3646473_+|terminase	terminase ATPase subunit family protein	terminase	V9IQL5	Stenotrophomonas_phage	75.5	1.2e-267
WP_075244554.1|3646472_3647495_+|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	71.5	3.4e-139
WP_053503138.1|3647520_3647766_+	Com family DNA-binding transcriptional regulator	NA	V9IQK2	Stenotrophomonas_phage	51.2	4.1e-14
WP_075246299.1|3647683_3648394_+	site-specific DNA-methyltransferase	NA	V9IQV5	Stenotrophomonas_phage	77.0	3.1e-107
WP_075240685.1|3648468_3649221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240684.1|3649217_3649925_-	hypothetical protein	NA	A4PE25	Ralstonia_virus	36.3	8.2e-07
WP_011408158.1|3649938_3650280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143700600.1|3650260_3650818_-	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	34.4	5.3e-09
WP_048484867.1|3650766_3651177_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_131077961.1|3653097_3654066_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.7	5.1e-100
WP_012445553.1|3655061_3655637_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3655633_3656068_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3656095_3656263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3656858_3657044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3657078_3657648_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3657740_3658592_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3659979_3661995_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3662265_3662964_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3663004_3663412_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_164994150.1|3663849_3664812_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011409084.1|3666096_3667347_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3667354_3668599_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3668826_3669306_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3669416_3669953_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3670062_3670812_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3671019_3671511_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_125168763.1|3671523_3671751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182214.1|3672624_3673944_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_012445565.1|3674088_3675795_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_012445566.1|3675828_3677133_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3677164_3677425_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011259803.1|3677426_3678302_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3680136_3680601_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3680652_3680841_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_069963878.1|3680813_3681134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445571.1|3681130_3682498_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_011409095.1|3682643_3683225_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_012445573.1|3683481_3684927_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 30
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3692919	3752604	5093052	transposase,tRNA	Ralstonia_phage(36.36%)	43	NA	NA
WP_011258802.1|3692919_3693888_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187728.1|3694172_3694970_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240646.1|3695269_3698383_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3699798_3700269_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_162013046.1|3700853_3701297_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3701354_3702470_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3702481_3702898_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|3702954_3703854_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3703850_3704879_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3704901_3705537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3706050_3708693_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3708765_3709377_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_011409107.1|3709581_3710439_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_027703806.1|3710694_3711144_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3711443_3712409_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|3712533_3713296_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_044756598.1|3713906_3714200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3714673_3714907_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3714940_3715954_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3715921_3716113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994151.1|3716133_3717522_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|3717609_3718824_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_011407237.1|3719186_3720143_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011260830.1|3720174_3721410_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3721538_3722507_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182719.1|3722607_3723564_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_143698801.1|3723557_3724094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133265413.1|3724090_3725056_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187771.1|3725296_3726059_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409116.1|3726361_3728494_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_011258802.1|3729044_3730013_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182545.1|3730813_3731770_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_075239868.1|3732057_3732522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756973.1|3737344_3738964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444470.1|3738987_3741234_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_012444469.1|3741458_3743339_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_010365831.1|3743505_3743841_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_033013172.1|3743840_3744467_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_011408097.1|3744469_3746470_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011258402.1|3746469_3747405_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011258401.1|3747918_3748869_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011408096.1|3748957_3749458_-	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258399.1|3749772_3752604_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
>prophage 31
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3803229	3823059	5093052	transposase	Ralstonia_phage(50.0%)	14	NA	NA
WP_115862282.1|3803229_3804549_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182297.1|3804790_3805753_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_158645227.1|3806189_3806492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182719.1|3806525_3807482_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_011408064.1|3809153_3809522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240223.1|3809527_3811036_-	RHS repeat-associated core domain-containing protein	NA	NA	NA	NA	NA
WP_143685531.1|3811037_3811367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125168747.1|3811363_3811663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|3811811_3812780_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168746.1|3812831_3813323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994152.1|3813319_3817810_-	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_113343766.1|3817986_3818970_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.4	3.6e-77
WP_069959761.1|3819451_3820687_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407587.1|3822024_3823059_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 33
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	3994659	4005486	5093052	transposase	Burkholderia_virus(28.57%)	8	NA	NA
WP_027703307.1|3994659_3995463_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	27.3	4.5e-25
WP_041182602.1|3995893_3996076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069965063.1|3996543_3999498_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.1	8.1e-258
WP_011260010.1|3999827_4000277_+	hypothetical protein	NA	A4JWV5	Burkholderia_virus	34.1	3.3e-09
WP_011260011.1|4000273_4000969_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	46.1	2.8e-36
WP_044756504.1|4000976_4002047_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	36.6	9.7e-60
WP_011409252.1|4002043_4003129_+	DUF3396 domain-containing protein	NA	E5E3X8	Burkholderia_phage	37.9	4.0e-61
WP_082322974.1|4004529_4005486_-|transposase	IS30-like element IS1112 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.4	3.1e-41
>prophage 34
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	4049608	4108267	5093052	transposase,tRNA	Bacillus_phage(25.0%)	57	NA	NA
WP_011260048.1|4049608_4050907_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_011260049.1|4050884_4051970_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.3	2.5e-07
WP_012444287.1|4051966_4053673_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011260051.1|4054138_4054657_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_011260052.1|4054689_4055472_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_011260053.1|4055453_4056683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409264.1|4056768_4057035_-	acylphosphatase	NA	NA	NA	NA	NA
WP_012444285.1|4057034_4057637_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011260056.1|4057633_4058911_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005925984.1|4059022_4059619_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_041182600.1|4059615_4059963_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_011409266.1|4060171_4061392_-	xylanase	NA	NA	NA	NA	NA
WP_011409267.1|4061905_4062391_+	asparaginase	NA	NA	NA	NA	NA
WP_012444282.1|4062395_4062869_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_027703427.1|4063076_4064774_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.2	5.3e-28
WP_012444279.1|4065117_4066482_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	35.2	1.1e-31
WP_011260065.1|4068227_4069313_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011260066.1|4069377_4069932_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_011409271.1|4070118_4070538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703428.1|4070652_4070877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187731.1|4071080_4071878_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260068.1|4071792_4073280_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_011409274.1|4073276_4073582_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_012444275.1|4073705_4074275_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012444274.1|4074271_4074622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703741.1|4074627_4075113_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_011409276.1|4075510_4076608_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_011260076.1|4076753_4079093_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011409277.1|4079460_4080036_+	nitroreductase	NA	NA	NA	NA	NA
WP_011260078.1|4080032_4081019_+	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	2.8e-13
WP_011260079.1|4081015_4081567_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011260080.1|4081547_4082345_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_011260081.1|4082545_4083487_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_011409278.1|4083575_4083881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703739.1|4083994_4084372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260082.1|4084382_4084709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260083.1|4084752_4085151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260084.1|4085388_4086234_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010381556.1|4086435_4086999_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011409282.1|4087194_4088787_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_012444268.1|4088878_4089820_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409284.1|4090246_4090678_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_012444266.1|4090740_4091709_+	transaldolase	NA	NA	NA	NA	NA
WP_109181928.1|4092372_4093338_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260092.1|4094770_4095349_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_011409288.1|4095764_4096415_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_044756487.1|4096775_4097990_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.7	8.2e-55
WP_075240588.1|4098510_4099218_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_094187801.1|4100337_4101135_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164994155.1|4101189_4101999_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240879.1|4101981_4102815_+	response regulator	NA	A0A2K9L5I4	Tupanvirus	38.5	3.4e-12
WP_011409313.1|4102811_4103276_+	response regulator	NA	NA	NA	NA	NA
WP_012444257.1|4103390_4103627_-	DUF2007 domain-containing protein	NA	NA	NA	NA	NA
WP_075240758.1|4103628_4104270_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011260138.1|4104674_4106414_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	54.8	9.9e-179
WP_059317428.1|4106606_4106792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4107503_4108267_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	4269206	4288006	5093052	transposase	Staphylococcus_prophage(50.0%)	16	NA	NA
WP_164994181.1|4269206_4270814_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239943.1|4270975_4271239_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_075239687.1|4271243_4271882_+	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	1.9e-10
WP_012444151.1|4272068_4273433_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_012444150.1|4273648_4274344_+	VIT family protein	NA	NA	NA	NA	NA
WP_024712536.1|4274438_4275062_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_048483028.1|4275206_4276004_+	cytochrome c4	NA	NA	NA	NA	NA
WP_048484705.1|4276097_4276748_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260284.1|4276839_4277655_+	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260285.1|4277674_4278442_+	endonuclease	NA	NA	NA	NA	NA
WP_041182719.1|4278540_4279497_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.8	3.7e-42
WP_012444143.1|4280056_4280323_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_094187763.1|4281254_4282053_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187777.1|4282106_4282905_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|4284551_4285784_+	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_041182545.1|4287049_4288006_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
>prophage 36
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	4369628	4418615	5093052	transposase,protease	Erwinia_phage(25.0%)	35	NA	NA
WP_011260359.1|4369628_4370996_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.2e-43
WP_011260360.1|4371100_4371652_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_012444084.1|4372167_4373085_-	tyrosine recombinase XerC	NA	A0A142F2H8	Mycobacterium_phage	27.7	1.3e-12
WP_011409476.1|4373290_4373962_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_011260363.1|4373958_4374813_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_011409477.1|4374802_4375039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409478.1|4375096_4375495_-	YbaN family protein	NA	NA	NA	NA	NA
WP_027703683.1|4375867_4378003_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.1	2.1e-29
WP_011409479.1|4378126_4379311_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_103073476.1|4379636_4380077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409481.1|4380150_4382244_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011409482.1|4382311_4382623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260370.1|4383010_4383580_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_011260371.1|4383688_4384654_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260372.1|4385212_4386013_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_011409484.1|4386563_4387478_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_011409485.1|4387508_4388246_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260375.1|4388276_4389329_-	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.6	1.8e-18
WP_011260376.1|4389333_4390002_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033013308.1|4390153_4392091_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_012446347.1|4393205_4394441_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260378.1|4395214_4396864_-	M28 family peptidase	NA	NA	NA	NA	NA
WP_012444070.1|4398254_4399742_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	1.6e-124
WP_075240643.1|4399949_4401410_+	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.5e-47
WP_012444068.1|4401571_4401892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075240061.1|4401891_4402119_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_143698729.1|4402644_4405269_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_075240063.1|4405523_4408412_+	insulinase family protein	NA	NA	NA	NA	NA
WP_075240064.1|4408959_4409889_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_075240065.1|4409927_4410932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4411174_4411938_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240246.1|4412985_4413771_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_011260388.1|4414024_4415698_+	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_164994158.1|4416114_4417434_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_129215559.1|4417646_4418615_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	3.9e-100
>prophage 37
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	4453765	4557191	5093052	transposase,tRNA,integrase	Ralstonia_phage(18.75%)	91	4502032:4502047	4567343:4567358
WP_011407587.1|4453765_4454800_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409520.1|4457667_4458153_+	DUF962 domain-containing protein	NA	NA	NA	NA	NA
WP_011409522.1|4458691_4461520_+	monovalent cation/H+ antiporter subunit A	NA	NA	NA	NA	NA
WP_024712495.1|4461519_4461894_+	Na+/H+ antiporter subunit C	NA	NA	NA	NA	NA
WP_075239895.1|4461890_4463435_+	monovalent cation/H+ antiporter subunit D	NA	NA	NA	NA	NA
WP_024745838.1|4463431_4463938_+	Na+/H+ antiporter subunit E	NA	NA	NA	NA	NA
WP_011260421.1|4463934_4464219_+	K+/H+ antiporter subunit F	NA	NA	NA	NA	NA
WP_011260422.1|4464215_4464569_+	Na+/H+ antiporter subunit G	NA	NA	NA	NA	NA
WP_011407237.1|4465167_4466124_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|4466596_4467565_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409528.1|4467996_4469322_-	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_012444023.1|4469686_4470802_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011260425.1|4470927_4471416_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011409530.1|4471772_4472363_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_027703915.1|4472374_4473883_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	33.8	1.3e-62
WP_011260428.1|4474325_4475219_-	tryptophan 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_011409533.1|4476564_4477230_+	pyruvate dehydrogenase E1 subunit alpha	NA	NA	NA	NA	NA
WP_164994159.1|4477862_4478828_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_075240757.1|4479360_4479741_+	peptide-binding protein	NA	NA	NA	NA	NA
WP_027703940.1|4479943_4480828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239392.1|4480917_4482213_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_011409538.1|4482342_4482867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260439.1|4483292_4484558_-	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_075240714.1|4484554_4485532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444011.1|4485635_4486439_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_011260442.1|4486614_4487424_+	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_094187731.1|4487431_4488230_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_042465763.1|4488272_4488890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075240531.1|4489014_4489590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239561.1|4489727_4490477_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011260447.1|4490514_4490955_-	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_011409547.1|4491161_4491503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260449.1|4491728_4492106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260450.1|4492316_4492514_-	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_012444006.1|4492820_4493567_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409549.1|4493659_4494466_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_012444005.1|4494689_4496102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703925.1|4496098_4497196_+	dipeptide epimerase	NA	NA	NA	NA	NA
WP_094187728.1|4497350_4498149_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182294.1|4498368_4499331_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011260456.1|4500007_4500784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704068.1|4500780_4502097_+	amino acid permease	NA	NA	NA	NA	NA
4502032:4502047	attL	GGCTTGGCGCTGGTGG	NA	NA	NA	NA
WP_094187715.1|4502155_4502919_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260459.1|4503122_4503404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260461.1|4503964_4504399_-	membrane protein	NA	NA	NA	NA	NA
WP_012443997.1|4504573_4505752_+	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_164994160.1|4506747_4507710_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044756364.1|4508489_4509452_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|4509868_4511104_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4511619_4512585_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260467.1|4513247_4515419_-	beta-glucosidase	NA	NA	NA	NA	NA
WP_011409563.1|4515646_4516003_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260469.1|4516081_4517146_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.1	8.6e-101
WP_002808376.1|4517425_4517641_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_011409564.1|4517948_4518395_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_011409565.1|4518735_4519107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187724.1|4519162_4519926_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012443989.1|4520688_4521651_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011260472.1|4521740_4523489_+	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_133264634.1|4523740_4525060_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239431.1|4525520_4525835_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011257535.1|4525844_4526066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257534.1|4526486_4526699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443985.1|4527037_4527775_+	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_075240619.1|4527785_4530443_+	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|4530439_4531114_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011257530.1|4531110_4531776_+	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|4531977_4532946_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075240171.1|4533020_4535162_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_012443983.1|4535251_4536520_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_027703875.1|4536519_4537956_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407516.1|4537966_4538689_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_109181928.1|4539927_4540893_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|4540928_4541885_-|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011257518.1|4542212_4543010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181951.1|4543006_4544281_-	DNA cytosine methyltransferase	NA	A0A191SB20	Nostoc_phage	37.4	8.3e-58
WP_011257516.1|4544361_4544772_-	DNA mismatch endonuclease Vsr	NA	I6NSG0	Burkholderia_phage	52.0	7.0e-35
WP_011257515.1|4546084_4546243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041181950.1|4546239_4546542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757144.1|4546548_4547634_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_044757145.1|4547635_4547896_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_044757146.1|4547892_4548372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757147.1|4548385_4549105_-	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_164994161.1|4549431_4549782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164994107.1|4549806_4551021_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	4.1e-54
WP_044757149.1|4551096_4551936_-	helix-turn-helix domain-containing protein	NA	R9TPU9	Vibrio_phage	40.0	8.0e-09
WP_015040072.1|4551932_4552172_-	Plasmid-related protein	NA	NA	NA	NA	NA
WP_041181948.1|4552410_4553505_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.6e-52
WP_011407506.1|4554254_4554575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407505.1|4554767_4556642_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_011257505.1|4556750_4557191_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
4567343:4567358	attR	CCACCAGCGCCAAGCC	NA	NA	NA	NA
>prophage 38
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	4569197	4649877	5093052	transposase,tRNA	Moraxella_phage(28.57%)	52	NA	NA
WP_011257494.1|4569197_4570121_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_027703439.1|4570514_4571027_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4571159_4572296_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_075240622.1|4572367_4573510_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4573552_4574026_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_041181947.1|4574066_4574789_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_011257488.1|4574830_4576105_+	RDD family protein	NA	NA	NA	NA	NA
WP_011257487.1|4576287_4578780_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	1.9e-114
WP_011257486.1|4578790_4579354_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4579577_4580351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407496.1|4580347_4581022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4581183_4581960_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4582066_4582282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181946.1|4582467_4584369_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_041181945.1|4584453_4585830_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011257479.1|4586338_4587184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4587514_4588117_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_011257477.1|4588100_4589126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257476.1|4589591_4591814_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4592216_4592732_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407489.1|4593261_4594581_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4595048_4596014_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407487.1|4596198_4596531_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_011407486.1|4596536_4598861_+	cytochrome c biogenesis protein	NA	NA	NA	NA	NA
WP_011407485.1|4599694_4600141_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257470.1|4600239_4600725_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_075240182.1|4600757_4601165_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|4601200_4602568_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011257468.1|4602706_4603072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187861.1|4603068_4603461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407482.1|4603529_4603994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257466.1|4604939_4605881_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_027703754.1|4606027_4606543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257464.1|4606686_4607064_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239516.1|4607774_4608620_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|4608726_4608999_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_151421348.1|4609683_4610649_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_012446211.1|4610645_4610840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|4610909_4611866_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_075240682.1|4614700_4615105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143698779.1|4617656_4618061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239879.1|4622963_4623215_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_075245036.1|4623272_4623518_-	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_164994182.1|4624184_4629713_-	filamentous hemagglutinin	NA	NA	NA	NA	NA
WP_075239876.1|4630449_4630728_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_133264755.1|4630857_4631244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075244762.1|4631277_4634742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994162.1|4634992_4635373_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_133264756.1|4635411_4635822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164994163.1|4635826_4646557_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	35.6	3.6e-37
WP_075240695.1|4646578_4648321_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.7	1.9e-33
WP_164994164.1|4648557_4649877_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP040687	Xanthomonas oryzae pv. oryzae strain IXO1088 chromosome, complete genome	5093052	4792614	4962293	5093052	transposase,holin,tRNA	Tupanvirus(10.53%)	117	NA	NA
WP_011257370.1|4792614_4793904_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011407411.1|4794072_4794282_-	CsbD family protein	NA	NA	NA	NA	NA
WP_011257368.1|4794525_4794660_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_011407410.1|4794723_4794876_-	entericidin A/B family lipoprotein	NA	NA	NA	NA	NA
WP_011407409.1|4794983_4795907_-	arginase	NA	A0A0N9R043	Chrysochromulina_ericina_virus	34.6	2.2e-28
WP_011257366.1|4796228_4796903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257365.1|4796899_4797139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012446308.1|4797145_4797442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257363.1|4797921_4798605_+	dTMP kinase	NA	K7R9G5	Vibrio_phage	33.8	1.3e-14
WP_011407408.1|4799403_4800324_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011257361.1|4800333_4801062_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_011257360.1|4801058_4802024_-	bifunctional biotin--[acetyl-CoA-carboxylase] synthetase/biotin operon repressor	NA	NA	NA	NA	NA
WP_012446311.1|4802381_4802693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704119.1|4803609_4804794_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_012446313.1|4804913_4806503_-	DUF1800 domain-containing protein	NA	NA	NA	NA	NA
WP_011257356.1|4806623_4808039_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_002808458.1|4808068_4808752_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024711526.1|4808823_4809126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257354.1|4809461_4810466_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_012446316.1|4810928_4811153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257351.1|4811873_4812449_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_012446318.1|4812507_4814031_-	catalase	NA	A0A2K9L0T1	Tupanvirus	48.0	2.2e-97
WP_027704121.1|4814721_4815192_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041182811.1|4815354_4816320_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407399.1|4816402_4816669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257345.1|4816942_4819075_-	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011257344.1|4819352_4819502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407398.1|4819536_4819923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257342.1|4819924_4820776_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_027703509.1|4820828_4821710_+	TolB-like protein	NA	NA	NA	NA	NA
WP_011257339.1|4822332_4824867_-	iron-uptake factor	NA	NA	NA	NA	NA
WP_011407395.1|4825100_4825853_+	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_011407394.1|4825980_4826895_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257334.1|4828167_4829160_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027703507.1|4829824_4830283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012446330.1|4830383_4832174_-	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_011257331.1|4832382_4834620_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011257330.1|4835044_4835734_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_011407389.1|4836123_4839138_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407388.1|4839321_4840023_+	SapC family protein	NA	NA	NA	NA	NA
WP_012446335.1|4840012_4841026_+	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_027703504.1|4841036_4842602_+	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	5.6e-40
WP_011407386.1|4842741_4843764_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_011257323.1|4844172_4845366_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446337.1|4845362_4846109_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	1.5e-19
WP_027703503.1|4846140_4847742_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257320.1|4847802_4848003_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703502.1|4847999_4848587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296754.1|4848790_4848952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407380.1|4849072_4849345_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027703501.1|4849410_4850400_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_027703500.1|4850484_4851312_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_011257314.1|4851348_4852344_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_012446343.1|4852361_4853153_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446344.1|4853155_4853905_+	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	4.3e-54
WP_011257570.1|4854422_4855658_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011260830.1|4856708_4857944_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_082323238.1|4857996_4859154_-|transposase	IS5-like element ISXoo14 family transposase	transposase	NA	NA	NA	NA
WP_094187862.1|4861787_4862889_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	4.7e-41
WP_094187782.1|4863649_4864412_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187814.1|4864472_4865270_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407366.1|4865622_4865907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703866.1|4868253_4869363_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_044757204.1|4869597_4870242_+	sterol-binding protein	NA	NA	NA	NA	NA
WP_011257293.1|4870238_4871912_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257292.1|4872025_4872415_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|4872639_4873392_+	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_011407361.1|4873487_4874066_-	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_011257289.1|4874122_4874554_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011257288.1|4874556_4875186_+|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_012446358.1|4875823_4877992_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_027703864.1|4878118_4880281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129215657.1|4881107_4882073_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011257283.1|4884178_4884538_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_011407355.1|4884540_4885842_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_011407354.1|4886022_4886799_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_109181945.1|4886927_4887691_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407353.1|4888091_4888676_+	manganese efflux pump MntP family protein	NA	NA	NA	NA	NA
WP_011257279.1|4888868_4892318_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_075240712.1|4893065_4895708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044757567.1|4895811_4898211_-	NdvB protein	NA	NA	NA	NA	NA
WP_027703801.1|4898213_4899596_-	MFS transporter	NA	NA	NA	NA	NA
WP_075239940.1|4899753_4900338_+	gluconokinase	NA	NA	NA	NA	NA
WP_027703799.1|4901218_4902973_+	PQQ-binding-like beta-propeller repeat protein	NA	A0A0M4JT37	Mollivirus	35.6	9.6e-81
WP_011257273.1|4903280_4903508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407344.1|4903488_4903938_-	3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_011257271.1|4903948_4904377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801909.1|4905871_4907191_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|4910062_4911031_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_117231531.1|4912313_4913633_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|4913925_4915161_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_041182821.1|4916842_4917799_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	3.4e-40
WP_109182116.1|4918643_4919609_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_069965040.1|4919626_4920184_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257259.1|4920202_4920490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407332.1|4920874_4921669_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257257.1|4921668_4922418_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012446379.1|4922429_4922981_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_011257255.1|4922977_4923640_+	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_011257254.1|4923629_4923920_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257253.1|4923930_4924989_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_109182012.1|4926787_4927551_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182545.1|4928991_4929948_+|transposase	IS30-like element IS1112b family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	6.2e-42
WP_011407325.1|4930020_4930836_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.3	6.3e-19
WP_133264763.1|4931710_4932818_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.6	3.7e-38
WP_011257245.1|4940155_4942060_-	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_011407319.1|4942056_4942659_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_143698759.1|4942718_4944023_-	TCR/Tet family MFS transporter	NA	NA	NA	NA	NA
WP_011257243.1|4944578_4946741_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407316.1|4947034_4947241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257241.1|4947448_4947838_-	YchJ family protein	NA	NA	NA	NA	NA
WP_011257239.1|4949181_4950312_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|4950959_4952012_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257237.1|4952774_4953848_-	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011407313.1|4954155_4955214_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_041182826.1|4958029_4958563_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_094187728.1|4961494_4962293_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
