The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	105380	111205	5435743		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|105380_107714_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|107728_108049_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|108045_108273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|108269_108812_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|108814_109081_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|109641_110379_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|110375_110621_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004200806.1|110638_111205_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.2	2.8e-58
>prophage 2
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	1203396	1236654	5435743	tRNA,tail,portal,terminase,head,capsid,integrase,protease	uncultured_Caudovirales_phage(75.0%)	34	1221004:1221021	1236999:1237016
WP_002919147.1|1203396_1204344_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|1204358_1204868_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|1204996_1206121_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|1206092_1206566_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|1206591_1207134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|1207138_1207711_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|1207714_1208533_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|1208529_1208787_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|1208762_1209317_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|1215112_1215334_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|1215627_1218738_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|1218750_1219890_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|1220268_1220919_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
1221004:1221021	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|1221194_1222421_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|1222513_1223455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|1223636_1223921_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|1223931_1224711_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|1225213_1225432_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|1225424_1225613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|1225689_1225818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|1225916_1226285_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|1226281_1226647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|1226646_1228782_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|1229124_1229460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|1229508_1230021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|1230284_1231451_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|1231502_1232063_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|1232064_1233306_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|1233302_1233638_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|1233634_1233934_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|1233933_1234377_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|1234369_1234522_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|1234652_1235009_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|1234992_1236654_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
1236999:1237016	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 3
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	1991929	2038164	5435743	coat,tail,tRNA,portal,lysis,terminase,head,capsid,integrase,plate	Salmonella_phage(83.72%)	61	1990223:1990269	2026790:2026836
1990223:1990269	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1991929_1992955_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1992957_1993587_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1993709_1993952_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1993984_1994494_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1994501_1994702_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1994665_1995004_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1995071_1995305_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1995304_1995532_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1995528_1996380_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004200605.1|1996376_1998761_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
WP_004151011.1|1998923_1999112_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1999123_1999357_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1999452_2000136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|2000122_2001202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|2001201_2002203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|2002724_2002994_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|2003050_2004094_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|2004093_2005857_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|2005997_2006831_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|2006847_2007900_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|2007903_2008557_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|2008652_2009117_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|2009116_2009320_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|2009323_2009539_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|2009519_2010029_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|2010033_2010417_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|2010413_2010842_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|2010816_2010975_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|2010937_2011360_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|2011352_2011799_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|2011821_2012688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|2012782_2013355_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|2013351_2013714_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|2013700_2014609_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|2014601_2015273_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|2015274_2017224_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|2017233_2018352_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|2018403_2019477_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|2019625_2020798_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|2020807_2021323_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|2021375_2021675_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|2021689_2021809_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|2022035_2024432_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|2024428_2024914_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|2024910_2026005_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|2026071_2026290_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|2026317_2026695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|2027298_2027781_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
2026790:2026836	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|2027891_2028368_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|2028357_2028648_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|2028714_2029056_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|2029037_2029178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|2029203_2030865_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|2030951_2031830_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|2031954_2032545_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|2032664_2033951_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|2033970_2034762_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|2034925_2036290_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|2036549_2036798_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|2036816_2037365_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|2037396_2038164_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	2142880	2208964	5435743	transposase,tail,holin,terminase,head,integrase,protease	Salmonella_phage(37.04%)	72	2143875:2143892	2211712:2211729
WP_004151980.1|2142880_2144347_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
2143875:2143892	attL	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
WP_004151979.1|2144414_2145992_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004200581.1|2146184_2147435_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.1	6.8e-206
WP_004200579.1|2147451_2147643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200578.1|2147639_2148236_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.8	1.4e-108
WP_071606115.1|2148232_2148739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152545.1|2148735_2148894_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_009485475.1|2148886_2149180_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|2149289_2149538_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_004200576.1|2149586_2150468_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.6	3.5e-132
WP_004200574.1|2150464_2151286_-	exonuclease VIII/RecE-like protein	NA	A0A193GYK2	Enterobacter_phage	82.1	2.3e-133
WP_004164029.1|2151282_2151582_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004200573.1|2151956_2152538_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	1.2e-64
WP_004152538.1|2152692_2152926_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004200566.1|2153272_2154247_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	65.8	2.3e-140
WP_004200565.1|2154236_2155007_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
WP_004200564.1|2155132_2155480_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	8.6e-50
WP_004200563.1|2155672_2156059_+	hypothetical protein	NA	R9TME7	Aeromonas_phage	44.0	6.7e-11
WP_004200562.1|2156042_2156234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200561.1|2156230_2156494_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	72.0	2.0e-27
WP_004200559.1|2156956_2157337_+	HNH endonuclease	NA	K7P7B7	Enterobacteria_phage	92.8	5.7e-63
WP_004200558.1|2157333_2157612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200557.1|2157608_2158103_+	DUF551 domain-containing protein	NA	A0A193GYX5	Enterobacter_phage	39.4	2.2e-27
WP_004200556.1|2158095_2158335_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	2.3e-09
WP_004200555.1|2158334_2158673_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	87.3	4.1e-49
WP_004178082.1|2159093_2160581_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_017896964.1|2160659_2160989_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	56.1	3.0e-28
WP_017896965.1|2161046_2161667_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	73.2	9.5e-76
WP_004200551.1|2161663_2163139_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.9	4.9e-280
WP_004200550.1|2163182_2163554_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	91.9	3.7e-59
WP_004141368.1|2164307_2164514_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004200549.1|2164528_2166211_+|head,tail	head-to-tail-joining protein	head,tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.4	9.6e-264
WP_004200548.1|2166207_2166504_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	9.6e-34
WP_004200547.1|2166506_2167190_+|protease	endoprotease	protease	G9L6C4	Escherichia_phage	71.6	7.3e-61
WP_004200546.1|2167204_2168191_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004200545.1|2168244_2168682_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	93.1	8.8e-68
WP_004200544.1|2168692_2169034_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	3.1e-36
WP_004200543.1|2169084_2169408_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	84.1	1.2e-45
WP_004200541.1|2169407_2170013_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.5	5.1e-90
WP_004200540.1|2170012_2172490_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.2	0.0e+00
WP_004200538.1|2172489_2172954_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.0	1.3e-69
WP_004200537.1|2172953_2173493_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	70.9	2.4e-59
WP_004200536.1|2173503_2176317_+	hypothetical protein	NA	T1SBJ1	Salmonella_phage	92.5	0.0e+00
WP_004200535.1|2176313_2178119_+	hypothetical protein	NA	A0A0F6TJQ3	Escherichia_coli_O157_typing_phage	73.5	3.3e-238
WP_004200534.1|2178122_2180597_+	phage protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	86.9	0.0e+00
WP_004200533.1|2180795_2181092_+	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	94.8	4.4e-47
WP_071606113.1|2181126_2181279_-	transmembrane anchored protein	NA	G9L6D9	Escherichia_phage	81.6	4.3e-14
WP_004200532.1|2181377_2181674_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.1	2.4e-24
WP_004200531.1|2181830_2184125_+	hypothetical protein	NA	T1S9Y2	Salmonella_phage	55.5	5.8e-78
WP_004200530.1|2184134_2184362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200529.1|2184539_2184944_+	integral membrane protein	NA	T1SA79	Salmonella_phage	82.6	3.5e-55
WP_004200528.1|2184930_2185224_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.7	2.4e-37
WP_004200527.1|2185225_2185855_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	79.7	8.4e-96
WP_004200526.1|2185851_2186334_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	75.6	1.7e-56
WP_004152009.1|2186553_2188422_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|2188405_2189584_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|2189877_2191110_-	MFS transporter	NA	NA	NA	NA	NA
WP_004221278.1|2191183_2192095_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174861.1|2192191_2192365_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_002913841.1|2192735_2194964_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|2195017_2196550_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|2196553_2198614_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|2198794_2199436_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|2199432_2200470_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|2200733_2201627_+	ROK family protein	NA	NA	NA	NA	NA
WP_002913829.1|2201636_2203070_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|2203287_2203914_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|2204009_2205296_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|2205394_2206096_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|2206092_2207004_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_002913810.1|2207131_2207491_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913807.1|2207500_2208964_-|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
2211712:2211729	attR	GTATTCCGGTTATCGCTG	NA	NA	NA	NA
>prophage 5
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	2552097	2570779	5435743	transposase	Shigella_phage(20.0%)	18	NA	NA
WP_004200433.1|2552097_2552739_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	37.9	3.8e-35
WP_004103714.1|2552829_2553411_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	3.9e-31
WP_004200430.1|2553438_2555286_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004200428.1|2555586_2557173_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.5	1.7e-36
WP_077264888.1|2557554_2557731_+|transposase	transposase	transposase	Q76S41	Shigella_phage	65.9	1.0e-06
WP_102003640.1|2557701_2558899_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	2.2e-145
WP_004201210.1|2558955_2559396_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.7e-18
WP_004189161.1|2559392_2559743_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
WP_038434044.1|2559773_2561366_+|transposase	IS66-like element ISKox1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	61.8	3.2e-176
WP_004200391.1|2561705_2562710_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	5.2e-31
WP_004200392.1|2563176_2563299_+	small membrane protein	NA	NA	NA	NA	NA
WP_004103677.1|2563856_2565023_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	1.8e-112
WP_023321278.1|2565185_2566556_-	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.5	4.2e-31
WP_025403909.1|2566578_2567994_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.9	2.8e-54
WP_156529680.1|2568292_2568556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102003640.1|2568737_2569935_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.1	2.2e-145
WP_004201210.1|2569991_2570432_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	59.0	1.7e-18
WP_004189161.1|2570428_2570779_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	63.8	5.2e-39
>prophage 6
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	3537801	3547215	5435743		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|3537801_3539436_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|3539490_3540756_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|3540786_3541875_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|3541961_3542222_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|3542519_3543380_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|3543400_3544162_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|3544422_3545325_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|3545336_3546602_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|3546594_3547215_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	3772145	3813887	5435743	integrase,terminase	Klebsiella_phage(34.04%)	62	3805000:3805014	3811009:3811023
WP_014343022.1|3772145_3775169_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3775224_3775422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3775396_3775528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3775648_3775813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3776287_3777061_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3777057_3778254_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3778253_3778607_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3778608_3779262_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3779315_3779666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3779918_3780104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3780156_3780498_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3780497_3781520_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3781522_3781750_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3781825_3782239_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3782424_3784428_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3784417_3784570_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3784605_3785031_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3785034_3785475_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3785485_3786631_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3786634_3787075_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3787169_3787556_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3787555_3788062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3788058_3788478_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3788446_3788728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3788767_3789709_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3789720_3790215_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3790218_3791421_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3791472_3792021_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3792076_3793528_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3793765_3795166_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3795116_3795605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3795970_3796291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3796525_3796915_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3796911_3797442_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3797444_3797693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3797710_3797839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3797876_3798032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3798098_3798881_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3798877_3799354_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|3799350_3800328_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3800314_3801973_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3802549_3802771_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3802868_3803537_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3803707_3804022_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3804014_3804203_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3804576_3804738_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3804730_3804985_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3805000:3805014	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3805052_3805175_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3805171_3805597_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3805593_3805788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3805784_3806612_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3806716_3807235_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3807240_3807951_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3807940_3808165_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3808260_3808374_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3808616_3808850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3808922_3809069_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3809028_3809271_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3809251_3810433_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3810629_3811178_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3811009:3811023	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3811376_3812909_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3813125_3813887_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 8
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	3846820	3855390	5435743	transposase	Salmonella_phage(25.0%)	8	NA	NA
WP_002901815.1|3846820_3847492_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
WP_071531199.1|3847678_3848506_+	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901813.1|3848581_3849847_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_002901812.1|3849848_3850268_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_004178082.1|3850347_3851835_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152776.1|3852729_3853152_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_001067855.1|3853744_3854449_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001389365.1|3854625_3855390_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
>prophage 9
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	3858884	3872597	5435743	integrase,transposase	Enterobacteria_phage(43.75%)	20	3860248:3860262	3872360:3872374
WP_001067855.1|3858884_3859589_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201118.1|3859685_3860534_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
3860248:3860262	attL	AGCTCCAGCATCAGG	NA	NA	NA	NA
WP_004201117.1|3860530_3861391_-	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_001548453.1|3861476_3861698_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201115.1|3861738_3861966_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_004201113.1|3862077_3862776_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201109.1|3863063_3864140_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201108.1|3864221_3864425_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004219883.1|3864735_3864861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004135674.1|3864853_3865048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201105.1|3865136_3865421_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004201103.1|3865436_3866282_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_088224434.1|3866278_3866566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201102.1|3866567_3867248_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_004151898.1|3867244_3867673_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004151899.1|3867669_3868332_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151900.1|3868539_3869757_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004151901.1|3869903_3870794_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004140266.1|3870793_3871786_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3871787_3872597_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
3872360:3872374	attR	CCTGATGCTGGAGCT	NA	NA	NA	NA
>prophage 10
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	4277778	4370729	5435743	tail,tRNA,lysis,portal,terminase,head,capsid,integrase,protease,plate	Salmonella_phage(57.63%)	97	4333304:4333322	4370804:4370822
WP_002898139.1|4277778_4279071_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|4279161_4280505_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|4280513_4281125_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|4281247_4285501_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|4285636_4286131_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|4286414_4286546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|4286663_4287632_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|4287746_4289513_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|4289513_4291235_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|4291261_4291981_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4292334_4292553_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|4292673_4294953_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|4294983_4295301_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|4295626_4295848_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|4295924_4297865_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|4297861_4298977_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|4299123_4300782_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|4301201_4301897_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|4302012_4302912_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|4303055_4304708_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|4304718_4305687_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|4305898_4306333_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|4306484_4308203_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|4308241_4309243_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|4309253_4310696_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|4310783_4311797_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|4311793_4312624_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|4312655_4313795_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|4314672_4315188_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|4315414_4316143_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|4316163_4316895_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|4316901_4317618_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|4317617_4318286_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|4318469_4319201_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|4319243_4320716_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|4320712_4321429_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|4321507_4322635_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|4322676_4323165_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|4323222_4324068_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|4324064_4325018_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|4325028_4326195_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|4326325_4327438_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|4327786_4328266_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|4328354_4329257_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|4330078_4330366_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|4330568_4330832_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|4330838_4331222_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|4331488_4333174_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|4333165_4333288_-	hypothetical protein	NA	NA	NA	NA	NA
4333304:4333322	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|4333393_4333612_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|4333703_4334804_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|4334800_4335286_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|4335282_4337676_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|4337902_4338022_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|4338036_4338336_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|4338388_4338904_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|4338913_4340086_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|4340224_4341301_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|4341330_4341492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|4341530_4342262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|4342265_4345217_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|4345218_4345818_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|4345810_4346719_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|4346705_4347068_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|4347064_4347637_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|4347751_4347916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|4347914_4348424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|4348420_4348867_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|4348859_4349291_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|4349253_4349400_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|4349386_4349815_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|4349811_4350195_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|4350199_4350709_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|4350689_4350905_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|4350908_4351112_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|4351111_4351576_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|4351671_4352322_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|4352325_4353384_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|4353400_4354234_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|4354376_4356143_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|4356142_4357168_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|4357229_4358972_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|4359247_4359925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4360039_4360273_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|4360283_4360472_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|4360625_4363040_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|4363036_4363894_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|4363890_4364118_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|4364117_4364351_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_004199692.1|4364418_4364760_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956179.1|4364723_4364924_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|4364931_4365441_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|4365473_4365695_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|4365840_4366719_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|4366730_4367675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|4367773_4369261_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|4369748_4370729_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
4370804:4370822	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP018816	Klebsiella pneumoniae strain AR_0049 chromosome, complete genome	5435743	4817145	4862420	5435743	head,lysis,tRNA,integrase	Escherichia_phage(26.42%)	65	4810358:4810404	4859492:4859538
4810358:4810404	attL	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004151249.1|4817145_4819623_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|4819609_4820005_-	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|4820001_4820472_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|4820471_4820948_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199612.1|4820990_4824437_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.0e-163
WP_004151254.1|4824529_4825033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|4825160_4825946_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|4826011_4826725_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|4826714_4826885_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|4826984_4827344_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|4827360_4827831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|4828124_4828379_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|4828381_4829137_-	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|4829312_4829990_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|4830042_4830795_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|4830863_4831256_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|4831252_4831678_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|4831680_4832043_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|4832042_4832216_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|4832215_4832596_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|4832598_4832838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|4832848_4833943_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|4833954_4834383_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|4834386_4835772_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|4835844_4836321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|4836362_4837367_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|4837341_4838763_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|4838775_4840248_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|4840247_4840850_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|4841220_4841550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|4841655_4842120_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|4842116_4842647_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|4842649_4842898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151283.1|4843807_4844497_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|4844493_4845024_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|4845016_4845154_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|4845150_4845786_-	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|4845778_4845949_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|4845948_4846404_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|4846904_4847552_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151293.1|4847724_4848567_-	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|4848673_4849180_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|4849176_4849470_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|4849469_4850885_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|4850889_4851741_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|4851781_4851928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4852013_4852235_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|4852275_4852509_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|4852636_4853326_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|4853676_4853892_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|4853888_4853999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|4853991_4854186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|4854274_4854559_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004199604.1|4854574_4855420_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	5.3e-69
WP_004151306.1|4855416_4856097_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|4856093_4856252_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|4856248_4856905_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|4856901_4857669_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|4857665_4857884_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|4857885_4858101_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|4858102_4858438_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151318.1|4858314_4859478_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004143017.1|4859908_4860775_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
4859492:4859538	attR	AATGGCACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_004143016.1|4860776_4860989_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|4861034_4862420_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 1
NZ_CP018818	Klebsiella pneumoniae strain AR_0049 plasmid unitig_2, complete sequence	117755	43824	85048	117755	transposase	Escherichia_phage(44.44%)	38	NA	NA
WP_004201219.1|43824_45363_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_017896554.1|46261_46570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567366.1|47063_47612_+	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_001567367.1|47658_48093_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003026799.1|48337_48604_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|48591_49074_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001567368.1|49274_50678_+|transposase	ISNCY-like element ISKpn21 family transposase	transposase	NA	NA	NA	NA
WP_001567369.1|50706_51339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200842.1|51956_53720_+	DUF262 domain-containing protein	NA	C4MZ12	Escherichia_phage	41.3	2.9e-08
WP_004200841.1|54369_55233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077255340.1|55249_55675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017896188.1|56586_57471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200838.1|58080_58629_-	thioredoxin fold domain-containing protein	NA	NA	NA	NA	NA
WP_004200837.1|59136_60132_+|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	29.2	3.5e-19
WP_004200835.1|60369_61338_-	phage exclusion protein	NA	NA	NA	NA	NA
WP_000421673.1|61866_64176_+	ATPase	NA	NA	NA	NA	NA
WP_004152291.1|64179_65496_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_004200832.1|65492_67688_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004200827.1|69014_69443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200826.1|69452_69737_-	hypothetical protein	NA	A0A1S6L2Z2	Erwinia_phage	43.2	1.5e-07
WP_032427995.1|70218_70467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141180.1|70675_70810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004200825.1|71104_71962_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_099913970.1|71954_72032_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|72248_72527_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_072141181.1|72846_73326_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	1.7e-19
WP_004200823.1|73502_73811_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	31.7	1.1e-08
WP_001351729.1|75624_76017_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|76154_77039_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|77070_78270_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|78375_79026_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_087758686.1|79057_79213_-	replication initiator protein	NA	NA	NA	NA	NA
WP_001067855.1|79203_79908_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|80029_80935_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|80931_82170_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|82169_82754_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|82982_83687_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|84343_85048_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP018819	Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence	85161	0	65193	85161	transposase,integrase	Escherichia_phage(30.0%)	65	24627:24686	69118:69939
WP_001776122.1|1814_2780_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|3259_3691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|3723_4251_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|4510_4966_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|5037_5403_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|5418_5694_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|5721_6147_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|6185_7871_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|7888_8254_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|8250_8487_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|8470_8590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|8552_8765_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003124096.1|8895_9456_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	88.6	2.1e-50
WP_001138070.1|9458_12425_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	72.9	0.0e+00
WP_000427619.1|12503_13508_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|13689_13866_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|14195_15011_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|15071_15875_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|15874_16711_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|16682_17222_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|17431_18292_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|18474_19032_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000608644.1|19595_20858_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|21113_21989_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|22035_22368_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
24627:24686	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_020324562.1|24689_25394_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_002063889.1|26587_27130_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|27142_28003_-	aminoglycoside N-acetyltransferase AAC(3)-IIa	NA	NA	NA	NA	NA
WP_020324562.1|28109_28814_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001334766.1|29445_30276_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|30406_30961_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_020324562.1|31104_31809_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_004176269.1|31945_32806_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|32826_33588_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|33849_34752_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004201219.1|39369_40908_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	5.1e-280
WP_000612626.1|40956_41304_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_003031976.1|41300_41705_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	98.5	4.3e-69
WP_025403922.1|41898_42333_+	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_004201260.1|42374_43019_-	quinolone resistance pentapeptide repeat protein QnrB9	NA	NA	NA	NA	NA
WP_017896601.1|43113_44103_-	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_003020532.1|44258_44927_+	phage shock protein PspA	NA	NA	NA	NA	NA
WP_003020509.1|44981_45206_+	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_003020497.1|45205_45565_+	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_003833267.1|45573_45804_+	phage shock protein PspD	NA	NA	NA	NA	NA
WP_004201265.1|46250_46568_+	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_020324562.1|47362_48067_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_000176305.1|48215_48827_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|48880_49162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|49334_49670_+	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_032428065.1|50285_50420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|51087_51843_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_000861580.1|52854_53046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|53054_53441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|54192_54897_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071549088.1|54921_55434_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|55438_55645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|56026_57460_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|57493_58708_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|58968_59733_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|59875_60142_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|60362_60836_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|60991_62005_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001749988.1|62397_62967_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_004201235.1|63723_65193_+	HNH endonuclease	NA	G0X580	Salmonella_phage	51.3	5.5e-21
69118:69939	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCAGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCAA	NA	NA	NA	NA
>prophage 2
NZ_CP018819	Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence	85161	69180	70748	85161	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_020324562.1|69180_69885_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.9e-138
WP_001217881.1|70190_70748_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
>prophage 3
NZ_CP018819	Klebsiella pneumoniae strain AR_0049 plasmid unitig_3, complete sequence	85161	76883	84613	85161	integrase	Escherichia_phage(50.0%)	9	70331:70344	81730:81743
70331:70344	attL	GCTGGATTTGCTGA	NA	NA	NA	NA
WP_000015958.1|76883_77660_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|77717_77975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|78103_78208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|78742_79609_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|79965_80235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|80649_81855_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
81730:81743	attR	TCAGCAAATCCAGC	NA	NA	NA	NA
WP_000064120.1|81854_82829_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|82910_84182_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|84181_84613_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
