The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	14667	161433	4882039	portal,holin,plate,integrase,tail,tRNA,lysis,capsid,terminase,head	Escherichia_phage(20.0%)	164	86240:86257	118801:118818
WP_032609956.1|14667_15936_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032609954.1|15886_17212_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032609953.1|17227_18832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609952.1|18841_19240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609951.1|19334_19763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071886179.1|19803_20067_-	cell wall-binding protein	NA	NA	NA	NA	NA
WP_032609950.1|20091_20478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114143817.1|21015_22476_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_032609947.1|22444_22882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596283.1|23084_23888_-	hypothetical protein	NA	I6PD67	Cronobacter_phage	30.3	7.6e-17
WP_023323125.1|23906_24113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609946.1|24276_24774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609944.1|24928_26644_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032610271.1|26643_27828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609942.1|28235_28508_+	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_032609941.1|28507_29896_+	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	28.7	1.7e-48
WP_032609940.1|29888_31001_+	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_071886178.1|30997_31600_+	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_050596973.1|31627_32761_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_032609938.1|32908_33340_+	TIGR04141 family sporadically distributed protein	NA	NA	NA	NA	NA
WP_032609936.1|33430_34321_-	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_032609935.1|34317_35214_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_032609933.1|35203_36760_-	recombinase family protein	NA	A0A0A7RTP8	Clostridium_phage	31.0	1.4e-19
WP_032609931.1|37042_38272_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	85.6	1.1e-205
WP_032610629.1|38595_39768_-	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	93.3	5.0e-211
WP_000050710.1|39722_39932_-	hypothetical protein	NA	I6PBM8	Cronobacter_phage	97.1	4.4e-33
WP_032610627.1|39921_40206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610626.1|40309_40723_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	64.2	2.0e-45
WP_023296234.1|40912_41320_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	87.5	2.1e-47
WP_032610625.1|41312_41534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610624.1|41640_42030_-	S24 family peptidase	NA	F1C5A0	Cronobacter_phage	58.8	4.0e-32
WP_032610623.1|42111_42405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023296237.1|42576_43269_-	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	65.4	4.3e-85
WP_048859479.1|43422_43638_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	50.0	2.4e-10
WP_087920840.1|43716_44526_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	64.1	1.6e-83
WP_032610621.1|44541_45423_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	62.4	1.8e-80
WP_032610619.1|45419_46799_+	AAA family ATPase	NA	Q8W640	Enterobacteria_phage	67.9	6.4e-173
WP_032610617.1|46826_47609_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.4	3.1e-108
WP_017384387.1|48605_48995_+	membrane protein	NA	G8C7V8	Escherichia_phage	92.2	1.1e-58
WP_017384386.1|48984_49263_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	85.9	1.7e-37
WP_032610613.1|49262_49892_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	87.6	2.7e-102
WP_071886186.1|49899_50169_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	82.0	2.0e-30
WP_032610608.1|50418_51117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032610607.1|51205_52663_+	glycosyl transferase	NA	K7PKP3	Enterobacterial_phage	92.6	4.0e-274
WP_071886177.1|52644_53235_+	hypothetical protein	NA	K7PGW6	Enterobacterial_phage	76.0	1.2e-88
WP_032610606.1|53234_53585_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	2.7e-51
WP_032610605.1|53742_54216_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	95.5	7.2e-84
WP_052686367.1|55050_56007_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	55.2	1.5e-88
WP_032610603.1|56009_56348_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	77.7	9.2e-49
WP_032610602.1|56344_57100_+|tail	phage minor tail protein L	tail	K7PKU0	Enterobacteria_phage	92.4	1.0e-135
WP_032610600.1|57101_57812_+	peptidase P60	NA	K7PJV6	Enterobacteria_phage	96.2	1.5e-141
WP_032610599.1|57840_58188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610598.1|58214_58805_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	85.2	3.8e-90
WP_032610597.1|58859_62657_+|tail	phage tail protein	tail	K7PHL5	Enterobacterial_phage	83.5	0.0e+00
WP_032610596.1|62700_63015_+	hypothetical protein	NA	A0A2P0WA17	Enterobacter_phage	71.6	6.4e-36
WP_032610595.1|63015_63687_+	hypothetical protein	NA	A0A2P0WA07	Enterobacter_phage	70.9	1.1e-85
WP_032610594.1|63794_64028_+	hypothetical protein	NA	E4WL42	Enterobacteria_phage	75.3	2.5e-29
WP_077870385.1|64085_65213_+|tail	tail fiber domain-containing protein	tail	A0A2I6PID3	Escherichia_phage	37.3	2.1e-52
WP_071886176.1|65466_65820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123906383.1|66580_67006_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	47.2	2.4e-25
WP_013096351.1|67092_67332_-	DinI family protein	NA	K7PKM2	Enterobacterial_phage	89.9	2.2e-33
WP_003863115.1|68055_68538_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	6.8e-29
WP_006811645.1|68655_69132_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003863119.1|69121_69409_+	RnfH family protein	NA	NA	NA	NA	NA
WP_032609930.1|69470_69809_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_071524123.1|69790_69973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023314691.1|69947_71609_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_003863124.1|71694_72573_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_003863126.1|72695_73289_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032609927.1|73341_74628_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_020883913.1|74647_75514_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_003863132.1|75605_76967_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_003863133.1|77083_77332_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_032609925.1|77347_77887_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_003863138.1|77918_78686_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002914145.1|78729_79077_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_003863141.1|79209_79614_+	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_032609922.1|79652_81023_+	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_003863144.1|81025_81511_-	OmpA family protein	NA	NA	NA	NA	NA
WP_032609921.1|81523_82744_-	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	39.8	1.2e-05
WP_003863149.1|82736_83273_-	YfiR family protein	NA	NA	NA	NA	NA
WP_003863151.1|83426_83801_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_006811632.1|84013_85084_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	4.5e-89
WP_022649060.1|85094_86216_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
86240:86257	attL	CCAGCATTGCTGGCTTTT	NA	NA	NA	NA
WP_032609917.1|86404_87385_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	80.1	4.4e-152
WP_032610269.1|87454_87748_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	68.0	4.2e-34
WP_023295263.1|87907_88180_+	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	82.2	3.4e-38
WP_032609915.1|88182_88362_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	66.7	8.1e-12
WP_032609913.1|88352_88853_+	hypothetical protein	NA	M1SV55	Escherichia_phage	88.6	2.5e-82
WP_044704157.1|88918_89134_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_032609912.1|89150_89426_+	DUF5405 family protein	NA	A0A0F7LCM4	Escherichia_phage	59.3	9.8e-25
WP_032609910.1|89415_91701_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	74.9	0.0e+00
WP_032609909.1|91706_92171_+	DUF3850 domain-containing protein	NA	Q2P9X4	Enterobacteria_phage	54.9	4.4e-41
WP_048859478.1|92577_93114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610267.1|93214_93553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609906.1|93945_94971_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	83.0	2.7e-168
WP_032609904.1|94972_96742_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.1	6.1e-301
WP_032609903.1|96907_97762_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	74.6	7.6e-116
WP_023295252.1|97817_98885_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	83.6	9.7e-169
WP_032609901.1|98888_99644_+|terminase	terminase endonuclease subunit	terminase	A0A0M4QWM0	Salmonella_phage	69.3	2.2e-74
WP_032609900.1|99743_100250_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	71.4	9.9e-63
WP_017382979.1|100249_100453_+|tail	tail protein	tail	Q858W3	Yersinia_virus	79.1	3.3e-25
WP_014170137.1|100443_100665_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	72.6	2.1e-25
WP_032609897.1|100648_101161_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	88.8	2.3e-83
WP_032609896.1|101157_101589_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	77.6	1.8e-57
WP_032609895.1|101588_102005_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	67.2	3.5e-42
WP_023295244.1|102100_102568_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	69.0	8.0e-59
WP_032609894.1|102560_103013_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	64.6	5.7e-46
WP_032609893.1|103264_103822_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_032609892.1|103796_105170_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_032609891.1|105248_105761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609890.1|105967_106609_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.7	5.6e-95
WP_023323587.1|106605_106956_+	hypothetical protein	NA	A0A0M4RE59	Salmonella_phage	72.4	8.1e-40
WP_023323586.1|106961_107870_+|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	83.8	8.3e-137
WP_032609889.1|107862_108393_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.9	1.4e-91
WP_032609887.1|108404_110753_+|tail	tail fiber protein	tail	A0A0F7LDR4	Escherichia_phage	47.0	8.8e-114
WP_032609885.1|110754_111186_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	55.1	5.3e-17
WP_032609883.1|111560_112754_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	4.1e-184
WP_023295232.1|112766_113285_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	81.4	2.9e-78
WP_032609880.1|113342_113666_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	64.0	4.4e-24
WP_017382998.1|113698_113821_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	89.7	5.9e-14
WP_032609878.1|113810_116261_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	74.9	9.3e-300
WP_032609877.1|116271_116736_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	7.2e-60
WP_032609875.1|116732_117902_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	78.8	7.9e-172
WP_023323577.1|117978_118200_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	72.6	4.9e-27
WP_044596285.1|118245_118638_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.2	9.7e-26
WP_032609874.1|118837_119710_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
118801:118818	attR	CCAGCATTGCTGGCTTTT	NA	NA	NA	NA
WP_023314685.1|119706_120867_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_100229775.1|120974_121022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003863162.1|121127_121469_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_003863164.1|121736_122474_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_003863165.1|122605_123586_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_003863167.1|123582_124314_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_032609871.1|124443_127017_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.7	6.9e-128
WP_006811623.1|132667_133120_+	DUF4385 domain-containing protein	NA	M4QHR1	Cyanophage	50.0	3.9e-34
WP_003860741.1|133271_134579_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	29.6	2.7e-43
WP_003860739.1|134575_134899_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_032609868.1|134944_136300_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_022651672.1|136409_139073_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_003860734.1|139108_139807_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_003860733.1|139877_140297_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	37.2	1.2e-13
WP_023314680.1|140501_141587_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_003860729.1|141626_142316_-	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	48.8	7.9e-55
WP_003860727.1|142631_143015_+	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	71.8	2.1e-33
WP_003860725.1|143067_144396_-	ATP-dependent RNA helicase SrmB	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.5	4.7e-48
WP_032609866.1|144528_145266_+|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003860722.1|145250_146870_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_006176728.1|147296_147872_+	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	28.1	8.2e-05
WP_032609863.1|147903_148554_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_003860717.1|148553_149507_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_003860716.1|149503_149980_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_003860714.1|150165_151971_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.9	1.1e-23
WP_003860712.1|151986_152961_+	signal peptidase I	NA	NA	NA	NA	NA
WP_003860711.1|153184_153865_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.0	9.6e-21
WP_003860709.1|153861_154767_+	GTPase Era	NA	NA	NA	NA	NA
WP_003860708.1|154784_155492_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003860707.1|155567_156299_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003860706.1|156298_156679_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_003860704.1|156675_156936_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	51.2	1.4e-17
WP_003860702.1|156992_157841_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003860700.1|157959_158856_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_032609861.1|158865_160230_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_032609859.1|160233_160869_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_022651606.1|160893_161433_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	598682	607532	4882039		Enterobacteria_phage(28.57%)	7	NA	NA
WP_032103484.1|598682_599747_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.4	6.4e-104
WP_032609646.1|599762_600629_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	2.8e-110
WP_032609645.1|600641_601532_+	dTDP-4-dehydrorhamnose reductase	NA	A0A1D7XFA3	Escherichia_phage	31.3	4.8e-28
WP_075155257.1|601542_602091_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.9	5.9e-53
WP_023294999.1|602226_603633_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	5.2e-37
WP_032609644.1|603886_605053_+	UDP-glucose 6-dehydrogenase	NA	A0A1J0FA55	Only_Syngen_Nebraska_virus	53.5	1.2e-111
WP_032609643.1|606527_607532_-	NAD-dependent epimerase	NA	A0A2K9L0I7	Tupanvirus	29.0	3.3e-33
>prophage 3
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	717006	728673	4882039	terminase	uncultured_Caudovirales_phage(22.22%)	14	NA	NA
WP_032609561.1|717006_717348_+	hypothetical protein	NA	A0A2H4J7H0	uncultured_Caudovirales_phage	51.8	3.7e-21
WP_032609560.1|717344_718955_+|terminase	phage terminase large subunit	terminase	A0A2H4JCA3	uncultured_Caudovirales_phage	70.3	8.4e-225
WP_048859468.1|718975_721222_+	hypothetical protein	NA	A0A0F6TJC8	Escherichia_coli_O157_typing_phage	46.0	3.8e-66
WP_032609559.1|721251_722733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609558.1|722729_723671_-	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.7	5.5e-160
WP_023295990.1|723667_724030_-	GtrA family protein	NA	B9UDL8	Salmonella_phage	75.0	3.5e-46
WP_023295991.1|724179_724410_+	hypothetical protein	NA	A5LH82	Enterobacteria_phage	71.0	2.9e-22
WP_032609557.1|724390_724930_+	lysozyme	NA	H6WRZ4	Salmonella_phage	89.3	2.2e-92
WP_032609556.1|724926_725286_+	hypothetical protein	NA	R9TPM9	Aeromonas_phage	45.5	2.4e-15
WP_154817219.1|725585_725948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859653.1|726037_726361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651459.1|726390_727317_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032609555.1|727322_727793_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003859661.1|727956_728673_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	1.0e-12
>prophage 4
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	999951	1052708	4882039	portal,protease,holin,plate,integrase,tail,lysis,capsid,terminase,head	Escherichia_phage(24.32%)	62	993346:993360	1023961:1023975
993346:993360	attL	TCGGCGATGGCCTGC	NA	NA	NA	NA
WP_032609415.1|999951_1000962_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	76.1	1.2e-147
WP_014884155.1|1001058_1001358_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	74.7	2.9e-38
WP_014884154.1|1001482_1001758_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	85.6	6.8e-42
WP_014884153.1|1001924_1002425_+	hypothetical protein	NA	M1SV55	Escherichia_phage	75.9	7.4e-71
WP_014884152.1|1002491_1002710_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	62.1	3.8e-11
WP_014884151.1|1002732_1002996_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	57.0	2.0e-22
WP_032609413.1|1002997_1005295_+	replication endonuclease	NA	Q858T4	Yersinia_virus	75.5	0.0e+00
WP_032609411.1|1005291_1005576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609409.1|1005723_1006278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609407.1|1006959_1007478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609405.1|1007480_1008680_-	ATP-binding protein	NA	A0A0P0IKU8	Acinetobacter_phage	32.6	3.4e-53
WP_032609403.1|1009007_1010033_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.9	2.1e-168
WP_032609402.1|1010034_1011804_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	85.7	1.1e-302
WP_032609401.1|1011970_1012825_+|capsid	GPO family capsid scaffolding protein	capsid	S4TP53	Salmonella_phage	72.2	1.0e-112
WP_032609400.1|1012880_1013948_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.3	3.9e-170
WP_038421123.1|1013951_1014707_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	65.3	7.5e-75
WP_032609395.1|1014806_1015313_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	70.2	7.1e-61
WP_032609394.1|1015312_1015516_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	76.1	6.1e-24
WP_032609392.1|1015506_1015728_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	74.0	7.1e-26
WP_032609391.1|1015711_1016221_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	86.9	1.7e-78
WP_038421124.1|1016217_1016643_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.1	9.2e-46
WP_072163335.1|1016530_1016776_+|holin	holin	holin	S4TNY4	Salmonella_phage	77.8	1.0e-28
WP_032609387.1|1016738_1017206_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	71.6	6.5e-61
WP_032609386.1|1017198_1017648_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	73.5	2.6e-51
WP_032609384.1|1017717_1018449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032609382.1|1018580_1019222_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	83.1	1.6e-97
WP_023338715.1|1019218_1019569_+	hypothetical protein	NA	A0A0M4RE59	Salmonella_phage	69.8	1.5e-38
WP_032609381.1|1019574_1020483_+|plate	baseplate assembly protein	plate	Q6K1H4	Salmonella_virus	83.1	3.2e-136
WP_032609378.1|1020475_1021006_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	86.4	1.5e-90
WP_032609376.1|1022861_1023377_+|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	36.8	4.4e-18
WP_032609374.1|1023751_1024945_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.1	8.3e-185
1023961:1023975	attR	GCAGGCCATCGCCGA	NA	NA	NA	NA
WP_032609372.1|1024957_1025476_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	8.5e-78
WP_032609371.1|1025532_1025835_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	73.6	1.4e-27
WP_032609370.1|1025867_1025990_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	92.3	1.0e-13
WP_032609369.1|1025979_1028427_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	72.1	4.6e-283
WP_032609367.1|1028439_1028904_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	4.2e-60
WP_032609366.1|1028900_1030070_+	phage late control D family protein	NA	A0A218M4J7	Erwinia_phage	76.9	4.0e-160
WP_032609365.1|1030146_1030368_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	69.9	6.0e-25
WP_032609364.1|1030484_1031375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032609363.1|1031431_1031908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003856755.1|1032051_1032348_-	YciI family protein	NA	NA	NA	NA	NA
WP_017384230.1|1032569_1033298_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_023314256.1|1033336_1033732_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_032609360.1|1033830_1036017_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_023324803.1|1036197_1036737_-	septation protein A	NA	NA	NA	NA	NA
WP_003856765.1|1036750_1037494_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_032609359.1|1037519_1037924_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_003856769.1|1038206_1038839_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_003856774.1|1039125_1039359_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_032609358.1|1039355_1040567_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_032609356.1|1040741_1041551_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_003856780.1|1041550_1042744_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_032609355.1|1042754_1044113_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.0	5.0e-37
WP_032609354.1|1044116_1045712_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	37.3	1.2e-50
WP_032609352.1|1045711_1047274_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_071524153.1|1047368_1047413_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_003856787.1|1047552_1048434_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_003856793.1|1048430_1049051_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_003856794.1|1049148_1050024_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023314251.1|1050060_1050651_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_017384219.1|1050647_1051409_-	YciK family oxidoreductase	NA	NA	NA	NA	NA
WP_022651351.1|1051661_1052708_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	29.2	1.3e-19
>prophage 5
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	2255498	2364919	4882039	transposase,holin,integrase,tail,terminase,head	Cronobacter_phage(29.85%)	116	2314109:2314125	2373879:2373895
WP_032608807.1|2255498_2257532_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.6	3.4e-21
WP_003858827.1|2257660_2258248_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_022650555.1|2258261_2259734_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_032608805.1|2259747_2261412_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.4	5.2e-60
WP_003858833.1|2261514_2262213_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_032608803.1|2262413_2263982_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_022650553.1|2264053_2265067_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023324282.1|2265066_2265900_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_032608801.1|2265892_2266729_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.9	9.7e-15
WP_022650552.1|2266715_2267420_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	1.5e-21
WP_032608799.1|2267489_2267963_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_003858846.1|2268100_2268871_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_003858847.1|2268891_2270571_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_003858848.1|2270584_2271364_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_022650550.1|2271469_2272351_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032608797.1|2272633_2273089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608796.1|2273314_2274292_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	52.2	1.3e-87
WP_032608795.1|2274426_2275476_-	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	31.8	1.0e-13
WP_032608794.1|2277850_2278396_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_032608792.1|2282624_2283062_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_023324277.1|2283192_2284314_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_032608791.1|2284243_2287399_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_032608790.1|2287408_2288473_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032608787.1|2288581_2291290_-	cation-transporting P-type ATPase	NA	M1I547	Acanthocystis_turfacea_Chlorella_virus	27.8	3.8e-68
WP_003858875.1|2291778_2292027_+	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_032608785.1|2292012_2293581_-	DUF3327 domain-containing protein	NA	NA	NA	NA	NA
WP_032608783.1|2293704_2295849_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_032608782.1|2295955_2296297_-	RamA family antibiotic efflux transcriptional regulator	NA	NA	NA	NA	NA
WP_032608780.1|2296329_2297433_-	RomA family MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032608778.1|2298191_2298560_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_003858884.1|2298680_2299334_+	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_003858885.1|2299370_2299658_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	38.1	6.9e-05
WP_032608774.1|2299931_2300801_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032608773.1|2300908_2302345_+	MFS transporter	NA	NA	NA	NA	NA
WP_023315564.1|2302412_2303657_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_032608772.1|2303657_2304629_-	LacI family transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	32.6	2.4e-25
WP_032608771.1|2304704_2305847_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032608769.1|2305839_2306865_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_032608767.1|2306880_2308116_-	MFS transporter	NA	NA	NA	NA	NA
WP_003858894.1|2308368_2309757_-	phenylalanine transporter	NA	NA	NA	NA	NA
WP_032608766.1|2309859_2311833_-	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_032665464.1|2311960_2314144_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
2314109:2314125	attL	CGCCAGCAGCGTTTTGT	NA	NA	NA	NA
WP_003858898.1|2314344_2314620_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_032608765.1|2315068_2315458_-	DNA polymerase V	NA	Q6UAV9	Klebsiella_phage	69.0	9.9e-47
WP_032608764.1|2315578_2315761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608763.1|2315767_2316130_+	GtrA family protein	NA	B9UDL8	Salmonella_phage	70.0	6.8e-42
WP_032608760.1|2316126_2317050_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.8	1.4e-160
WP_032608759.1|2317042_2318515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608758.1|2318602_2318989_-|tail	phage tail fiber protein	tail	A0A0F7LDZ0	Escherichia_phage	56.6	1.3e-17
WP_032608756.1|2319522_2321739_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	61.4	1.0e-39
WP_032608755.1|2321797_2324275_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	92.5	0.0e+00
WP_032608754.1|2324261_2324627_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	90.8	4.6e-62
WP_015571561.1|2324640_2325111_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	80.1	1.0e-66
WP_032608753.1|2325110_2325608_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	89.1	3.7e-86
WP_032608752.1|2325607_2328514_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	39.0	1.3e-127
WP_032608750.1|2328629_2328917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608748.1|2328911_2329601_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	51.1	3.5e-55
WP_032608746.1|2329658_2330402_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	81.6	2.2e-71
WP_000427623.1|2330665_2331670_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_052238023.1|2331851_2332346_-	HNH endonuclease	NA	G0ZNE5	Cronobacter_phage	50.7	1.0e-32
WP_032608745.1|2332445_2332829_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	64.6	2.3e-40
WP_032608743.1|2332825_2333290_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	45.5	1.2e-30
WP_032608742.1|2333292_2333643_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	66.1	8.9e-39
WP_032608741.1|2333642_2333816_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.9	2.7e-12
WP_006808952.1|2333815_2334196_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	54.5	7.0e-29
WP_032608740.1|2334198_2334564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006808954.1|2334573_2335671_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	77.5	7.6e-161
WP_017693196.1|2335681_2336116_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	72.2	1.4e-49
WP_032608738.1|2336119_2337508_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	59.2	3.3e-153
WP_032608737.1|2337579_2337996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063612943.1|2338030_2339029_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.4	2.1e-112
WP_032608735.1|2338955_2340413_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	60.4	9.8e-156
WP_032608733.1|2340441_2342004_-|terminase	terminase	terminase	G8C7P3	Escherichia_phage	93.2	8.8e-304
WP_032608731.1|2342000_2342651_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	99.5	9.2e-114
WP_003859853.1|2342870_2343101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608726.1|2343696_2344215_-	Rha family transcriptional regulator	NA	Q38450	Enterobacteria_phage	98.3	2.1e-92
WP_044596275.1|2344511_2344898_-	DUF2570 domain-containing protein	NA	A0A2H4FNE5	Salmonella_phage	44.0	5.5e-05
WP_032608725.1|2344894_2345335_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	71.1	4.4e-51
WP_001514184.1|2345338_2345614_-|holin	phage holin family protein	holin	S4TNV9	Salmonella_phage	41.0	5.8e-09
WP_032608724.1|2345610_2346012_-	membrane protein	NA	NA	NA	NA	NA
WP_032608723.1|2346288_2346978_-	antiterminator	NA	I6PDF8	Cronobacter_phage	48.9	1.5e-53
WP_032608722.1|2347087_2347723_-	Lambda NinG family protein	NA	M9NYX8	Enterobacteria_phage	85.4	1.1e-92
WP_032608721.1|2347715_2347886_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	92.9	2.4e-21
WP_032608720.1|2347885_2348341_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	66.9	2.9e-53
WP_032608719.1|2349443_2349629_-	hypothetical protein	NA	K7P7P5	Enterobacteria_phage	91.8	1.6e-26
WP_032608717.1|2349625_2350060_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	40.5	1.4e-09
WP_059555724.1|2350056_2350371_-	hypothetical protein	NA	I6PDF7	Cronobacter_phage	42.3	9.2e-11
WP_032608716.1|2350360_2351734_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	62.7	4.9e-165
WP_032608714.1|2351730_2352816_-	replication protein	NA	E5AGE9	Erwinia_phage	45.6	2.3e-85
WP_013095956.1|2352802_2352970_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	78.2	2.1e-14
WP_001514165.1|2353058_2353625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016042179.1|2353654_2353882_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	100.0	4.1e-37
WP_016042178.1|2353992_2354682_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	100.0	2.2e-126
WP_032608710.1|2354897_2355143_+	type II toxin-antitoxin system HicA family toxin	NA	K7PH44	Enterobacterial_phage	50.0	4.4e-16
WP_032608708.1|2355139_2355598_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	49.3	1.8e-39
WP_032608707.1|2355594_2356020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025760147.1|2356137_2356494_+	hypothetical protein	NA	G0ZNF1	Cronobacter_phage	90.7	7.7e-54
WP_032608706.1|2356652_2356850_-	hypothetical protein	NA	G8C7T7	Escherichia_phage	92.2	1.0e-23
WP_042862569.1|2357356_2357830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044596295.1|2358171_2358366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023294196.1|2358362_2358521_+	hypothetical protein	NA	G8C7T3	Escherichia_phage	96.2	5.8e-22
WP_000607101.1|2358517_2358727_+	cell division protein FtsZ	NA	M9NZE2	Enterobacteria_phage	97.1	3.9e-34
WP_032608703.1|2358799_2359084_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	92.6	1.9e-47
WP_032608701.1|2359102_2359948_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	55.4	4.5e-68
WP_032608700.1|2359944_2360625_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	95.1	6.9e-128
WP_032608699.1|2360621_2361050_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	95.1	1.5e-72
WP_164088318.1|2361046_2361214_+	hypothetical protein	NA	G8C7S7	Escherichia_phage	92.7	5.6e-23
WP_032608698.1|2361210_2361762_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	58.3	2.2e-55
WP_032608697.1|2361758_2361977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127341288.1|2361973_2362174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608692.1|2362452_2362671_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	63.9	4.6e-17
WP_032608691.1|2362670_2362982_+	DUF2591 family protein	NA	E5AGF4	Erwinia_phage	47.4	1.0e-14
WP_032608690.1|2362959_2363199_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	74.4	2.8e-28
WP_032608689.1|2363207_2363438_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	94.7	5.7e-34
WP_071886183.1|2363543_2363879_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_025756108.1|2363755_2364919_+|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	99.5	1.4e-229
2373879:2373895	attR	CGCCAGCAGCGTTTTGT	NA	NA	NA	NA
>prophage 6
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	3119659	3221448	4882039	integrase,protease,transposase	uncultured_Caudovirales_phage(32.0%)	92	3180828:3180842	3216186:3216200
WP_000090707.1|3119659_3120502_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|3120488_3122612_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|3122611_3124060_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|3124100_3125657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262420.1|3125668_3126595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|3126947_3127247_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|3127810_3129637_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000647571.1|3129805_3130156_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	61.4	8.1e-16
WP_000790485.1|3130302_3130734_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_001377740.1|3130978_3132460_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|3132452_3133133_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475506.1|3133322_3134708_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246155.1|3134735_3135089_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000157620.1|3135202_3136495_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_075155265.1|3136505_3139700_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_075155266.1|3142754_3142985_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001023257.1|3144043_3144493_-	copper resistance protein	NA	NA	NA	NA	NA
WP_001378117.1|3144727_3146545_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|3146544_3147441_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|3147480_3147861_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|3147865_3148795_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|3148849_3149530_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|3149526_3150927_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|3151144_3151579_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_032608336.1|3152073_3153693_-	DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032608335.1|3153759_3155268_-	AAA family ATPase	NA	A0A075DXT4	Acinetobacter_phage	30.5	4.1e-48
WP_032608334.1|3155670_3157449_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_032608332.1|3159337_3160021_-	SAM-dependent DNA methyltransferase	NA	A0A2K9V411	Faecalibacterium_phage	38.6	2.3e-30
WP_032608331.1|3160129_3161062_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_032608328.1|3161167_3162154_-	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	40.7	1.7e-50
WP_029591441.1|3162235_3162583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608327.1|3162650_3163253_-	DUF3085 domain-containing protein	NA	NA	NA	NA	NA
WP_032608326.1|3163328_3163976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608325.1|3164062_3164428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608323.1|3164535_3164898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154598151.1|3164890_3165259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|3165986_3166991_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032608321.1|3167069_3167504_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|3167575_3167926_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_011405607.1|3167939_3168215_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_011405608.1|3168402_3170112_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.3e-34
WP_011405609.1|3170147_3170801_+	phenylmercury resistance protein MerG	NA	NA	NA	NA	NA
WP_011405610.1|3170881_3171520_+	organomercurial lyase MerB	NA	NA	NA	NA	NA
WP_021443905.1|3171516_3171864_+	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_087920843.1|3171954_3172158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118541.1|3172175_3175184_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.8	0.0e+00
WP_004118540.1|3175344_3175902_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|3176033_3176366_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|3176719_3177868_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|3178142_3178517_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|3179045_3180242_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|3180313_3181141_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	42.3	4.9e-51
3180828:3180842	attL	TTTTGCAGCAGCTGT	NA	NA	NA	NA
WP_001549885.1|3181159_3182638_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|3183121_3183475_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|3183570_3184854_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|3184903_3185332_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_025801347.1|3185389_3186103_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	5.1e-97
WP_001549890.1|3186108_3186441_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000427614.1|3187309_3188314_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_002718009.1|3190153_3190714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608318.1|3190895_3191864_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.2e-45
WP_003465043.1|3193081_3193438_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|3193692_3194019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074422537.1|3194054_3194231_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_000427623.1|3194412_3195417_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000429838.1|3195516_3195951_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294667.1|3196022_3196373_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000735441.1|3196388_3196664_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000654684.1|3196666_3196912_+	mercury resistance system transport protein MerF	NA	NA	NA	NA	NA
WP_000136268.1|3196908_3198555_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.3	1.0e-39
WP_003465059.1|3198571_3198937_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087809.1|3198933_3199170_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_000904941.1|3199222_3199837_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.9	1.3e-37
WP_000801210.1|3199897_3201115_-	TniQ family protein	NA	NA	NA	NA	NA
WP_000393453.1|3201111_3202020_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010791757.1|3202022_3203705_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_032608310.1|3203900_3204518_+	recombinase family protein	NA	NA	NA	NA	NA
WP_006786007.1|3204584_3205484_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_048859499.1|3206453_3207125_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_071886162.1|3207187_3207682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028016388.1|3208063_3209032_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_029591133.1|3210382_3211654_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.5	8.1e-146
WP_077791480.1|3211656_3212172_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	9.2e-32
WP_004115509.1|3212372_3212774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029593071.1|3212798_3214322_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_004115513.1|3214324_3214663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032608305.1|3216147_3217140_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
3216186:3216200	attR	TTTTGCAGCAGCTGT	NA	NA	NA	NA
WP_032608304.1|3217136_3217535_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_071886161.1|3217743_3218598_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_087744867.1|3218631_3219751_+|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	3.9e-51
WP_127341290.1|3220000_3220294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032608300.1|3220503_3221448_+|protease	CAAX amino protease	protease	NA	NA	NA	NA
>prophage 7
NZ_CP018814	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 chromosome, complete genome	4882039	4350867	4391159	4882039	portal,plate,integrase,tail,lysis,tRNA,capsid,terminase,head	Salmonella_phage(80.49%)	49	4345849:4345879	4396851:4396881
4345849:4345879	attL	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
WP_032607942.1|4350867_4352427_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	7.4e-08
WP_003862595.1|4352423_4352918_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032607938.1|4353063_4353828_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_003862593.1|4353828_4354998_-	DNA repair ATPase	NA	NA	NA	NA	NA
WP_032610576.1|4355375_4356389_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	60.2	4.8e-117
WP_114143818.1|4356398_4357304_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_032610574.1|4357309_4357924_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.4	1.2e-38
WP_015386350.1|4358025_4358262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015386351.1|4358296_4358806_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.0e-83
WP_015386352.1|4358813_4359014_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.9	8.7e-31
WP_032610572.1|4358977_4359319_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	4.5e-51
WP_032610571.1|4359386_4359620_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	79.2	2.1e-23
WP_032610570.1|4359619_4359847_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	1.5e-34
WP_032610569.1|4359843_4360695_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	72.3	2.8e-118
WP_032610567.1|4360691_4363085_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	91.4	0.0e+00
WP_032610566.1|4363246_4363435_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	91.9	5.7e-24
WP_001217561.1|4363447_4363681_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_057979947.1|4363858_4364065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032610563.1|4364152_4365202_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	79.5	2.4e-156
WP_032610561.1|4365201_4366965_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	87.5	6.5e-312
WP_032610559.1|4367114_4367942_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	64.3	1.3e-72
WP_014884904.1|4367957_4369106_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	68.8	1.2e-132
WP_006777754.1|4369109_4369763_+|terminase	Small terminase subunit	terminase	E5G6M7	Salmonella_phage	56.1	5.2e-56
WP_014884903.1|4369861_4370329_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	58.7	1.3e-48
WP_000868184.1|4370328_4370532_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	100.0	3.8e-34
WP_014884902.1|4370535_4370751_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	66.2	2.0e-20
WP_032610558.1|4370731_4371247_+	lysozyme	NA	E5G6N1	Salmonella_phage	76.5	3.1e-72
WP_032610557.1|4371243_4371672_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	85.7	1.4e-57
WP_014884898.1|4371767_4372199_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	89.5	3.5e-69
WP_014884897.1|4372191_4372638_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	81.1	2.4e-60
WP_014884896.1|4372706_4373285_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	96.9	8.2e-106
WP_039264785.1|4373281_4373641_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	89.0	1.5e-52
WP_032610589.1|4373627_4374536_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	92.4	8.0e-148
WP_032610588.1|4374528_4375134_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	93.5	5.2e-111
WP_032610586.1|4375130_4376867_+|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	70.5	3.3e-142
WP_032610585.1|4376866_4377265_+|tail	phage tail fiber protein	tail	K7PMC4	Enterobacterial_phage	50.0	2.4e-19
WP_032610584.1|4377397_4378570_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	1.6e-209
WP_007848874.1|4378579_4379095_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	93.0	7.6e-87
WP_007848877.1|4379149_4379452_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	91.0	3.7e-41
WP_007848878.1|4379466_4379586_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	92.3	3.3e-14
WP_032610582.1|4379578_4383022_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	72.4	0.0e+00
WP_032610580.1|4383021_4383507_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	90.1	3.0e-69
WP_032610578.1|4383503_4384604_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	92.6	5.5e-183
WP_015386379.1|4384673_4384892_+	DNA-binding transcriptional regulator	NA	Q53ZE7	Salmonella_virus	72.2	1.6e-25
WP_032607936.1|4385228_4385735_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_006812010.1|4385835_4387680_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_003862574.1|4387832_4389578_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	39.0	1.4e-76
WP_001144069.1|4389693_4389909_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_032607934.1|4390145_4391159_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	6.3e-109
4396851:4396881	attR	TGTAGGCCGGGTAAGCGCAGCGCCACCCGGC	NA	NA	NA	NA
>prophage 1
NZ_CP018815	UNVERIFIED_ORG: Enterobacter cloacae strain AR_0002 plasmid tig00000003, complete sequence	139942	21082	110831	139942	transposase,integrase	Escherichia_phage(17.78%)	104	44663:44722	93281:93297
WP_020314932.1|21082_23083_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
WP_020314938.1|23151_23400_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020314935.1|23449_24007_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	72.4	1.8e-49
WP_072223070.1|24037_24127_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_022644875.1|24807_25128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644876.1|25152_25416_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.4e-12
WP_001568047.1|25603_25795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|25837_26344_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_073558255.1|26386_27052_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.0e-10
WP_032408983.1|27066_27423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644878.1|27495_28263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644879.1|28316_28736_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|28745_28967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|28966_29668_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_072216848.1|29869_29986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568040.1|30104_30335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644880.1|30396_31068_-	plasmid stability mediator StbB	NA	NA	NA	NA	NA
WP_001568038.1|31070_32042_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_020805749.1|32274_32706_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_022644881.1|32705_33977_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_022644882.1|34058_35033_-	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_015632469.1|35032_36238_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_007372134.1|37019_37424_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_000612626.1|37420_37768_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_022644883.1|37816_39355_+|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_012539983.1|39442_40198_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_032072094.1|40828_40942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408936.1|41070_41328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644886.1|41385_42171_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	1.9e-52
WP_022644887.1|42173_42812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072060.1|42860_43181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|43725_43956_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|43952_44369_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001348075.1|44442_44679_+	AAA family ATPase	NA	NA	NA	NA	NA
44663:44722	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|44725_45430_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
44663:44722	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_022644888.1|45320_46250_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.1	1.5e-45
WP_004201280.1|46405_46879_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001144737.1|47099_47366_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_001389365.1|47508_48273_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|48533_49748_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_072094655.1|49781_51185_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_001749967.1|51596_51803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064577928.1|51807_52296_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|52504_52816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404032.1|52851_53157_-	IncN plasmid KikA protein	NA	NA	NA	NA	NA
WP_001067855.1|53192_53897_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
53130:53786	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_000427619.1|55793_56798_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
53130:53786	attR	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACC	NA	NA	NA	NA
WP_000954592.1|56979_57156_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|57485_58301_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|58361_59165_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|59164_60001_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|59972_60512_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|60721_61582_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|62281_63106_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|63165_63954_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_014454105.1|64023_64578_-	aminoglycoside N-acetyltransferase AAC(6')-Ib'	NA	NA	NA	NA	NA
WP_001217881.1|64811_65369_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_004152391.1|66483_68199_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|68308_71338_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|71444_72470_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|72466_73246_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|73564_74446_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|74695_76015_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004196359.1|76926_77298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|77360_78281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196325.1|78334_79093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196314.1|79326_80625_+	MFS transporter	NA	NA	NA	NA	NA
WP_004196355.1|80730_81000_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|81012_82143_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_032072095.1|82304_82727_+	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196353.1|82982_84323_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015065592.1|84411_85944_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_162859354.1|86377_88660_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_022644891.1|88865_89906_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_087439983.1|90075_91451_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_015632484.1|91639_91966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644893.1|91962_92691_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632482.1|92687_93119_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_022644894.1|93163_95164_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_022644895.1|95232_95481_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644896.1|95529_96072_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644897.1|96746_97067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025404029.1|97102_97357_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
WP_022644899.1|97550_97742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644900.1|97784_98291_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_032072057.1|98335_99001_-	antirestriction protein	NA	NA	NA	NA	NA
WP_032072058.1|99444_100212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644903.1|100265_100685_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_022644904.1|100694_100916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|100915_101617_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_022644905.1|102002_102338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194746.1|102334_102568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644906.1|102602_103535_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_072216862.1|103736_103862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644907.1|103970_104201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644908.1|104404_104650_+	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
WP_044596206.1|104646_105096_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
WP_022644910.1|105107_106379_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	7.3e-147
WP_022644911.1|106480_106681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072061.1|106881_107157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644912.1|107147_107795_-	P-loop NTPase	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
WP_022644913.1|108124_108643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644914.1|109182_109770_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	36.5	2.6e-22
WP_022644915.1|109877_110831_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.4e-62
