The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018763	Pediococcus acidilactici strain BCC1 chromosome, complete genome	2096059	514066	523550	2096059		Enterococcus_phage(33.33%)	8	NA	NA
WP_075139720.1|514066_515494_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.7	1.7e-11
WP_024862546.1|515504_516080_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_024862545.1|516528_517269_+	glucose 1-dehydrogenase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.3	8.3e-18
WP_063504644.1|517791_519942_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	59.9	1.5e-256
WP_024862543.1|519952_520540_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	56.9	3.5e-51
WP_024862542.1|520554_521331_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	2.4e-07
WP_075139721.1|521311_522373_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_128688344.1|522320_523550_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	40.6	1.0e-81
>prophage 2
NZ_CP018763	Pediococcus acidilactici strain BCC1 chromosome, complete genome	2096059	535548	585687	2096059	protease,integrase,transposase	Escherichia_phage(20.0%)	47	533832:533854	554439:554461
533832:533854	attL	ATGGAGTCGGCGGGAGTCGAACC	NA	NA	NA	NA
WP_024862535.1|535548_536469_-|transposase	IS30-like element ISLsa1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	38.2	7.1e-51
WP_075139726.1|536821_538486_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_075139727.1|538707_539637_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	29.9	6.5e-20
WP_126130462.1|539614_540553_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_008842402.1|542308_543643_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.2	2.2e-29
WP_005919347.1|543795_544326_-	MFS transporter	NA	NA	NA	NA	NA
WP_075139729.1|544340_544574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139730.1|545171_545819_+	Mg2+ and Co2+ transporter	NA	NA	NA	NA	NA
WP_075139731.1|545848_546121_+	magnesium transporter CorA	NA	NA	NA	NA	NA
WP_081372606.1|546036_546567_-	recombinase family protein	NA	A0A0A8WIK3	Clostridium_phage	39.4	1.9e-16
WP_075139732.1|546536_547130_+	AlwI family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_075139733.1|549815_551423_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_075140322.1|551722_552160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139734.1|552302_552533_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075139735.1|553067_554222_+|integrase	site-specific integrase	integrase	P97010	Streptococcus_pyogenes_phage	36.6	8.9e-59
WP_008842435.1|555114_555927_+	LicD family protein	NA	A0A1V0SD50	Indivirus	53.4	7.7e-09
554439:554461	attR	ATGGAGTCGGCGGGAGTCGAACC	NA	NA	NA	NA
WP_081041632.1|555951_556752_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_008842437.1|557113_557713_+	chitin-binding protein	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	29.9	2.6e-14
WP_002829841.1|558049_558274_-	CsbD family protein	NA	NA	NA	NA	NA
WP_058120754.1|558668_559463_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_058120753.1|559459_560290_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_075139736.1|560279_560960_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_008842259.1|560941_561619_+	thiaminase II	NA	NA	NA	NA	NA
WP_155569851.1|561660_561810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139737.1|561985_562168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053905833.1|562371_564126_+	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.0	4.3e-73
WP_005917527.1|564262_564976_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_075139738.1|565302_566424_+	serine hydrolase	NA	NA	NA	NA	NA
WP_075139739.1|566439_567219_+	chain-length determining protein	NA	NA	NA	NA	NA
WP_075139740.1|567228_567975_+	CpsD/CapB family tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_002829826.1|567977_568766_+	tyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_075139741.1|568767_569433_+	sugar transferase	NA	NA	NA	NA	NA
WP_075139742.1|569452_570628_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_075139743.1|570630_571929_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_075139744.1|572110_573292_+	EpsG family protein	NA	NA	NA	NA	NA
WP_075139745.1|573318_574461_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_075139746.1|574457_575354_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_075139747.1|575374_576286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139748.1|576288_577365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139749.1|577351_578773_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_075139750.1|578803_579670_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	63.5	6.8e-104
WP_075139751.1|579680_580262_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D7XFA9	Escherichia_phage	40.6	1.6e-32
WP_075139752.1|580274_581303_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.5	9.9e-70
WP_075139753.1|581354_582194_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	38.4	2.2e-35
WP_075139754.1|582431_583268_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	27.0	9.7e-15
WP_075140323.1|583264_583864_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	35.1	3.7e-24
WP_075139755.1|583968_585687_-|transposase	IS1182 family transposase	transposase	A0ZS58	Staphylococcus_virus	37.8	2.8e-93
>prophage 3
NZ_CP018763	Pediococcus acidilactici strain BCC1 chromosome, complete genome	2096059	627262	717726	2096059	head,terminase,integrase,plate,tail,tRNA,portal,holin,capsid	Lactobacillus_phage(54.39%)	114	662085:662106	698811:698832
WP_075139772.1|627262_629680_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	68.2	0.0e+00
WP_053906527.1|629936_631619_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005919135.1|631629_632349_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_075139773.1|632454_633285_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005919128.1|633410_633872_+	universal stress protein	NA	NA	NA	NA	NA
WP_005919122.1|635990_636650_-	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	45.5	3.8e-46
WP_075139774.1|637322_638141_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_004165595.1|638142_638346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139775.1|638342_638561_+	AbrB protein	NA	NA	NA	NA	NA
WP_002830688.1|638560_638839_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_119179331.1|638956_639193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002830690.1|639787_641668_+	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_075139776.1|641686_643210_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_002830692.1|643209_644466_+	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_002830693.1|644471_645179_+	amino acid racemase	NA	NA	NA	NA	NA
WP_075139777.1|645270_646080_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_002830695.1|646162_646975_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008842223.1|647255_647945_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_075139778.1|648339_649419_-|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	36.6	8.9e-45
WP_075139779.1|649566_649971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139780.1|650006_650546_-	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	40.3	1.1e-14
WP_075139781.1|650607_651018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139782.1|651021_651366_-	XRE family transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	36.2	4.5e-11
WP_053905906.1|651638_651854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139783.1|651985_652702_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	50.2	1.4e-54
WP_075139784.1|652764_652971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139785.1|653067_653406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081372591.1|653564_654020_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_075139787.1|654020_654713_+	ERF family protein	NA	I6TJU2	Staphylococcus_virus	39.0	2.0e-21
WP_075139788.1|654705_655131_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	57.5	1.6e-42
WP_075139789.1|655141_655843_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	67.4	1.3e-84
WP_075139790.1|655820_656687_+	hypothetical protein	NA	A0A1W6JNI1	Staphylococcus_phage	39.8	1.9e-37
WP_075139791.1|656676_657909_+	DNA helicase	NA	A0A0P0IXJ2	Lactobacillus_phage	38.0	3.7e-63
WP_075139792.1|657908_658325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036685676.1|658321_658753_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	56.4	3.4e-40
WP_075139793.1|658752_658980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139794.1|658979_659615_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_075139795.1|659777_660149_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_075139796.1|660314_660608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139797.1|660610_660829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081372607.1|660899_661130_+	hypothetical protein	NA	A8ASM5	Listeria_phage	55.2	6.1e-12
WP_075139798.1|661129_661378_+	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	59.5	1.1e-22
WP_075139799.1|661387_661681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764004.1|661886_662048_+	hypothetical protein	NA	NA	NA	NA	NA
662085:662106	attL	GCTTGAGTTTGAGGAGGTAGAA	NA	NA	NA	NA
WP_075139800.1|662111_662450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139801.1|662554_662998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008842056.1|663537_664062_+|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	64.4	2.4e-43
WP_075139802.1|664045_665320_+|terminase	PBSX family phage terminase large subunit	terminase	Q6SE84	Lactobacillus_prophage	68.3	1.1e-171
WP_081372592.1|665380_666736_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	58.6	3.4e-142
WP_075139804.1|666704_667688_+|head	phage head morphogenesis protein	head	A0A0P0I371	Lactobacillus_phage	47.7	2.3e-79
WP_075139805.1|667792_668509_+	DUF4355 domain-containing protein	NA	A0A0A1EN85	Lactobacillus_phage	40.0	2.4e-22
WP_075139806.1|668508_669327_+|capsid	N4-gp56 family major capsid protein	capsid	B5SP31	Lactococcus_phage	72.8	1.6e-99
WP_075139807.1|669344_669611_+	hypothetical protein	NA	A0A2D1GPN4	Lactobacillus_phage	50.0	1.6e-08
WP_075139808.1|669622_669997_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IV23	Lactobacillus_phage	52.2	8.7e-24
WP_075139809.1|670001_670307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139810.1|670299_670641_+	hypothetical protein	NA	A0ZVS5	Lactococcus_phage	45.3	2.6e-19
WP_075139811.1|670641_671043_+	hypothetical protein	NA	A0A097BYB7	Leuconostoc_phage	38.3	7.4e-21
WP_075139812.1|671063_671669_+|tail	phage major tail protein, TP901-1 family	tail	A0A0A1ELH3	Lactobacillus_phage	54.8	2.8e-48
WP_155764005.1|671677_671968_+	hypothetical protein	NA	A0A0P0IXC0	Lactobacillus_phage	40.9	6.3e-06
WP_075139814.1|671974_672190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008842043.1|672252_672588_+	hypothetical protein	NA	A0A0A1ER95	Lactobacillus_phage	57.7	2.9e-26
WP_036685658.1|672632_673004_+	hypothetical protein	NA	A0A1B0Y2Q4	Lactobacillus_phage	42.6	2.1e-17
WP_075139815.1|672987_676008_+|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	62.3	9.0e-111
WP_075139816.1|676007_676769_+|tail	phage tail protein	tail	A0A286QMT6	Streptococcus_phage	40.8	9.4e-41
WP_075139817.1|676768_679714_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	36.7	9.9e-155
WP_075139818.1|679713_680127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139819.1|680130_681867_+|plate	phage baseplate upper protein	plate	NA	NA	NA	NA
WP_075139820.1|681859_682819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139821.1|682818_683097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139822.1|683096_683243_+	XkdX family protein	NA	NA	NA	NA	NA
WP_075140325.1|683262_683577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139823.1|683576_683816_+|holin	holin	holin	A0A2H4PBB2	Lactobacillus_phage	48.3	2.3e-06
WP_075139824.1|683799_685128_+	1,4-beta-N-acetylmuramidase	NA	A0A1X9IGI4	Lactococcus_phage	67.0	7.3e-81
WP_075139778.1|686351_687431_-|integrase	site-specific integrase	integrase	Q9ZXG6	Leuconostoc_phage	36.6	8.9e-45
WP_075139779.1|687578_687983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139780.1|688018_688558_-	hypothetical protein	NA	A0A097BY93	Leuconostoc_phage	40.3	1.1e-14
WP_075139781.1|688619_689030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075139782.1|689033_689378_-	XRE family transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	36.2	4.5e-11
WP_053905906.1|689650_689866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139783.1|689997_690714_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	50.2	1.4e-54
WP_075139784.1|690776_690983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139785.1|691079_691418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081372591.1|691576_692032_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_075139787.1|692032_692725_+	ERF family protein	NA	I6TJU2	Staphylococcus_virus	39.0	2.0e-21
WP_075139788.1|692717_693143_+	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	57.5	1.6e-42
WP_075139789.1|693153_693855_+	hypothetical protein	NA	E9LUU3	Lactobacillus_phage	67.4	1.3e-84
WP_075139791.1|694689_695922_+	DNA helicase	NA	A0A0P0IXJ2	Lactobacillus_phage	38.0	3.7e-63
WP_075139792.1|695921_696338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036685676.1|696334_696766_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0IXM5	Lactobacillus_phage	56.4	3.4e-40
WP_075139793.1|696765_696993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139794.1|696992_697628_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_075139795.1|697790_698162_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_075139796.1|698326_698620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139797.1|698622_698841_+	hypothetical protein	NA	NA	NA	NA	NA
698811:698832	attR	GCTTGAGTTTGAGGAGGTAGAA	NA	NA	NA	NA
WP_081372607.1|698911_699142_+	hypothetical protein	NA	A8ASM5	Listeria_phage	55.2	6.1e-12
WP_075139798.1|699141_699390_+	hypothetical protein	NA	A0A2K9VC51	Lactobacillus_phage	59.5	1.1e-22
WP_075139799.1|699399_699693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764004.1|699898_700060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139800.1|700123_700462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075139801.1|700566_701010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008842056.1|701549_702074_+|terminase	terminase small subunit	terminase	A0A097BYC9	Leuconostoc_phage	64.4	2.4e-43
WP_075139802.1|702057_703332_+|terminase	PBSX family phage terminase large subunit	terminase	Q6SE84	Lactobacillus_prophage	68.3	1.1e-171
WP_081372592.1|703392_704748_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	58.6	3.4e-142
WP_075139804.1|704716_705700_+|head	phage head morphogenesis protein	head	A0A0P0I371	Lactobacillus_phage	47.7	2.3e-79
WP_075139805.1|705803_706520_+	DUF4355 domain-containing protein	NA	A0A0A1EN85	Lactobacillus_phage	40.0	2.4e-22
WP_075139826.1|706519_707338_+|capsid	N4-gp56 family major capsid protein	capsid	B5SP31	Lactococcus_phage	70.9	1.1e-95
WP_075139812.1|709074_709680_+|tail	phage major tail protein, TP901-1 family	tail	A0A0A1ELH3	Lactobacillus_phage	54.8	2.8e-48
WP_155764005.1|709688_709979_+	hypothetical protein	NA	A0A0P0IXC0	Lactobacillus_phage	40.9	6.3e-06
WP_081372593.1|710052_710202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008842043.1|710264_710600_+	hypothetical protein	NA	A0A0A1ER95	Lactobacillus_phage	57.7	2.9e-26
WP_036685658.1|710644_711016_+	hypothetical protein	NA	A0A1B0Y2Q4	Lactobacillus_phage	42.6	2.1e-17
WP_075139815.1|710999_714020_+|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	62.3	9.0e-111
WP_075139816.1|714019_714781_+|tail	phage tail protein	tail	A0A286QMT6	Streptococcus_phage	40.8	9.4e-41
WP_075139817.1|714780_717726_+	peptidoglycan DD-metalloendopeptidase family protein	NA	Q6SEC2	Lactobacillus_prophage	36.7	9.9e-155
>prophage 4
NZ_CP018763	Pediococcus acidilactici strain BCC1 chromosome, complete genome	2096059	1129477	1138040	2096059		Synechococcus_phage(33.33%)	9	NA	NA
WP_070366160.1|1129477_1130059_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.2	8.8e-23
WP_075139991.1|1130058_1131105_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F0L1	Synechococcus_phage	38.7	3.5e-54
WP_008840998.1|1131107_1132577_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	2.8e-57
WP_075139992.1|1132561_1134766_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.4	3.7e-146
WP_036685062.1|1134783_1135458_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_008841001.1|1135454_1135715_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_008841002.1|1135701_1136436_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SLB8	Cyanophage	42.5	1.3e-42
WP_075139993.1|1136413_1137574_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_008841004.1|1137557_1138040_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	39.7	1.6e-17
>prophage 5
NZ_CP018763	Pediococcus acidilactici strain BCC1 chromosome, complete genome	2096059	1176043	1183365	2096059	tRNA	Staphylococcus_phage(28.57%)	7	NA	NA
WP_075140025.1|1176043_1176889_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	34.8	8.0e-17
WP_075140027.1|1177285_1177768_-	dihydrofolate reductase	NA	G9J252	Bacillus_phage	35.4	3.6e-22
WP_005917050.1|1177785_1178736_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	59.6	1.0e-113
WP_075140028.1|1178740_1180636_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	1.5e-50
WP_075140029.1|1180638_1181847_-|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.8	1.3e-44
WP_005917055.1|1181962_1182832_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	37.8	2.6e-55
WP_075140030.1|1182894_1183365_-	nucleoside 2-deoxyribosyltransferase	NA	K4I206	Lactobacillus_phage	34.6	4.6e-14
>prophage 6
NZ_CP018763	Pediococcus acidilactici strain BCC1 chromosome, complete genome	2096059	1532948	1609183	2096059	head,terminase,integrase,tail,portal,protease,tRNA,holin,capsid,transposase	Erysipelothrix_phage(48.57%)	70	1547167:1547226	1557593:1558404
WP_003717945.1|1532948_1533917_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.9	3.7e-34
WP_075140135.1|1533989_1535081_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_075140136.1|1535070_1536603_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	30.2	2.8e-52
WP_003672018.1|1536605_1536827_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	67.2	2.2e-19
WP_075140137.1|1536838_1539451_-	helicase	NA	NA	NA	NA	NA
WP_075140138.1|1539455_1540841_-	DUF1837 domain-containing protein	NA	NA	NA	NA	NA
WP_003672022.1|1541151_1541670_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_075140139.1|1541769_1541973_+	hypothetical protein	NA	A0A2I4R673	Erysipelothrix_phage	34.3	2.2e-05
WP_013923826.1|1541956_1542292_+	hypothetical protein	NA	A0A2K5B2A7	Erysipelothrix_phage	39.1	3.6e-05
WP_003672026.1|1542288_1543425_+	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	52.4	2.0e-108
WP_003672028.1|1543405_1543981_+	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	74.5	5.7e-75
WP_075140140.1|1544036_1545971_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	58.3	1.1e-226
WP_075140141.1|1546037_1546442_+	hypothetical protein	NA	NA	NA	NA	NA
1547167:1547226	attL	AGGTTCTGTTGCAAAGTTTTAAATAAAGAATAAAATCCCTTACGGTATCTATAATTTAAG	NA	NA	NA	NA
WP_013330746.1|1547221_1547908_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_013330746.1|1548095_1548782_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_002415638.1|1548829_1550458_-	ABC-F type ribosomal protection protein PoxtA	NA	A0A1V0SKJ1	Klosneuvirus	28.7	1.2e-48
WP_013330747.1|1551430_1552117_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_125276271.1|1552120_1552651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002415214.1|1552763_1553045_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	52.4	1.4e-13
WP_002415211.1|1554156_1555566_+	MFS transporter	NA	NA	NA	NA	NA
WP_000395511.1|1556070_1556685_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075140143.1|1556823_1557414_-|integrase	site-specific integrase	integrase	D2XR58	Bacillus_phage	34.3	1.7e-21
WP_013330746.1|1557647_1558334_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.9e-127
WP_075140144.1|1560156_1560438_+	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	52.2	7.5e-20
1557593:1558404	attR	AGGTTCTGTTGCAAAGTTTTAAATAAAGAATAAAATCCCTTACGGTATCTATAATTTAAGCTGGGATTCCCAATAATACCTTGATTTCAGTACAGACCGAAAACCCGAAGAGAGTGCCTTCTTTTCGGGTTTTCTTATATAATCCTCGGATGGCTTCCATGCCTTTAATCGTGGGTGAGGCAGTGCGTAAACTTCGATAGAATTTATTGCGTCTCTTTACTGGACGATGGTCTTGTTCAATCAAATTATTCAGGTATTTAATGGTACGATGTTCTGTCCCTTGATAAAAGCCGTATTCTTTTAGTTTCTTAAAGGCACTTGTAATAGAGGGGGCTTTATCTGTGACTACAACCTTCGGTTCATCAAACTGCTTCACTAACCGCTTAAGAAAAGCATAGGCTGCTTGTGTGTCCCGTTTTTTACGTAACCAAATATCCAAGGTTAAACCATCTGCATCGATGGCTCGATACAAATAATGCCATTTTCCTTTAATTTTGATGTACGTTTCATCCATTTTCCATGAATAAAAGGATTTTTTATTTTTCTTTTTCCAAATTTGATAGAGTAGTTTGCCATATTCTTGCACCCAACGATAAATCGTCGTATGAGAAACGTTAATGCCACGATCATATAAGATTTCTTGAACTTCACGATAGCTAAGGTTATAACGAAGATAGTAGCCCACGGCTACAATAATCACATCCTGCTGAAATTGCTTTCCTTTAAAATGATTCATCGTCATTCCTCCTGCTATCTTTTTCTATTATTCTACCTTATTTGATAGTAGATTTAAAACTTTGCAACAGAACCCC	NA	NA	NA	NA
WP_075140145.1|1560418_1561774_+	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	65.2	1.2e-152
WP_075140146.1|1561770_1562238_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_003671980.1|1562386_1562764_+	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	57.3	4.6e-33
WP_003671981.1|1562883_1563426_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	59.9	1.0e-57
WP_003671982.1|1563425_1564652_+	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	63.1	1.0e-153
WP_075140147.1|1564724_1565345_+	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	44.5	4.5e-41
WP_003671984.1|1565347_1565554_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_075140148.1|1565596_1567216_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	77.3	3.2e-248
WP_075140332.1|1567310_1568510_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	63.4	1.4e-152
WP_003671987.1|1568506_1569178_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	52.2	4.4e-58
WP_003671989.1|1569196_1570375_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	58.7	3.1e-128
WP_003671991.1|1570391_1570670_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_075140149.1|1570669_1571053_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_003671994.1|1571039_1571453_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	64.2	3.9e-41
WP_075140150.1|1571449_1572328_+	1,4-beta-N-acetylmuramidase	NA	A0A2K9V3I9	Faecalibacterium_phage	36.0	1.1e-24
WP_047767200.1|1572594_1572828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075140151.1|1572863_1574525_+	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	40.6	2.8e-106
WP_075140152.1|1574517_1576095_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	49.1	1.8e-131
WP_075140153.1|1576145_1577360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075140154.1|1577744_1579118_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	50.6	1.4e-122
WP_075140155.1|1579390_1580386_-	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	26.0	3.2e-17
WP_002832213.1|1580413_1581841_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_005918902.1|1581840_1583301_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_005918900.1|1583300_1583615_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_005918898.1|1583634_1584792_-	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_075140156.1|1584867_1587141_-	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.1	3.9e-135
WP_002832220.1|1587231_1588371_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_002832221.1|1588404_1588977_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002832222.1|1588998_1589640_-	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	50.3	6.0e-33
WP_075140157.1|1589740_1590349_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_075140158.1|1590870_1593720_+	DEAD/DEAH box helicase	NA	Q5YA94	Bacillus_phage	27.0	3.8e-26
WP_075140159.1|1593766_1594885_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_005918884.1|1595150_1595408_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002832230.1|1595551_1595773_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005918882.1|1596338_1596542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075140160.1|1596572_1597874_-	Y-family DNA polymerase	NA	Q6DMX4	Streptococcus_phage	39.1	2.7e-80
WP_024862990.1|1598274_1598826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075140161.1|1598912_1599767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075140333.1|1599954_1601331_-	amino acid permease	NA	NA	NA	NA	NA
WP_008841074.1|1601343_1602444_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_036685148.1|1602764_1602983_-	PspC domain-containing protein	NA	NA	NA	NA	NA
WP_081372603.1|1603482_1606077_+	SEC10/PgrA surface exclusion domain-containing protein	NA	NA	NA	NA	NA
WP_075140162.1|1606250_1607183_+	DUF4767 domain-containing protein	NA	NA	NA	NA	NA
WP_002832236.1|1607460_1607853_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_024862984.1|1607867_1608311_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_075140163.1|1608436_1609183_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
