The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018839	Thauera chlorobenzoica strain 3CB1 chromosome, complete genome	3735506	2233746	2241357	3735506	tRNA	uncultured_Mediterranean_phage(33.33%)	8	NA	NA
WP_075148336.1|2233746_2234778_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	39.6	1.7e-29
WP_075148337.1|2234832_2237223_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_075148338.1|2237224_2237530_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	1.6e-12
WP_075148339.1|2237510_2237891_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075148340.1|2238162_2238906_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.7	4.2e-70
WP_103893759.1|2238890_2239556_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	47.3	2.1e-28
WP_075148342.1|2239570_2240410_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	33.5	1.3e-11
WP_075148343.1|2240421_2241357_+	RNA polymerase sigma factor RpoS	NA	A0A2I7SAT0	Vibrio_phage	33.0	4.8e-31
>prophage 2
NZ_CP018839	Thauera chlorobenzoica strain 3CB1 chromosome, complete genome	3735506	2331466	2339877	3735506		Bacillus_virus(33.33%)	6	NA	NA
WP_075148419.1|2331466_2333281_+	branched-chain amino acid ABC transporter ATP-binding protein/permease	NA	A0A285PWH2	Cedratvirus	31.1	1.4e-10
WP_075148420.1|2333280_2334048_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	2.7e-11
WP_075148421.1|2334158_2334611_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	41.2	2.5e-09
WP_075148422.1|2334678_2337123_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.8	3.8e-75
WP_075148423.1|2337154_2339143_-	type IIA DNA topoisomerase subunit B	NA	G3M9Z3	Bacillus_virus	33.9	5.4e-88
WP_075148424.1|2339307_2339877_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	35.7	5.4e-17
>prophage 3
NZ_CP018839	Thauera chlorobenzoica strain 3CB1 chromosome, complete genome	3735506	3044419	3056852	3735506	portal,head,tail,capsid	Marinobacter_phage(20.0%)	16	NA	NA
WP_075148977.1|3044419_3047098_-|tail	phage tail tape measure protein	tail	A0A0K0PVV1	Roseobacter_phage	39.3	6.5e-28
WP_075148978.1|3047101_3047584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157110120.1|3047580_3047748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075148979.1|3047748_3048267_-	glycoside hydrolase family protein	NA	L7TJR2	Pseudomonas_virus	54.1	4.7e-44
WP_075148980.1|3048259_3048556_-	hypothetical protein	NA	Q3HQU8	Burkholderia_phage	48.1	2.5e-05
WP_075148981.1|3048700_3049492_-	hypothetical protein	NA	A0A2D1GMD2	Marinobacter_phage	35.7	1.8e-39
WP_075148982.1|3049507_3049915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075148983.1|3049914_3050229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075148984.1|3050231_3050432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075148985.1|3050446_3051460_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	38.8	8.6e-58
WP_075148986.1|3051474_3051852_-|head	head decoration protein	head	A0A291AUM0	Sinorhizobium_phage	47.2	3.9e-16
WP_083945242.1|3051864_3053220_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	36.4	1.1e-47
WP_075148987.1|3053216_3054911_-|portal	phage portal protein	portal	A0A2D1GMT8	Marinobacter_phage	33.5	6.0e-64
WP_075148988.1|3054913_3055141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075148989.1|3055314_3055599_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	54.9	4.7e-22
WP_075148990.1|3055637_3056852_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	50.0	2.9e-20
>prophage 4
NZ_CP018839	Thauera chlorobenzoica strain 3CB1 chromosome, complete genome	3735506	3075094	3081622	3735506	integrase	Vibrio_phage(16.67%)	12	3073058:3073073	3082854:3082869
3073058:3073073	attL	GTTCGAGTTCGTCGAC	NA	NA	NA	NA
WP_075149010.1|3075094_3075715_-	hypothetical protein	NA	U3PB51	Vibrio_phage	30.1	2.6e-17
WP_157110122.1|3075839_3076004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149011.1|3076010_3076418_+	hypothetical protein	NA	A0A1U9AJ93	Stx1_converting_phage	49.5	8.0e-15
WP_075149012.1|3076430_3076835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149013.1|3076831_3077065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146060801.1|3077135_3077396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083945319.1|3078142_3078460_+	DUF3310 domain-containing protein	NA	M4QTW5	Salicola_phage	53.2	1.8e-14
WP_075149015.1|3078456_3078894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149016.1|3078890_3079697_+	ParB/RepB/Spo0J family partition protein	NA	S5VSZ7	Leptospira_phage	34.1	4.3e-12
WP_075149746.1|3079981_3080515_+	3'-5' exoribonuclease	NA	C6ZR35	Salmonella_phage	44.2	5.0e-33
WP_075149017.1|3080511_3080724_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_075149018.1|3080650_3081622_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	49.1	4.6e-77
3082854:3082869	attR	GTCGACGAACTCGAAC	NA	NA	NA	NA
>prophage 5
NZ_CP018839	Thauera chlorobenzoica strain 3CB1 chromosome, complete genome	3735506	3260394	3312847	3735506	integrase,transposase,tRNA,capsid	Leptospira_phage(21.43%)	55	3260194:3260241	3272322:3272369
3260194:3260241	attL	TGGTTGCGGGGGCAGGATTTGAACCTGCGACCTTCGGGTTATGAGCCC	NA	NA	NA	NA
WP_075149132.1|3260394_3261696_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_146060805.1|3261714_3262287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149134.1|3262364_3262586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149135.1|3262636_3264250_+	DUF3987 domain-containing protein	NA	A0A088FAP0	Vibrio_phage	40.1	3.7e-87
WP_146060804.1|3264505_3264694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149137.1|3264729_3264999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083945254.1|3265068_3266148_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	35.0	3.5e-41
WP_075149139.1|3266158_3266368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157110123.1|3266364_3266535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149140.1|3266531_3266717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146060803.1|3266924_3267335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149142.1|3267376_3267622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149143.1|3267782_3268115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075149144.1|3268173_3268836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075146703.1|3269175_3269487_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_083945075.1|3269486_3269846_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.8	3.3e-12
WP_075146702.1|3269875_3271492_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	29.6	1.2e-42
WP_075149145.1|3271822_3272170_+	hypothetical protein	NA	A0A2I7S8X6	Vibrio_phage	51.7	3.9e-10
WP_075149146.1|3272843_3273308_-	ProQ activator of osmoprotectant transporter prop	NA	NA	NA	NA	NA
3272322:3272369	attR	TGGTTGCGGGGGCAGGATTTGAACCTGCGACCTTCGGGTTATGAGCCC	NA	NA	NA	NA
WP_075149147.1|3273411_3274056_-	cytochrome B	NA	NA	NA	NA	NA
WP_075149766.1|3274057_3275665_-	tetrathionate reductase family octaheme c-type cytochrome	NA	NA	NA	NA	NA
WP_075149148.1|3275833_3276967_-	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075149149.1|3277162_3277450_+	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_083945255.1|3277460_3278222_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075149150.1|3278477_3279644_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075149151.1|3279670_3280351_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_083945256.1|3280616_3281495_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075149152.1|3281468_3282383_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075149153.1|3282511_3282880_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_083945257.1|3282900_3285786_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.8	1.3e-260
WP_075149154.1|3285813_3286344_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_075149155.1|3286419_3287550_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_075149156.1|3287766_3288171_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_075149157.1|3288189_3289044_-	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_075149158.1|3289040_3289319_-	DUF2132 domain-containing protein	NA	NA	NA	NA	NA
WP_075149159.1|3289969_3291013_-	DMT family transporter	NA	NA	NA	NA	NA
WP_004265716.1|3291084_3291777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103893894.1|3291797_3292496_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_004265712.1|3292593_3293004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043742016.1|3293575_3293905_+	CzcE family metal-binding protein	NA	NA	NA	NA	NA
WP_043742157.1|3294020_3294299_+	periplasmic Cu(I)/Cu(II)-binding protein CopK	NA	NA	NA	NA	NA
WP_075149162.1|3295631_3296666_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	36.1	7.9e-59
WP_004213590.1|3299612_3300170_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	2.6e-48
WP_075149163.1|3300299_3301379_-	signal peptidase II	NA	NA	NA	NA	NA
WP_034375348.1|3301375_3303781_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.8	1.9e-140
WP_003804130.1|3303866_3304307_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_075146703.1|3305249_3305561_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_083945075.1|3305560_3305920_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	35.8	3.3e-12
WP_075146702.1|3305949_3307566_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	29.6	1.2e-42
WP_083945258.1|3307634_3308294_+	AAA family ATPase	NA	A0A059NT77	Lactococcus_phage	35.5	1.0e-27
WP_075149165.1|3308449_3308638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083945259.1|3308913_3309618_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	43.5	4.0e-38
WP_075149166.1|3309601_3310477_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_075149167.1|3310501_3311131_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_103893898.1|3311285_3312847_-|transposase	IS3 family transposase	transposase	Q6J1X2	Lactobacillus_phage	33.3	3.8e-12
>prophage 6
NZ_CP018839	Thauera chlorobenzoica strain 3CB1 chromosome, complete genome	3735506	3548928	3558757	3735506	tRNA	Escherichia_phage(33.33%)	9	NA	NA
WP_075149339.1|3548928_3549474_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.8	4.2e-51
WP_075149340.1|3549473_3550358_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	K7QKA7	Escherichia_phage	60.5	2.0e-95
WP_075149341.1|3550597_3551989_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	32.0	1.4e-53
WP_075149343.1|3552422_3555056_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.0	9.3e-80
WP_075149344.1|3555119_3555533_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_075149345.1|3555522_3555774_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_075149346.1|3555895_3556447_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_075149347.1|3556447_3557521_-	DNA polymerase IV	NA	A0A1W6JNT0	Morganella_phage	23.9	1.0e-16
WP_075149348.1|3557671_3558757_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	S4W5F1	Pandoravirus	46.6	6.1e-78
