The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	80702	125478	4846742	tRNA,plate,tail	Burkholderia_phage(40.91%)	48	NA	NA
WP_001182228.1|80702_81701_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|81788_83099_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416272.1|83345_83861_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|83960_84170_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|84191_84305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128103.1|84301_85627_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|85805_86414_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|86522_86891_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|87061_89482_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|89580_90453_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|90466_90964_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|91144_92062_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|92225_93584_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|93672_94782_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|95143_96334_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382575.1|96465_98010_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|98024_98915_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|99080_99491_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750806.1|99633_101730_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977959.1|101729_102467_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|102463_103132_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|103165_103408_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790036.1|103851_105501_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|105845_107195_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|107325_107673_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226442.1|108250_108538_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	49.1	2.3e-16
WP_001270441.1|108540_109146_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	2.5e-60
WP_000777266.1|109158_109473_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_000449433.1|109632_110088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|110084_110282_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729849.1|110271_111699_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.8e-194
WP_000907495.1|111698_112223_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003640.1|112274_112592_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185656.1|112551_112680_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262484.1|112776_115131_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.8	2.8e-67
WP_000271429.1|115130_116084_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_001269716.1|116083_116293_+	membrane protein	NA	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_000818152.1|116280_117324_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	45.1	3.2e-76
WP_000679396.1|117333_118056_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	2.3e-12
WP_012512893.1|118064_118304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000593184.1|118379_118742_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703634.1|118738_119668_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_000632052.1|119667_121215_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	30.4	1.6e-50
WP_001093501.1|121378_121738_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951728.1|121728_122844_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	5.3e-101
WP_000359503.1|122836_123469_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_000368212.1|123471_124953_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.7	1.6e-52
WP_001177098.1|124962_125478_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	40.7	1.3e-33
>prophage 2
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	244247	310028	4846742	portal,head,lysis,plate,terminase,integrase,tail,protease,capsid,holin	Salmonella_phage(42.22%)	79	274103:274149	305082:305128
WP_000208240.1|244247_244778_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001293360.1|244787_246119_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	2.4e-44
WP_000139637.1|246185_247115_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872918.1|247207_247693_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051370.1|247914_248154_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084285.1|248552_249398_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.6	2.0e-15
WP_000136809.1|249418_250927_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_001250617.1|251038_252049_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000796293.1|252145_252892_+	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_000155229.1|252997_253426_-	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000802242.1|253526_254123_+	YiiQ family protein	NA	NA	NA	NA	NA
WP_001216339.1|254235_255003_+	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001088053.1|255094_255859_-	epimerase	NA	NA	NA	NA	NA
WP_001543603.1|255868_256159_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774146.1|256241_257117_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000090737.1|257145_258168_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000981826.1|258196_259198_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911133.1|259194_260238_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001167248.1|260231_261767_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	6.3e-20
WP_001283049.1|262022_262982_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_000113085.1|263068_264661_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001173080.1|264674_265025_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000621104.1|265114_265246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001519915.1|265523_266246_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000557881.1|266308_267349_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_000646510.1|267358_268318_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000777320.1|268328_269663_-	MFS transporter	NA	NA	NA	NA	NA
WP_000750762.1|269925_270681_-	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_000758711.1|270781_271771_-	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000591793.1|271974_272937_-	ATP-dependent 6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001077320.1|273121_274024_-	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
274103:274149	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000933379.1|274310_274727_+	hypothetical protein	NA	S4TTB4	Salmonella_phage	52.3	1.8e-33
WP_000468311.1|274761_274980_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	100.0	4.7e-38
WP_000627818.1|275057_276227_-	phage late control D family protein	NA	S4TRX8	Salmonella_phage	95.6	1.4e-205
WP_000978869.1|276223_276709_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	94.4	5.9e-81
WP_000069524.1|276720_279162_-|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	93.1	0.0e+00
WP_085984508.1|279154_279310_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	98.0	8.8e-23
WP_001029727.1|279306_279642_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207676.1|279704_280223_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	99.4	1.4e-93
WP_001279030.1|280238_281426_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	100.0	2.0e-223
WP_000874698.1|281560_282130_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.0e-92
WP_000104695.1|282129_283872_-|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	97.1	1.5e-267
WP_001000070.1|283882_284413_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	100.0	1.9e-104
WP_000246674.1|284405_285314_-|plate	baseplate assembly protein	plate	A0A1J0I2M3	Salmonella_phage	98.7	1.7e-158
WP_000127150.1|285320_285668_-|plate	baseplate assembly protein	plate	A0A0M4RE59	Salmonella_phage	98.3	2.1e-56
WP_001093789.1|285664_286306_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	85.0	2.4e-98
WP_000273577.1|286382_287759_-	DUF4062 domain-containing protein	NA	NA	NA	NA	NA
WP_000997680.1|287763_288231_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	9.8e-49
WP_000277800.1|288223_288691_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	69.0	2.2e-56
WP_072209008.1|288653_288899_-|holin	holin	holin	S4TNY4	Salmonella_phage	73.1	5.5e-27
WP_000849743.1|288798_289212_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	59.9	8.4e-36
WP_000534554.1|289208_289718_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	82.6	4.6e-76
WP_000524754.1|289701_289923_-	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	71.2	8.7e-24
WP_001100637.1|289913_290117_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	76.1	8.9e-23
WP_000177982.1|290116_290617_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	68.5	3.8e-59
WP_000224816.1|290714_291473_-|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	67.1	2.7e-80
WP_001224307.1|291476_292637_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	62.5	2.8e-129
WP_001074705.1|292668_293532_-|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	64.8	4.5e-100
WP_000214048.1|293696_295466_+|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	81.0	3.2e-286
WP_000039235.1|295465_296503_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	78.7	7.7e-163
WP_000551923.1|297023_297215_-	hypothetical protein	NA	S4TRZ0	Salmonella_phage	100.0	1.1e-27
WP_000042036.1|297213_297645_+	hypothetical protein	NA	S4TUD6	Salmonella_phage	100.0	1.1e-75
WP_000680929.1|297778_298819_+	Fic family protein	NA	S4TP71	Salmonella_phage	100.0	6.3e-197
WP_000037667.1|298815_299013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257582.1|299191_301468_-	replication endonuclease	NA	S4TTC1	Salmonella_phage	88.0	0.0e+00
WP_000027647.1|301457_301733_-	hypothetical protein	NA	M1TAP2	Escherichia_phage	72.5	7.0e-31
WP_001113578.1|301729_301954_-	hypothetical protein	NA	A0A0F7LDG9	Escherichia_phage	75.7	2.0e-23
WP_000557712.1|302255_302480_-	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	78.4	3.4e-23
WP_001670778.1|302543_303044_-	hypothetical protein	NA	M1SV55	Escherichia_phage	91.0	1.8e-85
WP_001583792.1|303213_303486_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	87.8	1.0e-42
WP_001099751.1|303622_303916_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	75.3	1.6e-36
WP_000985251.1|303985_304966_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	96.0	1.5e-179
WP_001233463.1|305150_305651_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
305082:305128	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|305801_306500_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|306496_307870_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000338672.1|307917_308121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133442.1|308241_308637_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_077906285.1|308648_309401_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|309407_310028_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 3
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	1165187	1203159	4846742	portal,tail,terminase,integrase,head,capsid,holin	Cronobacter_phage(72.22%)	45	1159253:1159273	1209053:1209073
1159253:1159273	attL	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
WP_000478471.1|1165187_1166753_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000983434.1|1166749_1167397_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000213689.1|1167628_1168396_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000627044.1|1168653_1170435_-	ATP-binding protein	NA	X2KLG0	Campylobacter_phage	23.2	6.4e-08
WP_001145219.1|1170424_1171462_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	63.9	1.5e-121
WP_000568371.1|1171465_1172032_-	hypothetical protein	NA	Q4ZA70	Staphylococcus_virus	32.2	7.5e-19
WP_000514631.1|1172048_1172630_-	phage repressor protein	NA	A0A218M4J1	Erwinia_phage	37.2	1.2e-27
WP_001247711.1|1172773_1172995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460878.1|1173025_1173529_+	hypothetical protein	NA	F1BUN6	Cronobacter_phage	72.5	3.5e-60
WP_000643375.1|1173538_1173766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000996837.1|1173755_1174181_+	hypothetical protein	NA	F1BUN5	Cronobacter_phage	49.6	2.2e-23
WP_000022786.1|1174180_1174582_+	hypothetical protein	NA	F1BUN2	Cronobacter_phage	66.9	1.4e-48
WP_000551169.1|1174649_1174883_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_000279404.1|1174873_1175734_+	DNA adenine methylase	NA	F1BUN1	Cronobacter_phage	82.0	1.1e-130
WP_000170874.1|1175730_1177752_+	replication endonuclease	NA	F1BUM9	Cronobacter_phage	74.5	7.9e-297
WP_000353141.1|1177871_1178078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001552031.1|1178051_1178375_-	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	92.3	8.0e-50
WP_000038213.1|1178371_1179433_-|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	76.8	6.7e-162
WP_001151939.1|1179429_1181205_-	hypothetical protein	NA	F1BUM5	Cronobacter_phage	83.1	9.8e-291
WP_000018800.1|1181365_1182169_+|capsid	phage capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	56.0	2.0e-78
WP_000550495.1|1182230_1183253_+|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	81.5	3.9e-159
WP_001218537.1|1183256_1183958_+|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	66.8	9.4e-88
WP_000447487.1|1184018_1184507_+|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	82.7	2.3e-64
WP_000084218.1|1184503_1185010_+|tail	phage tail protein	tail	F1BUL7	Cronobacter_phage	69.1	1.2e-63
WP_000560080.1|1185006_1185714_+	hypothetical protein	NA	F1BUL6	Cronobacter_phage	76.1	1.3e-100
WP_000220203.1|1185710_1186838_+	DUF2586 domain-containing protein	NA	F1BUL5	Cronobacter_phage	83.7	1.9e-175
WP_000166743.1|1186834_1187290_+	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	72.2	1.5e-57
WP_001154425.1|1187299_1187593_+|holin	holin	holin	C7BGD7	Burkholderia_phage	46.2	1.3e-14
WP_000175560.1|1187589_1187931_+	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	91.1	2.2e-50
WP_000376373.1|1187930_1188263_+	hypothetical protein	NA	F1BUL2	Cronobacter_phage	70.9	1.5e-35
WP_001670161.1|1188234_1188423_+	hypothetical protein	NA	F1BUL1	Cronobacter_phage	77.4	1.5e-21
WP_000411339.1|1188409_1188667_+	hypothetical protein	NA	A5X9I7	Aeromonas_virus	63.4	3.6e-21
WP_000811094.1|1188854_1190825_+|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	70.8	3.2e-274
WP_001002797.1|1190821_1191151_+	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	72.4	3.8e-39
WP_000136921.1|1191147_1192332_+	hypothetical protein	NA	F1BUK6	Cronobacter_phage	78.4	6.7e-179
WP_001001828.1|1192324_1192912_+	hypothetical protein	NA	F1BUK5	Cronobacter_phage	82.6	3.8e-90
WP_000084307.1|1192921_1195156_+|tail	tail protein	tail	Q8HAB4	Salmonella_phage	73.7	7.2e-182
WP_000861353.1|1195168_1195723_+|tail	tail fiber assembly protein	tail	S4TUB9	Salmonella_phage	89.0	2.7e-90
WP_000267957.1|1195712_1196438_+	hypothetical protein	NA	F1BUK1	Cronobacter_phage	53.5	3.7e-63
WP_000200789.1|1196409_1196955_+	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	72.0	3.2e-59
WP_001680744.1|1196957_1198658_+	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	81.4	9.9e-224
WP_000746531.1|1199438_1199624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115200405.1|1199593_1200358_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_000237776.1|1200681_1201188_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001519776.1|1201311_1203159_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
1209053:1209073	attR	GATAAGCGCAGCGCCATCAGG	NA	NA	NA	NA
>prophage 4
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	1746367	1823107	4846742	portal,tail,tRNA,lysis,terminase,integrase,head,protease,capsid,holin,transposase	Salmonella_phage(37.93%)	93	1738448:1738464	1828954:1828970
1738448:1738464	attL	CGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000997365.1|1746367_1747405_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179978.1|1747520_1748210_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	4.6e-55
WP_000627811.1|1748528_1748912_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_000188414.1|1748973_1749561_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_001670786.1|1749663_1750563_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219174.1|1750580_1751915_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000083342.1|1752044_1752782_+|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000989165.1|1752766_1754389_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001521719.1|1754473_1754653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014344135.1|1754652_1754817_+	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_000003307.1|1754813_1755389_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001168374.1|1755420_1756071_+	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_000812017.1|1756070_1757027_+	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_000589050.1|1757023_1757503_+	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_001007934.1|1758000_1759230_+|integrase	site-specific integrase	integrase	H6WRW7	Salmonella_phage	94.1	4.9e-233
WP_001670787.1|1759207_1759492_-	excisionase Xis	NA	H6WRW8	Salmonella_phage	86.2	3.1e-42
WP_001237031.1|1759532_1759772_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_077248255.1|1759814_1760972_-	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.5	3.9e-216
WP_000017128.1|1760934_1763862_-	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	99.2	0.0e+00
WP_001539619.1|1763988_1764339_-	hypothetical protein	NA	S4TSN6	Salmonella_phage	97.4	1.1e-60
WP_000917562.1|1764360_1764519_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_000950426.1|1764975_1765638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356948.1|1765637_1766024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001111772.1|1766016_1766856_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	33.3	1.5e-31
WP_000660736.1|1766914_1767310_-	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	61.4	1.9e-37
WP_000643689.1|1767409_1767652_+	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	64.1	2.1e-23
WP_010835408.1|1767611_1767986_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000024044.1|1768077_1768962_+	replication protein	NA	K7PGT1	Enterobacteria_phage	47.2	1.3e-46
WP_000801764.1|1768958_1769654_+	hypothetical protein	NA	G8C7U6	Escherichia_phage	45.4	2.1e-55
WP_000664368.1|1769667_1770366_+	DUF550 domain-containing protein	NA	A0A0M4RTV1	Salmonella_phage	85.7	2.1e-63
WP_000877757.1|1770473_1771106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217669.1|1771348_1771582_+	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_014343878.1|1771698_1771947_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_000929791.1|1771981_1772584_+	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_001241017.1|1772583_1772790_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	97.1	1.7e-34
WP_001096562.1|1772792_1773404_+	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	98.5	1.8e-90
WP_000801757.1|1773400_1773541_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_001097241.1|1773537_1774215_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.0	7.7e-63
WP_072095218.1|1774211_1774397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211410.1|1774487_1775051_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	92.2	7.6e-56
WP_000657897.1|1775557_1775746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001110783.1|1775960_1776647_-|protease	type III secretion system effector protease GogA	protease	Q9MBM2	Phage_Gifsy-1	100.0	9.4e-133
WP_001574216.1|1776922_1777252_+|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000984581.1|1777235_1777688_+	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	5.1e-79
WP_001533543.1|1777705_1778158_+|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	92.7	2.9e-66
WP_000669690.1|1778393_1778795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001102153.1|1779081_1779627_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_000623091.1|1779598_1781530_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	6.3e-259
WP_000201415.1|1781513_1781717_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000831821.1|1781713_1783294_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_001189503.1|1783283_1784780_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	8.1e-97
WP_000011260.1|1784792_1785140_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_000522566.1|1785194_1786223_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000201486.1|1786280_1786640_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_000083294.1|1786650_1787034_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	9.2e-29
WP_000677089.1|1787061_1787640_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000817263.1|1787688_1788819_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q9G0F2	Phage_Gifsy-1	100.0	9.2e-218
WP_000033885.1|1788927_1789329_+|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000971954.1|1789336_1790083_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000479607.1|1790133_1790529_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_010989052.1|1790525_1790864_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000372072.1|1790835_1793931_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.3	6.1e-280
WP_000447369.1|1793933_1794263_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	70.4	1.3e-42
WP_001152689.1|1794272_1794971_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	76.3	5.5e-104
WP_000662739.1|1794977_1795715_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	85.0	5.2e-129
WP_000246126.1|1795612_1796260_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	77.7	2.1e-89
WP_000514917.1|1796321_1799684_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.7	0.0e+00
WP_000178853.1|1799722_1799965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001144691.1|1800018_1802391_+|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	65.6	1.1e-90
WP_000593433.1|1802387_1803212_+|tail	tail protein	tail	A0A0M4QWS3	Salmonella_phage	92.0	1.2e-145
WP_000143154.1|1803201_1803780_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.6e-93
WP_010989049.1|1803876_1804104_-	PagK-like protein	NA	NA	NA	NA	NA
WP_001738443.1|1804210_1804423_+	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	90.6	3.8e-08
WP_015701342.1|1804485_1804551_+	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_015589559.1|1805130_1805295_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001542312.1|1806007_1806145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989047.1|1806629_1808123_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	100.0	3.4e-260
WP_000790154.1|1808527_1810327_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.9	7.2e-23
WP_000002559.1|1810343_1811318_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|1811591_1812272_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000102232.1|1812268_1813174_+	GTPase Era	NA	NA	NA	NA	NA
WP_000399380.1|1813185_1813914_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818972.1|1813925_1814657_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000986042.1|1814656_1815037_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196291.1|1815148_1815409_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	4.9e-18
WP_001022472.1|1815446_1816373_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	24.4	1.8e-09
WP_001276364.1|1816488_1817685_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_000684023.1|1817706_1818624_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000995694.1|1818662_1819511_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001048530.1|1819626_1820520_+	N-acetylmuramic acid 6-phosphate etherase	NA	NA	NA	NA	NA
WP_000361663.1|1820530_1821892_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000253558.1|1821895_1822531_+	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001134572.1|1822555_1823107_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
1828954:1828970	attR	GTAGGCCGGATAAGGCG	NA	NA	NA	NA
>prophage 5
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	2267015	2276186	4846742	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|2267015_2267963_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|2267946_2268678_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|2268658_2268766_-	protein YohO	NA	NA	NA	NA	NA
WP_001240417.1|2268825_2269557_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|2269779_2271465_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|2271461_2272181_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|2272227_2272695_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_001197951.1|2272751_2273282_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703137.1|2273453_2273912_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_000195330.1|2274152_2276186_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 6
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	2344275	2354782	4846742		Enterobacteria_phage(37.5%)	10	NA	NA
WP_001111837.1|2344275_2345679_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
WP_000981471.1|2345856_2346750_+	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_000697840.1|2347126_2348212_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.2e-102
WP_001023659.1|2348211_2349111_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	36.0	5.1e-30
WP_000857530.1|2349158_2350037_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.8	5.1e-107
WP_000973714.1|2350037_2350589_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.0	1.0e-52
WP_000018224.1|2350594_2351569_+	CDP-6-deoxy-delta-3,4-glucoseen reductase	NA	NA	NA	NA	NA
WP_000648783.1|2351584_2352358_+	glucose-1-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000565902.1|2352362_2353442_+	CDP-glucose 4,6-dehydratase	NA	A0A222YY99	Synechococcus_phage	24.5	1.3e-16
WP_000126351.1|2353468_2354782_+	lipopolysaccharide biosynthesis protein RfbH	NA	H8ZJ36	Ostreococcus_tauri_virus	35.1	9.1e-52
>prophage 7
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	2451312	2458563	4846742		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|2451312_2451732_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_000457658.1|2451734_2453003_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000208509.1|2453457_2453670_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131109.1|2453680_2453869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080660.1|2454126_2455323_-	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.1	5.1e-110
WP_000107431.1|2455972_2456284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377036.1|2456363_2457059_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	2.8e-07
WP_001157313.1|2457132_2458563_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 8
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	3356942	3485177	4846742	portal,tail,tRNA,lysis,terminase,integrase,head,protease,holin	Salmonella_phage(51.43%)	158	3424534:3424553	3496329:3496348
WP_010989012.1|3356942_3357263_-	membrane protein	NA	E5G6P3	Salmonella_phage	76.6	1.2e-08
WP_001123040.1|3357480_3358356_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_000938182.1|3358577_3359258_+|protease	type III secretion system effector protease PipA	protease	Q9MBM0	Phage_Gifsy-2	71.0	9.8e-82
WP_001670820.1|3359646_3359913_+	hypothetical protein	NA	A0A0M3ULK3	Salmonella_phage	78.4	7.3e-33
WP_000503667.1|3359969_3360617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670723.1|3360659_3360857_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	1.4e-09
WP_127913510.1|3361039_3361285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033280.1|3361482_3361875_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	37.4	8.5e-14
WP_000370530.1|3361984_3362593_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	44.7	1.1e-31
WP_071786695.1|3362655_3362841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421108.1|3363089_3363608_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	53.8	2.0e-47
WP_001670454.1|3363622_3365155_-	hypothetical protein	NA	S4TP62	Salmonella_phage	66.2	1.4e-128
WP_000049939.1|3365154_3365835_-	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	96.0	5.5e-125
WP_001197089.1|3365831_3367031_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	96.7	5.5e-213
WP_001270641.1|3367031_3367385_-	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	95.7	3.0e-58
WP_000301078.1|3367384_3368137_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	69.8	9.7e-91
WP_000931859.1|3368255_3368711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000819157.1|3368794_3369127_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	69.1	1.7e-23
WP_000155111.1|3370192_3370495_-	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	100.0	4.2e-53
WP_000353826.1|3370494_3371070_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	100.0	2.4e-97
WP_000990866.1|3371069_3373079_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	95.2	0.0e+00
WP_024131618.1|3373068_3373245_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	72.9	4.7e-12
WP_000389049.1|3373256_3373709_-	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	78.7	1.3e-61
WP_000535992.1|3373712_3374156_-	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.5	1.0e-55
WP_001135539.1|3374168_3375314_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	75.3	1.2e-164
WP_001670724.1|3375317_3375881_-	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	78.7	2.1e-82
WP_001121925.1|3375855_3376245_-	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	98.4	2.1e-68
WP_000008738.1|3376231_3376786_-	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	99.5	1.4e-94
WP_001125672.1|3376782_3377190_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	96.3	3.0e-70
WP_001040693.1|3377155_3377545_-	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	62.0	4.0e-32
WP_000627463.1|3377586_3378528_-	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	99.7	3.1e-179
WP_000128057.1|3378539_3379037_-	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	99.4	8.7e-88
WP_000873181.1|3379041_3380274_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	99.3	3.7e-228
WP_137911068.1|3380277_3381024_-|head	phage head morphogenesis protein	head	A0A0M4REK0	Salmonella_phage	91.2	3.1e-97
WP_000113503.1|3380908_3382378_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	99.2	1.3e-280
WP_001130808.1|3382377_3384000_-	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	99.4	0.0e+00
WP_001118126.1|3384002_3384632_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	1.5e-108
WP_086374239.1|3385132_3385588_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	76.8	1.3e-53
WP_000951228.1|3385905_3386445_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	74.1	4.0e-78
WP_001525456.1|3386422_3386725_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000658037.1|3386927_3387116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000640103.1|3387508_3388087_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	52.0	2.4e-44
WP_000717784.1|3388083_3388377_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	65.3	2.1e-33
WP_000090037.1|3388373_3388970_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	73.7	1.5e-81
WP_000474096.1|3389038_3389230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001129735.1|3389413_3389752_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	86.6	3.7e-50
WP_000180135.1|3389751_3389922_-	hypothetical protein	NA	I6S1S6	Salmonella_phage	87.5	6.3e-06
WP_001037052.1|3389918_3390521_-	adenine methylase	NA	G9L699	Escherichia_phage	87.3	1.7e-98
WP_000918617.1|3390513_3390762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000130738.1|3390765_3391446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000074839.1|3391483_3392872_-	DNA helicase	NA	Q76H51	Enterobacteria_phage	47.1	1.2e-105
WP_000063056.1|3392868_3393849_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	80.6	2.3e-44
WP_001195066.1|3393851_3394076_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	44.7	1.0e-08
WP_001643782.1|3394098_3394545_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	50.4	5.5e-25
WP_001526889.1|3394479_3394695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001670726.1|3394609_3394843_-	helix-turn-helix transcriptional regulator	NA	A0A0U2S629	Escherichia_phage	48.6	6.2e-12
WP_000467661.1|3394941_3395406_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	51.7	2.7e-35
WP_000387662.1|3396090_3396414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001192832.1|3396421_3396667_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	53.8	3.5e-13
WP_000158391.1|3396696_3398961_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.7	1.5e-102
WP_000205292.1|3398957_3399512_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	59.3	1.3e-47
WP_000916251.1|3399514_3399697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024131616.1|3399746_3399944_+	hypothetical protein	NA	H9C154	Pectobacterium_phage	58.5	8.3e-10
WP_000196402.1|3399909_3400134_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533596.1|3400134_3401154_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	53.5	1.2e-91
WP_000374046.1|3401741_3402401_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|3402487_3402817_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|3402813_3403095_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000548080.1|3403143_3403923_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859429.1|3403948_3404497_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140482.1|3404711_3405923_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|3405980_3406298_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000975203.1|3406342_3406759_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847732.1|3406929_3407592_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|3407686_3408145_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000420513.1|3408180_3410235_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	1.1e-19
WP_001261222.1|3410358_3410805_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950876.1|3410823_3412977_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|3412963_3413569_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_000288732.1|3413785_3414295_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001670727.1|3414651_3415704_+	porin OmpA	NA	NA	NA	NA	NA
WP_000877172.1|3415775_3416228_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000156448.1|3416413_3418174_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|3418242_3418761_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|3418860_3419028_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|3419283_3419847_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000433416.1|3419843_3421484_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333152.1|3421488_3422742_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|3422756_3424664_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
3424534:3424553	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|3424676_3426785_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|3426883_3427993_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001670452.1|3427989_3428532_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|3428697_3429708_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193770.1|3429915_3432528_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	4.8e-20
WP_000497441.1|3432954_3433146_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	95.2	6.2e-26
WP_001525490.1|3433416_3434103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010989011.1|3434087_3434387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000334547.1|3434455_3435082_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	63.2	1.4e-66
WP_001526469.1|3435729_3436698_-	SPI-2 type III secretion system effector SseI	NA	Q9MBL9	Phage_Gifsy-2	100.0	7.1e-195
WP_000143167.1|3437173_3437755_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.5	1.7e-95
WP_001144679.1|3437754_3440193_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	63.4	2.9e-91
WP_000178849.1|3440246_3440489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000033415.1|3440527_3443878_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	68.6	0.0e+00
WP_000246065.1|3443949_3444654_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	62.6	9.2e-67
WP_000606351.1|3444551_3445289_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	76.1	1.6e-114
WP_001152415.1|3445298_3445994_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	66.7	1.3e-89
WP_000877926.1|3446083_3446617_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	54.0	1.8e-46
WP_000725267.1|3446733_3447231_-	outer membrane beta-barrel protein	NA	A0A1B0VBR9	Salmonella_phage	36.6	1.4e-16
WP_000978296.1|3447329_3447662_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	61.5	3.3e-35
WP_010989010.1|3447658_3450646_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	62.1	8.2e-266
WP_010989009.1|3450725_3451055_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	50.9	5.0e-23
WP_000478859.1|3451051_3451450_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	56.8	8.6e-30
WP_000132756.1|3451495_3452245_-|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	68.6	3.7e-90
WP_000196702.1|3452256_3452658_-|tail	tail protein	tail	K7PHM6	Enterobacterial_phage	60.9	1.5e-42
WP_000453194.1|3452654_3453221_-|tail	phage tail protein	tail	Q9G063	Phage_Gifsy-2	97.8	9.5e-14
WP_000774239.1|3453201_3453501_-	ATP-binding protein	NA	K7PH43	Enterobacteria_phage	45.1	4.5e-15
WP_001107908.1|3453493_3453817_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	61.3	7.7e-29
WP_010989008.1|3453907_3455989_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	69.5	4.8e-265
WP_077679777.1|3455912_3457430_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	65.1	1.5e-175
WP_000196190.1|3457456_3457663_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	53.3	2.9e-05
WP_000989241.1|3457659_3459798_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	72.6	3.4e-290
WP_000371784.1|3459754_3460288_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	48.1	1.0e-33
WP_001541990.1|3460495_3460975_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.0	1.4e-55
WP_000984586.1|3460992_3461445_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	97.3	2.3e-79
WP_001574216.1|3461428_3461758_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_001141973.1|3462033_3462720_+|protease	type III secretion system effector protease GtgA	protease	Q9MBM0	Phage_Gifsy-2	100.0	2.1e-132
WP_000798705.1|3463080_3463530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3463665_3463791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989004.1|3463964_3464282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047631.1|3464348_3465146_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	2.3e-151
WP_001617856.1|3465135_3465282_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096552.1|3465278_3465890_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	91.6	6.9e-79
WP_001241019.1|3465892_3466099_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	100.0	3.5e-35
WP_000929805.1|3466098_3466701_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	98.5	8.3e-109
WP_000807548.1|3466783_3467005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217665.1|3467116_3467350_-	DinI family protein	NA	H6WRY5	Salmonella_phage	98.7	2.1e-36
WP_014343823.1|3467641_3467932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065108.1|3468009_3468321_-	ead/Ea22-like family protein	NA	A0A220NQV2	Salmonella_phage	97.2	7.2e-32
WP_000113629.1|3468317_3468665_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	89.6	5.4e-52
WP_000800010.1|3468675_3469425_-	DNA replication protein DnaC	NA	S4TNF5	Salmonella_phage	99.6	3.6e-138
WP_000062941.1|3469427_3470411_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_001574095.1|3470495_3470870_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	99.2	3.9e-64
WP_000370145.1|3470835_3471075_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	47.2	8.3e-12
WP_001038966.1|3471194_3471605_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	42.4	8.1e-07
WP_014344008.1|3471654_3471915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917564.1|3471907_3472066_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	1.2e-22
WP_001668146.1|3472087_3472387_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	84.5	8.1e-49
WP_000017133.1|3472513_3475399_+	exodeoxyribonuclease	NA	S4TNL0	Salmonella_phage	97.3	0.0e+00
WP_001539618.1|3475361_3476519_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	100.0	1.6e-217
WP_001237031.1|3476561_3476801_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|3476841_3477090_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262306.1|3477134_3478427_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	99.8	1.0e-252
WP_000191406.1|3478621_3479824_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000893197.1|3479904_3481338_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_000544853.1|3481583_3482798_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000301921.1|3482884_3483118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000762343.1|3483114_3483576_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117870.1|3483776_3485177_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	35.1	4.5e-81
3496329:3496348	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 9
NZ_CP013685	Salmonella enterica subsp. enterica serovar Newport strain 0007-33, complete genome	4846742	3549607	3556921	4846742	protease	Ralstonia_phage(16.67%)	7	NA	NA
WP_001670446.1|3549607_3549985_+	hypothetical protein	NA	A0A077KET4	Ralstonia_phage	42.7	5.9e-20
WP_001117984.1|3550146_3550344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934064.1|3550557_3552834_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_000520789.1|3552864_3553185_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000447499.1|3553508_3553730_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000125893.1|3553859_3555806_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
WP_001201748.1|3555802_3556921_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.8e-08
