The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	1162499	1228965	5478335	integrase,plate,lysis,terminase,head,portal,capsid,tail,tRNA	Salmonella_phage(76.09%)	77	1182299:1182345	1217591:1217637
WP_032418442.1|1162499_1163375_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_071844616.1|1164328_1164493_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_032418443.1|1165336_1166695_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_123836165.1|1166704_1167250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418444.1|1167271_1167721_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.8e-44
WP_032418445.1|1168094_1168253_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	68.0	3.2e-12
WP_071844617.1|1168737_1168944_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	7.4e-09
WP_032418447.1|1169384_1170398_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032418448.1|1170408_1171389_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_032418449.1|1171385_1171760_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_032418451.1|1171756_1172278_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_032418453.1|1172390_1172675_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	4.6e-17
WP_087757875.1|1172769_1173126_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032418456.1|1173444_1175514_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	8.7e-73
WP_032418458.1|1175549_1175765_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032418459.1|1176245_1180049_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032418460.1|1180237_1180885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418461.1|1180886_1182134_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	61.8	8.5e-140
1182299:1182345	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_032418462.1|1182430_1183477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155498.1|1183466_1184507_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_031591564.1|1184510_1185143_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
WP_000102105.1|1185259_1185502_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_031591568.1|1185534_1186044_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_000956190.1|1186051_1186252_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_031591570.1|1186215_1186557_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
WP_016529331.1|1186624_1186858_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_031591572.1|1186857_1187085_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_031591574.1|1187081_1187939_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.1e-159
WP_031591576.1|1187935_1190350_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
WP_001154434.1|1190503_1190692_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1190702_1190936_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1191050_1191728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497736.1|1192006_1193158_+	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_032418464.1|1193209_1194244_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.9e-171
WP_031591583.1|1194243_1196010_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|1196152_1196986_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591585.1|1197002_1198061_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_000059191.1|1198064_1198715_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_031591589.1|1198810_1199275_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
WP_031591593.1|1199274_1199478_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
WP_000171568.1|1199481_1199697_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_031591597.1|1199677_1200193_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
WP_031591599.1|1200189_1200618_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
WP_001039947.1|1200713_1201145_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_031591600.1|1201137_1201602_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_031591601.1|1201689_1203201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591602.1|1203327_1203906_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_031591604.1|1203902_1204262_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_031591606.1|1204248_1205157_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086836.1|1205149_1205755_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_031591609.1|1205751_1207473_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	3.5e-152
WP_050486392.1|1207472_1207655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255116.1|1207635_1207788_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	71.1	5.8e-11
WP_032418466.1|1208451_1209018_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.1e-85
WP_031591343.1|1209160_1210333_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
WP_001504081.1|1210342_1210858_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|1210912_1211215_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1211229_1211349_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_032418469.1|1211341_1214419_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
WP_016529761.1|1214415_1214901_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_032418471.1|1214897_1215998_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	4.2e-175
WP_000972389.1|1216088_1216307_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000380485.1|1216568_1216742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591352.1|1216710_1217484_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_002914164.1|1218098_1218581_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1217591:1217637	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_071549035.1|1218691_1219168_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1219157_1219448_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1219514_1219856_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1220003_1221665_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1221751_1222630_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004174800.1|1222754_1223345_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1223465_1224752_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1224771_1225563_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1225726_1227091_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1227350_1227599_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1227617_1228166_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1228197_1228965_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	1330943	1345716	5478335	integrase,tail	Morganella_phage(37.5%)	19	1315806:1315821	1352892:1352907
1315806:1315821	attL	GCGCTGCCGGGGATCC	NA	NA	NA	NA
WP_004213157.1|1330943_1332197_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.4	3.2e-147
WP_004213158.1|1332292_1333300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213159.1|1333430_1333649_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004213160.1|1333648_1334083_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	55.3	2.4e-25
WP_004213161.1|1334096_1334699_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	57.8	1.2e-54
WP_004213162.1|1334698_1334878_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_023302683.1|1334874_1335840_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	44.3	3.9e-07
WP_032418506.1|1335836_1336340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418508.1|1336336_1336546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418509.1|1336542_1337169_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.8e-26
WP_032418510.1|1337178_1337529_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	69.1	8.9e-39
WP_032418512.1|1337521_1339972_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	38.0	1.1e-138
WP_048265897.1|1340279_1340678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418513.1|1340674_1341121_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_077252710.1|1341134_1341485_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_004213172.1|1341489_1341963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213173.1|1342146_1342317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213174.1|1342316_1342643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004213175.1|1342650_1345716_+|tail	phage tail length tape measure family protein	tail	B1GS57	Salmonella_phage	40.5	2.0e-94
1352892:1352907	attR	GCGCTGCCGGGGATCC	NA	NA	NA	NA
>prophage 3
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	1355655	1390167	5478335	terminase,integrase,tail	Salmonella_phage(44.44%)	42	1344320:1344334	1387124:1387138
1344320:1344334	attL	ATCAGCAGAAGGCGG	NA	NA	NA	NA
WP_032418525.1|1355655_1357122_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
WP_004151979.1|1357189_1358767_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032418526.1|1358958_1360212_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
WP_032418527.1|1360473_1361136_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
WP_032418529.1|1361132_1361735_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
WP_023285452.1|1361731_1362238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009485474.1|1362234_1362393_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_009485475.1|1362385_1362679_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1362788_1363037_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032418530.1|1363087_1364110_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
WP_004144292.1|1364119_1365019_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
WP_004164029.1|1365015_1365315_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1365311_1365461_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1365681_1366263_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1366417_1366651_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1366797_1367007_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1367006_1367774_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1367770_1368556_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_032418534.1|1368675_1369023_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
WP_032419436.1|1369215_1369617_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
WP_025860565.1|1369688_1369898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418536.1|1369894_1370149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419437.1|1370148_1370412_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
WP_032418538.1|1371105_1371345_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_032418539.1|1371344_1371683_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
WP_032418540.1|1371757_1372015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418541.1|1372092_1372677_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
WP_032418542.1|1372673_1374149_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	2.4e-279
WP_032413826.1|1374191_1374563_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
WP_004152472.1|1375360_1375564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|1375567_1377247_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|1377243_1377549_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1377830_1378229_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|1378241_1379249_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1379258_1379651_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|1379643_1379922_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|1379970_1380582_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_032418543.1|1380581_1383059_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
WP_032418545.1|1383060_1383531_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
WP_025860587.1|1383523_1384021_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
WP_032418548.1|1384033_1386778_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
WP_032418549.1|1386777_1390167_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
1387124:1387138	attR	ATCAGCAGAAGGCGG	NA	NA	NA	NA
>prophage 4
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	1811919	1820298	5478335		Enterobacteria_phage(28.57%)	8	NA	NA
WP_032418677.1|1811919_1813326_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
WP_032418679.1|1813548_1814613_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_004175258.1|1814639_1815509_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_004175259.1|1815540_1816431_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_021313307.1|1816445_1817000_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|1817179_1818346_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|1818771_1818894_-	small membrane protein	NA	NA	NA	NA	NA
WP_004175262.1|1819293_1820298_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 5
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	1943532	2077601	5478335	protease,integrase,plate,terminase,head,portal,capsid,tail,tRNA,holin	Enterobacteria_phage(23.33%)	149	1996295:1996313	2034043:2034061
WP_000059623.1|1943532_1944795_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
WP_002911729.1|1945362_1946280_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_032418726.1|1946386_1947337_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_064147810.1|1947415_1948357_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004141160.1|1948735_1949656_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911718.1|1949796_1950186_+	RidA family protein	NA	NA	NA	NA	NA
WP_004227143.1|1950851_1951652_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_004184758.1|1951944_1952937_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_032418728.1|1952938_1953166_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
WP_050598702.1|1953473_1954382_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
WP_032418729.1|1954374_1955451_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	6.2e-147
WP_032418730.1|1955578_1956364_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
WP_032418731.1|1956363_1956663_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
WP_032418732.1|1956750_1957668_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
WP_016530207.1|1958114_1958774_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_016530206.1|1958866_1959064_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1959089_1959551_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1959788_1959968_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_032418734.1|1959957_1960926_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
WP_032418735.1|1961131_1961956_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
WP_032418736.1|1961965_1962343_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
WP_032418737.1|1962355_1963336_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
WP_032418738.1|1963349_1963928_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
WP_032418739.1|1964079_1964319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057182115.1|1964489_1964789_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
WP_032418741.1|1964785_1965325_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
WP_032418742.1|1965321_1965669_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_032418743.1|1965665_1965941_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
WP_032418744.1|1965891_1966086_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
WP_022065473.1|1966443_1966689_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_032419453.1|1967200_1967551_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_004884285.1|1967682_1968177_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032418747.1|1968173_1969904_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_004899640.1|1970098_1971328_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|1971314_1971968_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_021313628.1|1971982_1973191_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_021313627.1|1973229_1973433_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.4e-07
WP_021313626.1|1973429_1973750_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032408655.1|1973758_1974097_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_019705270.1|1974093_1974543_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|1974539_1974887_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_021313623.1|1974943_1975648_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_029497345.1|1975678_1976083_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_032418748.1|1976085_1976391_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
WP_016530182.1|1976464_1976698_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032418749.1|1976758_1980145_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
WP_023301979.1|1980165_1980639_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_021313618.1|1980625_1981111_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_021313617.1|1981120_1981501_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_032418750.1|1981497_1984581_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_032419560.1|1987078_1987369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057184564.1|1987423_1989133_-	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.2e-16
WP_032418751.1|1989265_1989844_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|1989894_1990317_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_004216505.1|1990728_1990968_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
WP_032418752.1|1990970_1991297_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
WP_002911596.1|1991900_1993046_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|1993584_1993866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|1993908_1994616_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_073546856.1|1994692_1996093_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	1.9e-100
WP_032419454.1|1996073_1996568_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
1996295:1996313	attL	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_004184683.1|1996542_1997454_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|1997637_1998549_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032418754.1|1998663_2000343_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
WP_002911589.1|2000642_2000864_-	YodD family protein	NA	NA	NA	NA	NA
WP_002911586.1|2000997_2001189_+	protein DsrB	NA	NA	NA	NA	NA
WP_002911561.1|2001221_2001845_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_004189223.1|2002217_2002652_+	lipoprotein	NA	NA	NA	NA	NA
WP_004189225.1|2002693_2004181_-	alpha-amylase	NA	NA	NA	NA	NA
WP_004141135.1|2004381_2005182_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180445.1|2005277_2006264_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_002911547.1|2006279_2006948_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_004151455.1|2006944_2007697_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
WP_002911542.1|2008014_2008737_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_002911541.1|2008804_2009029_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_002911539.1|2009490_2010147_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_002911538.1|2010143_2011976_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002911537.1|2012033_2012582_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032418755.1|2013155_2014163_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
WP_050598706.1|2014159_2015026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418756.1|2015042_2015672_-	membrane protein	NA	NA	NA	NA	NA
WP_077261143.1|2015681_2016110_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
WP_032418759.1|2016382_2016586_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
WP_050598721.1|2016808_2017006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418760.1|2017022_2017421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418761.1|2017430_2017703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418762.1|2017771_2017996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418763.1|2017992_2018571_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
WP_032418764.1|2018579_2018807_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
WP_032418765.1|2018803_2018998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418766.1|2018990_2019944_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
WP_162900880.1|2019943_2020117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156851987.1|2020127_2020283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418767.1|2020258_2021275_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.1	1.9e-97
WP_032418768.1|2021267_2023862_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
WP_032418769.1|2024058_2025060_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_032418771.1|2025795_2026842_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	5.8e-142
WP_032418772.1|2026841_2028563_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
WP_032418773.1|2028723_2029557_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
WP_032418774.1|2029581_2030631_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
WP_032418775.1|2030678_2031578_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
WP_032418776.1|2031680_2032178_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.2e-60
WP_032418777.1|2032177_2032378_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	6.7e-15
WP_032418778.1|2032368_2032650_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.1e-18
WP_032418779.1|2032646_2033198_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
WP_050598707.1|2033194_2033590_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032418780.1|2033734_2034193_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
2034043:2034061	attR	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_032418781.1|2034189_2034831_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
WP_032418782.1|2034830_2035409_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
WP_032418783.1|2035405_2035774_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.3	2.3e-29
WP_032418784.1|2035760_2036660_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
WP_032418785.1|2036652_2037249_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
WP_032418787.1|2040632_2041790_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
WP_032418788.1|2041917_2042406_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
WP_032418789.1|2042417_2045357_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
WP_101972624.1|2045337_2045514_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
WP_032418790.1|2045510_2045810_-	hypothetical protein	NA	B9A7B2	Serratia_phage	73.7	3.1e-32
WP_032418791.1|2045864_2046380_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032418792.1|2046379_2047561_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
WP_032418793.1|2047714_2048869_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
WP_044785060.1|2048913_2049162_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_004180444.1|2049548_2050430_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_023316206.1|2050528_2051197_+	YecA family protein	NA	NA	NA	NA	NA
WP_004151453.1|2051221_2052433_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004175410.1|2052624_2052864_+	YecH family protein	NA	NA	NA	NA	NA
WP_004141101.1|2052899_2053397_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_020956668.1|2053454_2053634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911524.1|2055497_2055749_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_002911522.1|2055786_2057298_-	MFS transporter	NA	NA	NA	NA	NA
WP_004148869.1|2057363_2057522_+	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_004175413.1|2057592_2058102_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_160525722.1|2058536_2058635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911518.1|2058996_2059977_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032418795.1|2060039_2061554_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
WP_002911507.1|2061568_2062549_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002911505.1|2062710_2063499_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004175414.1|2063473_2064898_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_002911500.1|2064921_2065350_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002911499.1|2065703_2067287_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184668.1|2067291_2068431_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_004151452.1|2068492_2070226_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|2070461_2071031_+	VOC family protein	NA	NA	NA	NA	NA
WP_032418796.1|2071107_2071851_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023316208.1|2071932_2072937_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|2072933_2073677_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|2073716_2074112_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_002911483.1|2074164_2074983_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_004145564.1|2074979_2075546_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|2075813_2077601_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 6
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	2880749	2891636	5478335		Escherichia_phage(87.5%)	9	NA	NA
WP_032419001.1|2880749_2883857_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032419002.1|2883911_2885177_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2885207_2886296_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2886382_2886643_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2886940_2887801_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2887821_2888583_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2888843_2889746_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2889757_2891023_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2891015_2891636_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	3593038	3602512	5478335	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023158537.1|3593038_3594760_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3594804_3595506_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3595859_3596078_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3596208_3598488_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3598518_3598836_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3599161_3599383_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_032419142.1|3599459_3601400_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3601396_3602512_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP018735	Klebsiella pneumoniae strain Kp_Goe_121641 chromosome, complete genome	5478335	4112291	4159709	5478335	terminase,head,holin	Cronobacter_phage(26.42%)	67	NA	NA
WP_032419291.1|4112291_4114769_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
WP_032419292.1|4114755_4115151_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
WP_032419293.1|4115147_4115618_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_074513098.1|4115617_4116094_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	4.3e-36
WP_074513099.1|4116206_4116377_+	ATP-NAD kinase	NA	NA	NA	NA	NA
WP_153594629.1|4116373_4116541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029884074.1|4116585_4116828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513100.1|4116827_4119440_-	tape measure protein	NA	A0A1B1W284	Salmonella_phage	33.8	2.7e-79
WP_032415940.1|4119496_4120012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342743.1|4120086_4120299_-	hemolysin XhlA family protein	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
WP_074513101.1|4120871_4121846_-	phage antirepressor N-terminal domain-containing protein	NA	A0A0M4REH5	Salmonella_phage	79.0	1.3e-79
WP_074513112.1|4121913_4122075_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_074513102.1|4122153_4122405_+	Arc family DNA-binding protein	NA	B9UDL4	Salmonella_phage	67.9	9.0e-25
WP_074513103.1|4122407_4122815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074513104.1|4122830_4123010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074513105.1|4123167_4123725_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	86.4	1.6e-85
WP_074513106.1|4123941_4124655_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	54.2	6.2e-63
WP_074513107.1|4124723_4125488_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	44.2	7.2e-41
WP_023339086.1|4125546_4125930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546891.1|4125926_4126295_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	2.9e-48
WP_073546892.1|4126346_4126901_-	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	39.7	4.3e-35
WP_040229587.1|4126998_4127361_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
WP_048336937.1|4127360_4127534_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_004191534.1|4127533_4127914_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.1e-29
WP_032419306.1|4127916_4128210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178847.1|4128219_4129317_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	4.2e-151
WP_004178846.1|4129328_4129760_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.4e-41
WP_032419307.1|4129763_4131149_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	64.0	7.6e-166
WP_050598716.1|4131215_4131695_-	HNH endonuclease	NA	S5M802	Pseudoalteromonas_phage	39.0	5.0e-24
WP_050598717.1|4131997_4133002_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	68.7	1.9e-113
WP_032419309.1|4132928_4134398_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
WP_032419310.1|4134410_4135883_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
WP_032419311.1|4135882_4136485_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
WP_032419312.1|4136922_4137273_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
WP_032419505.1|4137269_4137767_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
WP_012542609.1|4137744_4138014_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032419313.1|4138233_4138773_-	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
WP_032419314.1|4139210_4139900_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	6.7e-62
WP_032419315.1|4140034_4140673_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.4	7.0e-74
WP_032419316.1|4140665_4141334_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	77.8	8.9e-104
WP_024264476.1|4141330_4141498_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	7.8e-09
WP_023283341.1|4141503_4142100_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.3	3.6e-56
WP_032419317.1|4142258_4142573_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	35.6	3.4e-05
WP_009308003.1|4143677_4143854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419318.1|4143853_4144183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419320.1|4144870_4145095_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	51.5	8.3e-14
WP_032419321.1|4145091_4145385_-	protein ren	NA	O48423	Enterobacteria_phage	66.7	1.5e-26
WP_073546926.1|4145384_4146800_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.3	6.3e-184
WP_073546927.1|4146804_4147656_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.0	5.9e-84
WP_032419324.1|4147696_4147843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4147928_4148150_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_001548452.1|4148229_4148421_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_032419325.1|4148525_4149236_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.6	3.7e-92
WP_004191592.1|4149608_4150664_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	68.8	1.1e-140
WP_032419508.1|4150852_4151056_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	4.5e-19
WP_004219883.1|4151365_4151491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4151483_4151690_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_016529276.1|4151770_4152055_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_014342891.1|4152464_4152800_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_032419327.1|4152796_4153420_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.6	6.1e-46
WP_032419328.1|4153416_4153845_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	5.8e-64
WP_032419329.1|4153841_4154498_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.1e-113
WP_032419330.1|4154494_4155631_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
WP_032419331.1|4155846_4156119_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
WP_032419332.1|4156115_4156820_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
WP_072032585.1|4157035_4157371_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|4158842_4159709_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
>prophage 1
NZ_CP018737	Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1	72952	6359	53874	72952	transposase,integrase	Escherichia_phage(45.0%)	50	9717:9776	52089:52909
WP_001067855.1|6359_7064_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_002063889.1|8257_8800_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557452.1|8812_9673_-	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
9717:9776	attL	GGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTG	NA	NA	NA	NA
WP_001067855.1|9779_10484_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001334766.1|11115_11946_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|12076_12631_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|12774_13479_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_148722744.1|13503_14019_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	93.5	4.5e-79
WP_063840280.1|14252_14807_+	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001206315.1|14876_15665_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000722315.1|15724_16549_+	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_000027057.1|17248_18109_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001300294.1|20019_20688_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|20723_20960_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|20956_21319_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|21336_23031_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|23082_23505_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_072093211.1|23540_23666_-	mercury transporter	NA	NA	NA	NA	NA
WP_000239590.1|24788_25664_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|25710_26043_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|27513_28218_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|29192_29897_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152334.1|31375_32086_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|32159_32576_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|32572_32803_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072202616.1|32759_33221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|33364_33715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|33765_34509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|34505_35282_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|35339_35597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|35725_35830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|36364_37231_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|37587_37857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|38271_39477_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064120.1|39476_40451_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|40532_41804_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|41803_42235_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|42640_44128_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|44597_45563_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|46042_46474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|46506_47034_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|47293_47749_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|47820_48186_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|48201_48477_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|48504_48930_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|48968_50654_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|50671_51037_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|51033_51270_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001067855.1|51380_52085_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000227969.1|52797_53874_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
52089:52909	attR	CAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGAATGGAGAAGGCGCGCATCTGGGAGATCACAGACCGTACCGTCCGCACCTGGCTTAGCGAAGCGGTGGAGTCCGCAGCGGCCGACGGGGTGACGTTCTCAGTACCGGTGACCCCCCATACGTTCCGTCACTCCTACGCGATGCACATGCTGTATGCCGGCATACCACTGAAGGTTTTGCAGAGCCTGATGGGCCACAAATCGATTAGCTCGACGGAGGTCTATACGAAGGTGTTTGCGCTCGATGTCGCGGCGCGCCATCGTGTGCAGTTCGCCATGCCGGAAGCTGAAGCTGTTGCGTTGATAAAAAAGTTAACTGAAGTGGTCAACAAAAACTGGCCACCGCGTTAGAGTTTTTCCAGTATCGGTTTTCTGATTCGTTTGGCGGTAACCCACCATTATATTCGTGCGGTCTTAGTGCGCTGTAATATCCAACGATATAGTCCGTTATTGCGTGAGCTGCATCGCTGAAGCTTACATAGCCCGTCGCCGGCACCCATTCGTTCTTCAGACTCCTGAAGAAGCGCTCCATTGGGCTGTTATCCCAGCAGTTTCCACGCCGACTCATACTCTGCCTGATCCGGTATCGCCACAGTAACTGCCGGAACTGCCTGCTCGTATAATGGCTGCCTTGGAGGCCCTTCTAAGAGTCAAGCTGTTATCGGGATACTGTTGATCCGCCTGTTTTGATTGCGCAGTAACGTGTAAACTTCGCGGGAGATATATCGCTTTAGACAGCGTATCGCTTCCATTTTTGTATGT	NA	NA	NA	NA
>prophage 2
NZ_CP018737	Klebsiella pneumoniae strain Kp_Goe_121641 plasmid pKp_Goe_641-1	72952	61332	71802	72952	transposase,integrase	Escherichia_phage(37.5%)	11	62525:62584	71769:72562
WP_087759376.1|61332_62453_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	6.0e-52
62525:62584	attL	GCAGCGTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATT	NA	NA	NA	NA
WP_001067855.1|62550_63255_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071549088.1|63279_63792_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|63796_64003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|64414_65818_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|65851_67066_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|67326_68091_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|68233_68500_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|68720_69194_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|69349_70363_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|71097_71802_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
71769:72562	attR	AATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAACGCTGCCTCATCGCTAACTTTGCAACAGTGCCCGCTCAGCTGGTTGGTAACTATTTTCAACCCGGACTCCAGATCACCTGGGCCAGCTTCAAGGCAGCGCCGCAGATACTCTGACCGATTACCACCTGAAACCAGGTCTATATAGGCCAAAAGTTCATCTGATACTTTTGCGGTTATTGTTGGCATTCAGTCCTCACTTTGTGCATTTTTTAAACGAAAAAAGGGTGTCTAATACGGTGAAATCATAGTATTACCAAAGTAATAAATAAAAAATGTTTTAAATCAGTAAGTTAGATTAGATTTGTAATACCTGGGTAATACCGCAGCATGGTTAAATTTGGTTTTTTTTCTTTTAAATCAGTGAGATAGCGTGATTTATCACGCTGCGTTAGGTGTATAGCAGGTTAAGGGATAAAAAATCATCTTTTTTTGGTAGGGCGATCTCCGTAGGTTAAGGGTCATTTGGCTAAAAAGCGTCCTATTCTTTGATGGTCATGCTTGCATGACCATCTGAGCAACCAAAAACTACAGATAAACTACAGATAAACTACAGATAAACTACAAAAAACGTTTTGCCTTAGTGTTGGAAGACTACAAATAGACTACAATAAAACTACAAAGAAACTACAAAAAACGTGACAGACTACAAATAGACTACAAGAAAACTACAGATAAACTACAAAACTCGATTGACCCCTTCTTACGAGTGTTGTAGAGTCATTTTCATACAACGGAGGGGG	NA	NA	NA	NA
