The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018760	Maribacter sp. T28 chromosome, complete genome	4271158	3785820	3843821	4271158	transposase,integrase	Brevibacillus_phage(28.57%)	46	3826990:3827035	3846947:3846992
WP_068483189.1|3785820_3786894_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	29.8	2.3e-21
WP_074472156.1|3787012_3787393_+	DUF2116 family Zn-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_157483776.1|3787406_3787652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483086.1|3787920_3788631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074472157.1|3788637_3789954_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_068483092.1|3790576_3792250_+	ribulokinase	NA	NA	NA	NA	NA
WP_068483192.1|3792288_3794049_+	L-fucose isomerase	NA	NA	NA	NA	NA
WP_068483095.1|3794144_3795161_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_082960125.1|3795430_3798454_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_082960126.1|3798481_3800116_+	RagB/SusD family nutrient uptake outer membrane protein	NA	NA	NA	NA	NA
WP_082960127.1|3800241_3801423_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_068483104.1|3801459_3802617_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_068483107.1|3802632_3803556_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_068483110.1|3803600_3805073_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	25.4	7.9e-20
WP_068483113.1|3805171_3806506_+	DUF3748 domain-containing protein	NA	NA	NA	NA	NA
WP_157483778.1|3807149_3807626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483119.1|3807926_3808727_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_068483122.1|3808746_3810216_-	DUF2779 domain-containing protein	NA	NA	NA	NA	NA
WP_068483125.1|3810229_3812371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483128.1|3812459_3813722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483131.1|3813724_3814330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483134.1|3814339_3815440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483136.1|3815442_3817269_-	restriction system-associated AAA family ATPase	NA	NA	NA	NA	NA
WP_068483139.1|3817255_3818773_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_068483141.1|3818772_3820392_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.1	2.8e-34
WP_068483144.1|3820392_3823170_-	DEAD/DEAH box helicase	NA	S0A182	Cellulophaga_phage	24.2	4.7e-13
WP_068483198.1|3823293_3823587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483147.1|3823591_3824017_-	TerB family tellurite resistance protein	NA	NA	NA	NA	NA
WP_068483150.1|3824034_3824220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483153.1|3824312_3824564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068483156.1|3824747_3825542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483159.1|3825534_3826938_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
3826990:3827035	attL	ATGTAGCGAGAGGGGGGCACGATCCCCCGACCTCCGGGTTATGAAT	NA	NA	NA	NA
WP_068483162.1|3827372_3827669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068483165.1|3828116_3829850_-	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_074472153.1|3830245_3831214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068485161.1|3831345_3831630_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.1	5.2e-13
WP_068485159.1|3831631_3831934_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.5	9.8e-18
WP_157483873.1|3832166_3833153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074472153.1|3833570_3834539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_068485164.1|3834668_3835199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082960185.1|3835211_3835598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068485157.1|3837545_3838067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068485156.1|3838295_3839426_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_068485155.1|3839428_3841063_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_068484998.1|3841292_3842117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_068484996.1|3842747_3843821_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CP59	Brevibacillus_phage	30.8	1.2e-22
3846947:3846992	attR	ATGTAGCGAGAGGGGGGCACGATCCCCCGACCTCCGGGTTATGAAT	NA	NA	NA	NA
