The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018758	Pseudomonas psychrotolerans strain PRS08-11306 chromosome, complete genome	5271920	185286	193354	5271920	tRNA	uncultured_Caudovirales_phage(85.71%)	10	NA	NA
WP_058762050.1|185286_186564_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	53.8	2.8e-98
WP_074527704.1|186563_187955_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_074527705.1|187957_188959_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_074527706.1|189023_190007_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	65.4	3.3e-123
WP_058762054.1|190003_190318_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	66.7	2.1e-31
WP_058779735.1|190320_190620_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_058762056.1|190616_190973_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	48.3	1.5e-17
WP_058762057.1|190974_191370_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	63.1	2.8e-41
WP_058762058.1|191419_192088_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	72.6	1.2e-79
WP_074529756.1|193135_193354_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	58.0	1.9e-15
>prophage 2
NZ_CP018758	Pseudomonas psychrotolerans strain PRS08-11306 chromosome, complete genome	5271920	605357	615130	5271920		Acinetobacter_phage(33.33%)	11	NA	NA
WP_074527890.1|605357_607169_-	gamma-glutamyltransferase family protein	NA	Q5GF27	Diachasmimorpha_longicaudata_entomopoxvirus	26.1	6.3e-11
WP_058784297.1|607401_607905_-	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_058768452.1|607901_608738_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_074529769.1|609005_609569_+	nicotinamide mononucleotide transporter	NA	A0A140B3H4	Vibrio_phage	24.6	3.1e-09
WP_074527891.1|609565_610093_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_074527892.1|610130_610685_+	Smr/MutS family protein	NA	A0A0P0IDT4	Acinetobacter_phage	32.4	4.2e-14
WP_058778153.1|610748_611297_+	GTP cyclohydrolase I FolE	NA	A0A0P0HSD2	Acinetobacter_phage	64.4	2.9e-60
WP_074527893.1|611358_611664_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_074527894.1|611843_612392_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	41.9	4.7e-26
WP_058765175.1|612602_613556_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074527895.1|613567_615130_+	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.9e-12
>prophage 3
NZ_CP018758	Pseudomonas psychrotolerans strain PRS08-11306 chromosome, complete genome	5271920	1440051	1448646	5271920		Escherichia_phage(33.33%)	9	NA	NA
WP_074528260.1|1440051_1440966_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	2.9e-36
WP_074528261.1|1440962_1441499_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	63.7	2.7e-58
WP_058761294.1|1441498_1442380_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.6e-105
WP_058761295.1|1442451_1443516_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.4	2.3e-98
WP_074528262.1|1443737_1445720_-	polysaccharide biosynthesis protein	NA	A0A2P1ELS8	Moumouvirus	24.2	3.5e-15
WP_081321766.1|1445730_1446780_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_074528263.1|1446776_1447751_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_058773025.1|1447891_1448113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007160396.1|1448358_1448646_-	integration host factor subunit beta	NA	G3M9Y0	Bacillus_virus	39.1	1.6e-09
>prophage 4
NZ_CP018758	Pseudomonas psychrotolerans strain PRS08-11306 chromosome, complete genome	5271920	2738406	2746804	5271920		Mycobacterium_phage(33.33%)	7	NA	NA
WP_058761494.1|2738406_2738631_+	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	56.8	5.0e-19
WP_058767837.1|2738641_2739046_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	F8WQ19	Bacillus_phage	35.0	5.9e-10
WP_074528795.1|2739027_2741169_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	49.0	3.8e-204
WP_058761492.1|2741179_2742160_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	73.4	6.4e-135
WP_074528796.1|2742595_2744134_+	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_058779554.1|2744130_2744637_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A2P1EI66	Megavirus	29.4	1.7e-14
WP_074528797.1|2744755_2746804_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.9	7.3e-40
>prophage 5
NZ_CP018758	Pseudomonas psychrotolerans strain PRS08-11306 chromosome, complete genome	5271920	3237252	3274409	5271920	holin,plate,transposase	Serratia_phage(16.67%)	31	NA	NA
WP_074529025.1|3237252_3238584_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_074529026.1|3238587_3239058_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_058766901.1|3239059_3240247_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_058794424.1|3240402_3241896_-	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_074529027.1|3241892_3244421_-	type VI secretion system ATPase TssH	NA	A0A1S6UBG5	Serratia_phage	33.5	2.2e-86
WP_074529028.1|3244436_3245447_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_074529029.1|3245410_3247195_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_058762305.1|3247199_3247604_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_058766906.1|3247610_3249089_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_058794419.1|3249103_3249598_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_157772829.1|3249627_3251133_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_058762309.1|3251516_3252191_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_074529031.1|3252329_3253553_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.1	5.4e-38
WP_058794417.1|3253545_3254001_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	61.2	6.6e-50
WP_074529032.1|3254046_3256596_+	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	29.8	5.3e-56
WP_058762313.1|3256670_3257573_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_074529033.1|3257633_3258485_-	DUF1989 domain-containing protein	NA	NA	NA	NA	NA
WP_058787881.1|3258518_3259184_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058762316.1|3259416_3260013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058762317.1|3260193_3260835_-	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_058762318.1|3260915_3261695_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_074529034.1|3261813_3263142_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_074529035.1|3263183_3263612_-	universal stress protein	NA	NA	NA	NA	NA
WP_058773771.1|3263695_3265054_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_058763061.1|3265267_3266521_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	2.0e-101
WP_058768398.1|3266600_3267851_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_058763066.1|3267862_3268162_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_074529036.1|3268158_3271179_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_058763070.1|3271194_3271824_+	sarcosine oxidase subunit gamma family protein	NA	NA	NA	NA	NA
WP_058763072.1|3271924_3272782_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_058768395.1|3273173_3274409_-|holin	choline ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	35.1	1.4e-25
>prophage 6
NZ_CP018758	Pseudomonas psychrotolerans strain PRS08-11306 chromosome, complete genome	5271920	4080052	4148226	5271920	tail,holin,plate,integrase	uncultured_Caudovirales_phage(27.5%)	73	4115833:4115870	4149549:4149586
WP_099049476.1|4080052_4080745_+|holin	phosphatidylcholine synthase	holin	NA	NA	NA	NA
WP_058763318.1|4080747_4081068_+	GIY-YIG nuclease family protein	NA	A0A2I7QNM5	Vibrio_phage	39.2	2.0e-05
WP_074529326.1|4081055_4081994_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_074529327.1|4082057_4082678_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_074529328.1|4082688_4083159_-	metallophosphoesterase family protein	NA	NA	NA	NA	NA
WP_074529329.1|4083168_4084698_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_074529330.1|4084780_4085695_-	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_058763329.1|4085694_4086120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529331.1|4086366_4088871_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	24.9	8.4e-22
WP_058763331.1|4088894_4089635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529333.1|4089977_4090808_+	oxidoreductase	NA	NA	NA	NA	NA
WP_074529334.1|4090820_4091759_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_074529335.1|4091871_4092300_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_074529336.1|4092303_4093512_-	amino acid deaminase	NA	NA	NA	NA	NA
WP_074529337.1|4093508_4094282_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058768196.1|4094296_4094683_-	RidA family protein	NA	NA	NA	NA	NA
WP_074529338.1|4094711_4095488_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.8e-31
WP_074529339.1|4095484_4096147_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_074529340.1|4096157_4096820_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_037007680.1|4096868_4097705_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_074529341.1|4097915_4099379_-	D-aminoacylase	NA	NA	NA	NA	NA
WP_074529342.1|4099576_4101595_+	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	37.3	1.1e-06
WP_058784083.1|4101887_4103909_+	methyl-accepting chemotaxis protein	NA	A0A1B0VAH3	Salmonella_phage	37.3	3.4e-05
WP_058763356.1|4104005_4104437_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A2H4J538	uncultured_Caudovirales_phage	37.0	9.1e-17
WP_074529343.1|4104429_4105701_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	46.7	7.6e-96
WP_058763371.1|4105716_4107822_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_058763373.1|4107833_4109048_-	MFS transporter	NA	NA	NA	NA	NA
WP_074529344.1|4109037_4110951_-	siderophore synthetase	NA	NA	NA	NA	NA
WP_074529345.1|4111058_4112453_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_074529346.1|4112795_4114973_+	PAS domain-containing hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	36.4	4.3e-06
WP_074529856.1|4115101_4115494_+	RidA family protein	NA	NA	NA	NA	NA
4115833:4115870	attL	GGGCGAAGGGAATCGAACCCTCGTCATGAGCTTGGGAA	NA	NA	NA	NA
WP_058763381.1|4116024_4117221_+|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.6	8.4e-36
WP_058763383.1|4117229_4117433_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_074529857.1|4117519_4120357_-	bifunctional DNA primase/helicase	NA	A0A2H4J936	uncultured_Caudovirales_phage	63.7	0.0e+00
WP_074529347.1|4120368_4120590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529348.1|4120586_4120832_-	hypothetical protein	NA	A0A2H4JGL7	uncultured_Caudovirales_phage	47.1	4.4e-08
WP_074529349.1|4120908_4121106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058794958.1|4121102_4121399_-	transcriptional regulator	NA	Q9ZXJ1	Pseudomonas_virus	55.3	2.0e-23
WP_058777467.1|4121450_4121681_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_058763395.1|4121765_4122107_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	47.7	8.2e-21
WP_058777468.1|4122237_4122459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529351.1|4122550_4123834_-	phage late control D family protein	NA	Q9ZXJ8	Pseudomonas_virus	54.7	2.3e-124
WP_058763401.1|4123830_4124274_-|tail	phage tail protein	tail	Q9ZXJ9	Pseudomonas_virus	66.7	2.9e-50
WP_074529352.1|4124279_4126553_-	hypothetical protein	NA	A4PE52	Ralstonia_virus	40.0	1.2e-75
WP_074529353.1|4126542_4126662_-|tail	GpE family phage tail protein	tail	Q9ZXK1	Pseudomonas_virus	64.1	1.4e-07
WP_058763405.1|4126670_4126976_-|tail	phage tail assembly protein	tail	E5FFG7	Burkholderia_phage	56.0	1.2e-20
WP_058768225.1|4127029_4127545_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	74.3	6.1e-68
WP_058778840.1|4127589_4128756_-|tail	phage tail sheath protein	tail	F1BUU3	Erwinia_phage	71.2	2.2e-158
WP_081375614.1|4128929_4129355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081375615.1|4129365_4131309_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	52.6	5.0e-14
WP_099049477.1|4131854_4133063_-|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	42.3	6.7e-33
WP_074529859.1|4133566_4134133_-|tail	phage tail protein I	tail	V5YTN0	Pseudomonas_phage	53.8	1.2e-21
WP_074529355.1|4134125_4135031_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	50.2	7.2e-72
WP_058763420.1|4135258_4135690_-	hypothetical protein	NA	A0A2H4J973	uncultured_Caudovirales_phage	54.3	2.1e-42
WP_058763422.1|4135686_4136229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529356.1|4136238_4137363_-	hypothetical protein	NA	A0A0M3ULH6	Salmonella_phage	64.2	7.3e-50
WP_074529357.1|4137359_4137974_-|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	64.4	3.8e-69
WP_074529358.1|4137976_4138885_-|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	56.0	3.7e-84
WP_058773325.1|4138881_4139226_-|plate	baseplate assembly protein	plate	A0A2H4JE52	uncultured_Caudovirales_phage	51.4	1.5e-25
WP_074529359.1|4139222_4139813_-|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	65.6	6.3e-53
WP_074529360.1|4139881_4140163_-|tail	phage tail protein	tail	D5LGY9	Escherichia_phage	59.3	5.5e-23
WP_074529361.1|4140173_4141568_-|tail	phage tail protein	tail	D5LGZ0	Escherichia_phage	53.1	7.8e-126
WP_058778851.1|4141692_4142247_-	DUF4376 domain-containing protein	NA	A0A2H4JF49	uncultured_Caudovirales_phage	60.0	3.5e-37
WP_074529362.1|4142243_4143875_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_074529363.1|4143867_4144503_-|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	46.2	2.8e-38
WP_058773332.1|4144495_4145419_-|plate	baseplate assembly protein	plate	A0A088FQL4	Escherichia_phage	56.2	9.8e-85
WP_074529364.1|4145619_4146135_-|tail	phage tail protein	tail	Q9ZXL3	Pseudomonas_virus	44.8	1.2e-28
WP_157772837.1|4146118_4146274_-	hypothetical protein	NA	K4PAX1	Burkholderia_phage	57.1	3.7e-05
WP_157772838.1|4146230_4146665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529365.1|4146661_4146859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529366.1|4146855_4147668_-	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	56.5	1.6e-70
WP_058763537.1|4147664_4147979_-|holin	phage holin, lambda family	holin	A0A2H4J1U5	uncultured_Caudovirales_phage	47.7	8.1e-23
WP_058778858.1|4148001_4148226_-|tail	phage tail protein	tail	A0A2H4J946	uncultured_Caudovirales_phage	58.6	2.9e-14
4149549:4149586	attR	GGGCGAAGGGAATCGAACCCTCGTCATGAGCTTGGGAA	NA	NA	NA	NA
>prophage 1
NZ_CP018759	Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence	114250	0	20091	114250		Pseudomonas_phage(22.22%)	35	NA	NA
WP_157772855.1|1031_1238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529896.1|1441_1648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529897.1|2086_2290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529898.1|2538_2769_+	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	62.7	9.4e-13
WP_157772856.1|3766_4165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529900.1|4161_4428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529901.1|4424_4799_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	50.4	2.7e-33
WP_081375648.1|4821_5142_+	DUF2786 domain-containing protein	NA	A0A2H4JCP9	uncultured_Caudovirales_phage	44.6	1.6e-05
WP_157772857.1|5117_5585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529902.1|5581_6055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529903.1|6044_6512_+	hypothetical protein	NA	H2BD44	Pseudomonas_phage	37.4	9.2e-15
WP_157772858.1|6555_6843_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529905.1|6839_7238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529906.1|7347_7584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772859.1|7605_7770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529907.1|7766_8264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081375650.1|8291_9317_+	thymidylate synthase	NA	A0A142IIU2	Enterobacteria_phage	38.0	6.2e-56
WP_074529908.1|9412_9766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529909.1|9758_10031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529910.1|10036_10768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772860.1|10764_11199_+	hypothetical protein	NA	A0A097PAL3	Delftia_phage	71.2	2.2e-23
WP_074529911.1|11158_11434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529912.1|11535_11853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529913.1|11862_12432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772861.1|12462_13410_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	24.3	1.8e-12
WP_074529915.1|13488_13695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772862.1|13835_13973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529916.1|13965_15516_+	hypothetical protein	NA	Q71T61	Escherichia_phage	33.4	2.4e-67
WP_074529917.1|15578_15800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529918.1|15796_16210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529919.1|16243_16540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529920.1|16539_17559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529921.1|17632_17908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529922.1|17910_18393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772863.1|18471_20091_+	hypothetical protein	NA	A0A222YXQ7	Escherichia_phage	28.0	7.6e-40
>prophage 2
NZ_CP018759	Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence	114250	25921	32336	114250		Pseudomonas_phage(40.0%)	5	NA	NA
WP_074529929.1|25921_27259_+	SGNH/GDSL hydrolase family protein	NA	A0A059VA35	Pseudomonas_phage	26.0	6.1e-19
WP_157772865.1|27361_29620_+	hypothetical protein	NA	Q7Y5J1	Xanthomonas_virus	33.6	9.3e-28
WP_074529931.1|29633_30530_+	hypothetical protein	NA	A0A1L2BYA7	Clostridium_phage	26.7	4.7e-15
WP_074529932.1|31127_31814_+	hypothetical protein	NA	A0A2H4P873	Pseudomonas_phage	31.7	1.4e-06
WP_074529933.1|31817_32336_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	46.5	3.9e-30
>prophage 3
NZ_CP018759	Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence	114250	36102	47950	114250		Pseudomonas_phage(20.0%)	8	NA	NA
WP_074529939.1|36102_37179_+	hypothetical protein	NA	A0A0S0N716	Pseudomonas_phage	40.2	2.7e-62
WP_157772866.1|37175_37352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529940.1|37355_37628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772867.1|37689_39507_+	hypothetical protein	NA	M4M9L8	Vibrio_phage	49.0	1.7e-35
WP_074529942.1|39792_42333_+	hypothetical protein	NA	V5UQK6	Shigella_phage	29.1	1.2e-20
WP_074529943.1|42325_44188_+	hypothetical protein	NA	G9BWI3	Planktothrix_phage	33.3	1.0e-08
WP_074529944.1|44184_44511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529945.1|44503_47950_+	methyltransferase domain-containing protein	NA	A8HNV9	Thalassomonas_phage	39.0	1.5e-53
>prophage 4
NZ_CP018759	Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence	114250	57981	59075	114250		Bordetella_phage(100.0%)	2	NA	NA
WP_074529958.1|57981_58296_+	hypothetical protein	NA	A0A291LAU3	Bordetella_phage	47.8	3.0e-09
WP_157772869.1|58292_59075_+	lytic murein transglycosylase	NA	A0A291LA05	Bordetella_phage	63.3	2.3e-71
>prophage 5
NZ_CP018759	Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence	114250	66389	82163	114250		Vibrio_phage(27.27%)	24	NA	NA
WP_074529976.1|66389_67028_-	hypothetical protein	NA	A0A2H4JC30	uncultured_Caudovirales_phage	69.1	3.3e-79
WP_074529977.1|67082_67472_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_074529978.1|67468_67705_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_074529979.1|67942_68593_+	AAA family ATPase	NA	D3JZ99	Mycobacterium_phage	36.8	4.4e-07
WP_074529980.1|68589_68952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529981.1|68961_69267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529982.1|69269_69635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529983.1|69631_70465_-	hypothetical protein	NA	A0A059VJU4	Pseudomonas_phage	39.1	6.9e-05
WP_074529984.1|70519_70729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529985.1|70725_71973_-	recombination-associated protein RdgC	NA	L7TP07	Pseudomonas_virus	62.1	2.7e-101
WP_074529986.1|71962_72451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074529987.1|72462_73035_-	single-stranded DNA-binding protein	NA	W6MWX5	Pseudomonas_phage	79.2	4.9e-50
WP_074529988.1|73104_73950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157772871.1|73977_74610_-	hypothetical protein	NA	A0A2K9V3J9	Faecalibacterium_phage	34.3	1.0e-16
WP_074529990.1|74606_75617_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.5	4.4e-70
WP_074529992.1|76989_77973_+	hypothetical protein	NA	A0A1C9LVZ5	Vibrio_phage	45.9	1.4e-12
WP_157772872.1|77923_78697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530027.1|78720_79068_+	DUF968 domain-containing protein	NA	NA	NA	NA	NA
WP_074529994.1|79162_79459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530028.1|79530_79932_+	dUTP diphosphatase	NA	A0A2I7QLE0	Vibrio_phage	49.6	2.4e-27
WP_074529995.1|79931_80954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530029.1|81076_81418_+	DUF1064 domain-containing protein	NA	T1SA23	Salmonella_phage	60.2	3.1e-28
WP_074529996.1|81414_81669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529997.1|81692_82163_+	DUF1367 family protein	NA	A0A2I7RQ46	Vibrio_phage	36.5	4.4e-17
>prophage 6
NZ_CP018759	Pseudomonas psychrotolerans strain PRS08-11306 plasmid pPRS08-11306, complete sequence	114250	85862	109758	114250		Pseudomonas_phage(40.0%)	43	NA	NA
WP_074530002.1|85862_86804_+	hypothetical protein	NA	I6NV32	Burkholderia_virus	36.8	7.8e-29
WP_074530003.1|86870_87122_+	hypothetical protein	NA	A0A1W6JTA9	Pseudomonas_phage	55.2	5.3e-09
WP_074530004.1|87231_87606_+	hypothetical protein	NA	A0A0U1UNQ6	Pseudomonas_phage	52.1	2.5e-23
WP_074530005.1|87602_88616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530006.1|88612_89011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530007.1|89003_89780_+	hypothetical protein	NA	A0A0U4JEF1	Pseudomonas_phage	47.4	4.6e-11
WP_074530008.1|89776_90139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772875.1|90135_90441_+	hypothetical protein	NA	A0A291LA57	Bordetella_phage	53.8	2.2e-17
WP_074530010.1|90604_91303_+	hypothetical protein	NA	H2BD37	Pseudomonas_phage	52.9	9.9e-21
WP_074530030.1|91642_91873_+	hypothetical protein	NA	Q9ZXM0	Pseudomonas_virus	69.6	2.6e-15
WP_074530012.1|92084_92360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530031.1|92422_92845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530013.1|92841_93354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530014.1|93350_95192_+	DEAD/DEAH box helicase	NA	A0A2K8IBK8	Pseudomonas_phage	65.4	2.5e-220
WP_081375653.1|95294_95972_+	hypothetical protein	NA	I6WMX7	Pseudomonas_phage	43.8	2.2e-33
WP_074530015.1|96024_96240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530016.1|96326_96782_+	hypothetical protein	NA	A0A223LH76	Erwinia_phage	47.3	1.7e-13
WP_074529898.1|96778_97009_+	hypothetical protein	NA	A0A0U1VYM8	Pseudomonas_phage	62.7	9.4e-13
WP_074530017.1|97060_97597_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	J9Q7H7	Salmonella_phage	48.0	3.5e-26
WP_074530018.1|97593_97983_+	DUF2493 domain-containing protein	NA	A0A291L9X7	Bordetella_phage	50.4	1.8e-24
WP_157772856.1|98008_98407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529900.1|98403_98670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074530019.1|98666_99044_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	52.0	2.7e-33
WP_074530020.1|99062_99827_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	30.7	3.1e-12
WP_074529902.1|99823_100297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529903.1|100286_100754_+	hypothetical protein	NA	H2BD44	Pseudomonas_phage	37.4	9.2e-15
WP_157772858.1|100797_101085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529905.1|101081_101480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529906.1|101589_101826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772859.1|101847_102012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529907.1|102008_102506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081375650.1|102533_103559_+	thymidylate synthase	NA	A0A142IIU2	Enterobacteria_phage	38.0	6.2e-56
WP_074529908.1|103654_104008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529909.1|104000_104273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529910.1|104278_105010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772860.1|105006_105441_+	hypothetical protein	NA	A0A097PAL3	Delftia_phage	71.2	2.2e-23
WP_074529911.1|105400_105676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529912.1|105777_106095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529913.1|106104_106674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772861.1|106704_107652_+	hypothetical protein	NA	K7PKM7	Enterobacterial_phage	24.3	1.8e-12
WP_074529915.1|107730_107937_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157772862.1|108077_108215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074529916.1|108207_109758_+	hypothetical protein	NA	Q71T61	Escherichia_phage	33.4	2.4e-67
