The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	444765	478023	5295517	capsid,tRNA,integrase,portal,tail,head,terminase,protease	uncultured_Caudovirales_phage(75.0%)	34	462373:462390	478368:478385
WP_002919147.1|444765_445713_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|445727_446237_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|446365_447490_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|447461_447935_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|447960_448503_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|448507_449080_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_073545598.1|449083_449902_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|449898_450156_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|450131_450686_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|456481_456703_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|456996_460107_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|460119_461259_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|461637_462288_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
462373:462390	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|462563_463790_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|463882_464824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|465005_465290_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|465300_466080_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|466531_466801_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|466793_466982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|466974_467289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|467285_467654_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|467650_468016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|468015_470151_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|470493_470829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|470877_471390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|471653_472820_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|472871_473432_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|473433_474675_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|474671_475007_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|475003_475303_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|475302_475746_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|475738_475891_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|476021_476378_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|476361_478023_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
478368:478385	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	2009886	2066153	5295517	plate,transposase,protease	Microcystis_phage(27.27%)	55	NA	NA
WP_032425077.1|2009886_2010633_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032425076.1|2011071_2012058_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|2012889_2013012_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|2013309_2013453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286625.1|2013629_2014571_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2014664_2015654_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2015679_2017011_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|2017038_2018247_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|2018275_2020570_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_004225356.1|2020621_2020768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004189329.1|2021057_2022116_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2022225_2023140_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|2023149_2024436_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|2024432_2025308_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_004175491.1|2025304_2026024_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2026029_2026923_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2027206_2028850_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2028899_2029376_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|2029474_2030401_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|2030704_2032000_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004145468.1|2032011_2032821_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020801945.1|2032795_2033695_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2033804_2034287_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004197491.1|2034477_2035176_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2035201_2035741_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2035855_2036185_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_004899025.1|2036753_2038094_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|2038090_2038744_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|2038747_2040445_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|2040903_2043390_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425069.1|2043413_2044745_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_072198477.1|2044789_2045758_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425068.1|2045834_2046344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2046340_2046847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2046941_2047094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032423970.1|2047083_2047593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|2047886_2049242_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_004200304.1|2049242_2049752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2049748_2050255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|2050716_2051745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958629.1|2051768_2052074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343203.1|2052095_2052989_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	28.8	8.8e-14
WP_032410376.1|2053034_2053151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|2053172_2054066_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2054091_2054220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004184615.1|2054241_2055135_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.2e-12
WP_162487910.1|2055430_2055664_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343198.1|2055627_2056200_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_072093174.1|2056937_2057123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2057420_2057687_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_064181763.1|2058836_2062247_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004148784.1|2062380_2064144_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_073511693.1|2064173_2065190_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004184604.1|2065170_2065707_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152261.1|2065709_2066153_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 3
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	2743479	2754366	5295517		Escherichia_phage(87.5%)	9	NA	NA
WP_004151613.1|2743479_2746587_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004151612.1|2746641_2747907_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2747937_2749026_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2749112_2749373_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2749670_2750531_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2750551_2751313_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2751573_2752476_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2752487_2753753_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2753745_2754366_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 4
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	2948407	3019904	5295517	plate,holin,terminase,integrase	uncultured_Caudovirales_phage(34.0%)	83	3011017:3011031	3017026:3017040
WP_002902268.1|2948407_2949493_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2949456_2951211_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2952882_2956308_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2956291_2957431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2957427_2957685_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004151601.1|2957729_2960147_-	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2960134_2960665_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2960732_2961263_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902176.1|2961331_2961862_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|2961929_2962460_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|2962528_2963059_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|2963122_2963902_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|2963902_2966272_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_065519287.1|2966273_2968928_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|2969192_2969684_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|2969688_2971395_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|2971391_2972081_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|2972077_2973421_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|2973430_2974975_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|2975017_2975509_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_002902136.1|2976354_2976603_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|2976825_2977110_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|2977214_2977424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171482183.1|2977420_2977795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218487.1|2978162_2978891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2981241_2981439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152576.1|2981438_2982305_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	64.5	1.9e-34
WP_004152575.1|2982304_2983078_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|2983074_2984271_-|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|2984270_2984624_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|2984625_2985279_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152571.1|2985332_2985899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199301.1|2985941_2986124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|2986173_2986515_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|2986514_2987537_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|2987539_2987767_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152567.1|2987842_2988442_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	57.6	9.9e-54
WP_004152566.1|2988441_2990445_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|2990434_2990587_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|2990622_2991048_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|2991051_2991492_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|2991502_2992648_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|2992651_2993092_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|2993186_2993573_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|2993572_2994079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2994075_2994495_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|2994463_2994745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|2994784_2995726_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|2995737_2996232_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|2996235_2997438_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|2997489_2998038_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|2998093_2999545_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|2999782_3001183_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3001133_3001622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3001987_3002308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3002542_3002932_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3002928_3003459_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3003461_3003710_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004152167.1|3004115_3004898_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3004894_3005371_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004198233.1|3005367_3006330_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3006331_3007990_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3008566_3008788_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3008885_3009554_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3009724_3010039_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3010031_3010220_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152158.1|3010389_3010755_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	99.2	6.9e-58
WP_004152157.1|3010747_3011002_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004177208.1|3010973_3011192_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	98.6	6.6e-32
3011017:3011031	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004152156.1|3011188_3011614_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3011610_3011805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3011801_3012629_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3012733_3013252_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3013257_3013968_+	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3013957_3014182_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004152150.1|3014178_3014391_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	98.6	3.4e-33
WP_014343018.1|3014633_3014867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3014939_3015086_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3015045_3015288_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3015268_3016450_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3016646_3017195_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3017026:3017040	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3017393_3018926_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3019142_3019904_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 5
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	3444281	3453745	5295517	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004150847.1|3444281_3446003_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3446047_3446749_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3447102_3447321_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3447441_3449721_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3449751_3450069_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3450394_3450616_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3450692_3452633_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_065874941.1|3452629_3453745_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 6
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	3933883	3979156	5295517	tRNA,head,lysis,holin	Cronobacter_phage(25.0%)	65	NA	NA
WP_004151249.1|3933883_3936361_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
WP_004151250.1|3936347_3936743_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004199076.1|3936739_3937210_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151252.1|3937209_3937686_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004151253.1|3937728_3941175_-	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151254.1|3941267_3941771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151255.1|3941898_3942684_-	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151256.1|3942749_3943463_-	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151257.1|3943452_3943623_-	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151258.1|3943722_3944082_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151259.1|3944098_3944569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151260.1|3944862_3945117_-	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151261.1|3945119_3945875_-	KilA-N domain-containing protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151262.1|3946050_3946728_-	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151263.1|3946780_3947533_-	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151264.1|3947601_3947994_-	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151265.1|3947990_3948416_-	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151266.1|3948418_3948781_-	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151267.1|3948780_3948954_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151268.1|3948953_3949334_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151269.1|3949336_3949576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151270.1|3949586_3950681_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151271.1|3950692_3951121_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151272.1|3951124_3952510_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151273.1|3952582_3953059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151274.1|3953100_3954105_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151275.1|3954079_3955501_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151276.1|3955513_3956986_-	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151277.1|3956985_3957588_-	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151279.1|3957958_3958288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151280.1|3958393_3958858_-|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151281.1|3958854_3959385_-	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151282.1|3959387_3959636_-|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_004151283.1|3960545_3961235_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151284.1|3961231_3961762_-	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151285.1|3961754_3961892_-	YlcG family protein	NA	NA	NA	NA	NA
WP_004151286.1|3961888_3962524_-	recombination protein NinG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151287.1|3962516_3962687_-	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151288.1|3962686_3963142_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151291.1|3963642_3964290_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151292.1|3964286_3964463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151293.1|3964462_3965305_-	ead/Ea22-like family protein	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151294.1|3965411_3965918_-	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151295.1|3965914_3966208_-	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004230547.1|3966207_3967623_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004230546.1|3967627_3968479_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004151298.1|3968519_3968666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|3968751_3968973_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151299.1|3969013_3969247_-	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_004151300.1|3969374_3970064_+	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151301.1|3970414_3970630_+	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151302.1|3970626_3970737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151303.1|3970729_3970924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151304.1|3971012_3971297_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151305.1|3971312_3972158_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151306.1|3972154_3972835_+	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151308.1|3972831_3972990_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151310.1|3972986_3973643_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151312.1|3973639_3974407_+	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151314.1|3974403_3974622_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151316.1|3974623_3974839_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151317.1|3974840_3975176_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004143017.1|3976644_3977511_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_004143016.1|3977512_3977725_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143010.1|3977770_3979156_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 7
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	4190017	4201671	5295517	integrase	Enterobacteria_phage(70.0%)	13	4190467:4190481	4213524:4213538
WP_004144574.1|4190017_4191121_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4190467:4190481	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4191131_4192385_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4192737_4193928_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4193915_4194866_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4194865_4195291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4195859_4196426_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4196443_4196689_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4196685_4197423_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4197964_4198231_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4198233_4198785_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4198781_4199009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4199005_4199326_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4199337_4201671_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4213524:4213538	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 8
NZ_CP018692	Klebsiella pneumoniae strain Kp_Goe_821588 chromosome, complete genome	5295517	4669915	4675740	5295517		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4669915_4672249_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4672263_4672584_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4672580_4672808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4672804_4673347_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4673349_4673616_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4674176_4674914_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4674910_4675156_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4675173_4675740_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP018693	Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence	180027	0	62237	180027	bacteriocin,transposase	Escherichia_phage(50.0%)	50	NA	NA
WP_004152721.1|53_332_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152722.1|332_746_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004178064.1|1579_2401_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
WP_011977736.1|2433_2763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178063.1|2795_3281_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_072198477.1|4012_4981_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_004171484.1|5191_5410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152595.1|5410_5728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152594.1|5794_6199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153071.1|6494_6893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152592.1|6964_9604_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_004152591.1|9603_9993_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_004152590.1|9992_10619_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_004178057.1|10629_11622_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_004152682.1|11634_12273_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_004153093.1|12320_14276_+	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_004152683.1|14307_14544_+	conjugal transfer protein TrbE	NA	NA	NA	NA	NA
WP_004152685.1|14771_15098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152686.1|15118_15871_+	type-F conjugative transfer system pilin assembly protein TraF	NA	NA	NA	NA	NA
WP_004152687.1|15881_16121_+	type-F conjugative transfer system pilin chaperone TraQ	NA	NA	NA	NA	NA
WP_004152688.1|16092_16665_+	type-F conjugative transfer system pilin assembly thiol-disulfide isomerase TrbB	NA	NA	NA	NA	NA
WP_004152689.1|16657_17086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178055.1|17072_18443_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_004178054.1|18442_21292_+	conjugal transfer mating pair stabilization protein TraG	NA	NA	NA	NA	NA
WP_004153030.1|21297_21825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152629.1|22014_22746_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_004153029.1|25414_30676_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152303.1|30755_31481_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004178053.1|31638_32235_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152301.1|32254_32602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178052.1|32816_33362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|33718_36040_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|36041_36320_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|36660_37140_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|37460_37739_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|37955_38033_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|38025_38883_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000093087.1|40329_42525_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|42521_43838_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|43841_46151_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|50527_51232_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|51375_51930_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|52060_52891_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|53522_54227_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|54333_55194_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|55206_55749_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|56942_57647_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|59968_60301_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|60347_61223_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001067858.1|61532_62237_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP018693	Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence	180027	68994	131585	180027	protease,integrase,transposase	Escherichia_phage(28.0%)	62	73125:73184	76460:77260
WP_072094655.1|68994_70398_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|70431_71646_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|71906_72671_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|72813_73080_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
73125:73184	attL	GGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|73188_73893_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_073545622.1|73926_74886_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	44.6	1.1e-67
WP_004201280.1|75041_75515_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|75750_76455_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|76605_77421_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
76460:77260	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCCTCTGATGTTACATTGCACAAGATAAAAATATATCATCATGAACAATAAAACTGTCTGCTTACATAAACAGTAATACAAGGGGTGTTATGAGCCATATTCAACGGGAAACGTCTTGCTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGGAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGAC	NA	NA	NA	NA
WP_044117068.1|77610_78279_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_004217321.1|79582_80287_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_004153729.1|81142_81970_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|81966_82830_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|82838_83666_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|83674_84685_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|84678_85548_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|86756_87737_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|88938_89202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|89216_89480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|89723_90005_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|90039_90609_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|90723_93519_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|93518_93716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|93953_94703_+	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152113.1|94689_95652_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|97494_98841_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_003026803.1|99052_99535_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003026799.1|99522_99789_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_004152108.1|99964_100219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152107.1|100294_100552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|100600_100804_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152105.1|100837_101206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|101249_101744_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152103.1|101774_102350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152102.1|102337_102607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152101.1|102964_103315_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|103364_103727_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|103744_105496_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|105543_106833_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|106845_107271_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152096.1|107303_107840_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152095.1|109736_110099_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004182005.1|110174_110720_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152093.1|110728_111442_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004152092.1|111438_111765_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152091.1|112096_112594_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_031944101.1|112643_113153_-	aquaporin	NA	NA	NA	NA	NA
WP_004152086.1|114895_115075_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004152085.1|115306_115741_-	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152084.1|115957_117358_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|117354_118035_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|118089_119019_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|119023_119404_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001378118.1|119443_120334_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|120339_122157_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_000019473.1|122321_123302_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_001023257.1|123590_124040_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|124328_125066_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|125099_125297_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|125337_127785_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|127911_128352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|128438_131585_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
>prophage 3
NZ_CP018693	Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence	180027	134958	143462	180027	holin,transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_001572351.1|134958_135639_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|135631_137107_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|137357_137789_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|139217_140424_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|141464_143462_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 4
NZ_CP018693	Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence	180027	148770	165983	180027	integrase,transposase	Macacine_betaherpesvirus(30.0%)	13	138520:138536	169581:169597
138520:138536	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_011977741.1|148770_149739_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_071527918.1|149758_150070_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|150096_151044_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|152187_152928_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|153644_154655_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|155406_156573_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|156572_157544_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|160495_161767_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|161766_162192_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004178082.1|162594_164082_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|164315_164546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|165066_165492_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|165728_165983_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
169581:169597	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 5
NZ_CP018693	Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence	180027	169120	173405	180027		Thalassomonas_phage(33.33%)	4	NA	NA
WP_004152645.1|169120_169684_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|170459_171002_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|171050_171299_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|171368_173405_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
>prophage 6
NZ_CP018693	Klebsiella pneumoniae strain Kp_Goe_821588 plasmid pKp_Goe_588-1, complete sequence	180027	178825	179182	180027		Klebsiella_phage(100.0%)	1	NA	NA
WP_004152717.1|178825_179182_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
