The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	660372	700346	5373057	tRNA,lysis,integrase,holin,capsid,tail,portal,terminase,head,plate	Erwinia_phage(24.44%)	50	659821:659836	690840:690855
659821:659836	attL	GCAATGATGGCATTTA	NA	NA	NA	NA
WP_032433590.1|660372_661371_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	98.2	4.5e-192
WP_032433588.1|661370_661946_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	58.2	1.2e-59
WP_001630878.1|662075_662339_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	100.0	3.1e-44
WP_039818858.1|662369_662879_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	96.4	8.9e-88
WP_023343330.1|662886_663087_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	92.4	8.1e-29
WP_032433585.1|663050_663389_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	93.8	1.6e-53
WP_032433580.1|663456_663684_+	DUF2732 domain-containing protein	NA	A0A218M4I9	Erwinia_phage	97.3	2.9e-30
WP_032433578.1|663683_663905_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	5.5e-34
WP_072198081.1|664053_666123_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	95.4	0.0e+00
WP_048292468.1|666241_666682_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	95.6	3.4e-67
WP_162897204.1|667110_667266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071557792.1|667302_667611_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.1	2.4e-11
WP_032433573.1|667588_668539_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	37.7	8.7e-36
WP_032433571.1|668677_669109_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	93.7	2.9e-71
WP_032433569.1|669107_669302_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	64.1	4.7e-13
WP_032433567.1|669814_670858_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	82.1	4.4e-166
WP_009309687.1|670857_672627_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	87.9	6.3e-306
WP_039818862.1|672792_673647_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	81.0	2.1e-126
WP_025710540.1|673720_674779_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.8	4.9e-165
WP_072196895.1|674806_675526_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	78.2	3.1e-94
WP_009309691.1|675622_676129_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	84.3	5.4e-61
WP_019725382.1|676128_676332_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	79.1	9.5e-25
WP_032433564.1|676336_676627_+|holin	phage holin family protein	holin	A0A0M5M1H1	Salmonella_phage	80.6	2.2e-35
WP_032433563.1|676613_677111_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	84.8	4.8e-78
WP_032433560.1|677107_677539_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	66.9	1.1e-41
WP_032427129.1|677513_677672_+	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	74.0	3.8e-13
WP_032433558.1|677634_678102_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.2	9.1e-63
WP_032433555.1|678094_678544_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	68.0	4.7e-48
WP_045326985.1|678872_679916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015959011.1|680258_680900_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	77.5	2.0e-92
WP_014343405.1|680896_681244_+	GPW/gp25 family protein	NA	Q7Y4D7	Escherichia_virus	77.4	4.9e-45
WP_032433553.1|681248_682157_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	72.2	5.2e-115
WP_076026137.1|682164_682752_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	56.8	4.1e-52
WP_125116968.1|682687_685018_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	40.8	7.2e-108
WP_032433551.1|685023_685752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032433550.1|685763_686843_+|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	43.3	4.7e-30
WP_019724797.1|686952_688134_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	86.6	7.9e-196
WP_032433549.1|688147_688663_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	75.0	1.2e-68
WP_004195711.1|688723_688999_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	77.3	2.4e-31
WP_014343413.1|689031_689151_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	92.3	2.0e-14
WP_032433547.1|689143_691582_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	73.8	2.1e-299
690840:690855	attR	TAAATGCCATCATTGC	NA	NA	NA	NA
WP_023343304.1|691598_692078_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	80.9	1.3e-69
WP_032433545.1|692077_693238_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	80.6	8.3e-174
WP_032433542.1|693278_693686_-	hypothetical protein	NA	S4TTB4	Salmonella_phage	44.3	1.2e-26
WP_023343301.1|693779_693998_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	88.9	3.2e-34
WP_002917636.1|694356_694863_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_004174339.1|694962_696804_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_002917631.1|697022_698768_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.7	1.6e-75
WP_001144069.1|698879_699095_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002916879.1|699332_700346_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
>prophage 2
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	1718917	1725822	5373057	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1718917_1719781_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_039819854.1|1719791_1720565_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	6.6e-26
WP_004151134.1|1720805_1721702_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_039819857.1|1721944_1723306_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	1.1e-206
WP_004175198.1|1723624_1724347_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1724343_1725822_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	1769166	1782483	5373057	transposase	Enterobacteria_phage(22.22%)	12	NA	NA
WP_000043543.1|1769166_1770573_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004180506.1|1770799_1772215_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_039819506.1|1772236_1773607_+	O9 family phosphomannomutase RfbK2	NA	A0A127AWJ1	Bacillus_phage	25.9	6.4e-32
WP_039819536.1|1773761_1774826_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	9.8e-105
WP_039819507.1|1774839_1775709_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.3e-110
WP_004175259.1|1775740_1776631_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_039819508.1|1776645_1777200_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.9e-52
WP_039819510.1|1777379_1778546_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_039819538.1|1778938_1779946_+	acyltransferase	NA	NA	NA	NA	NA
WP_077255456.1|1780160_1780265_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004144151.1|1780956_1781079_-	small membrane protein	NA	NA	NA	NA	NA
WP_039819511.1|1781478_1782483_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 4
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	1900116	1943793	5373057	lysis,integrase,holin,protease,capsid,tail,portal,terminase,head,transposase	Enterobacteria_phage(28.95%)	50	1907877:1907936	1948897:1948960
WP_039817189.1|1900116_1901379_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.8e-73
WP_002911729.1|1901946_1902864_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_004180456.1|1902970_1903921_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_023286672.1|1903999_1904941_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004212965.1|1905139_1905376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020477091.1|1905676_1906372_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_004227143.1|1906957_1907758_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
1907877:1907936	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_023317562.1|1908050_1909043_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	86.9	1.1e-174
WP_004184757.1|1909044_1909272_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	1.1e-29
WP_023317563.1|1909311_1910142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023317564.1|1910458_1910614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817954.1|1910741_1911527_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	52.1	1.1e-60
WP_039817952.1|1911526_1911826_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	47.6	7.2e-13
WP_039817950.1|1911915_1912833_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.5	1.5e-45
WP_023317570.1|1913546_1914242_-	helix-turn-helix transcriptional regulator	NA	Q8HAA0	Salmonella_phage	71.3	3.5e-87
WP_001191665.1|1914339_1914582_+	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	80.3	1.3e-25
WP_039817948.1|1914616_1915078_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	6.4e-69
WP_071557781.1|1915315_1915528_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_039817942.1|1915484_1916399_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	3.1e-30
WP_039817939.1|1916395_1917205_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.9	3.5e-110
WP_039817937.1|1917214_1917592_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	75.2	6.7e-48
WP_039817935.1|1917604_1918585_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	6.4e-135
WP_039817933.1|1918598_1919177_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_004151282.1|1919884_1920133_+|holin	class II holin family protein	holin	NA	NA	NA	NA
WP_039817927.1|1920135_1920666_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	80.0	3.2e-80
WP_039817926.1|1920662_1921127_+|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	62.9	1.6e-43
WP_039817923.1|1921201_1921540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817921.1|1922329_1922725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039817920.1|1922924_1923170_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	65.4	1.2e-18
WP_039817918.1|1923225_1923567_+	HNH endonuclease	NA	K7P7P4	Enterobacteria_phage	74.8	6.0e-48
WP_039817917.1|1923749_1924214_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	60.8	6.3e-48
WP_039817916.1|1924167_1925910_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	45.6	2.0e-139
WP_039817913.1|1925909_1927217_+|portal	phage portal protein	portal	K7PJU5	Enterobacteria_phage	84.4	4.3e-211
WP_039817990.1|1927229_1928078_+|protease	Clp protease ClpP	protease	K7PH05	Enterobacteria_phage	84.6	1.0e-128
WP_004886697.1|1928087_1929305_+|capsid	phage major capsid protein	capsid	K7PM57	Enterobacteria_phage	81.4	3.9e-182
WP_039817908.1|1929634_1929961_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	68.5	1.2e-40
WP_004884319.1|1929972_1930311_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	6.4e-42
WP_039817904.1|1930307_1930757_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	1.9e-62
WP_039817902.1|1930753_1931101_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	61.1	4.0e-31
WP_039817900.1|1931157_1931862_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	67.4	7.2e-80
WP_039817897.1|1931892_1932297_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	1.7e-33
WP_039817895.1|1932299_1932605_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
WP_039817893.1|1932709_1933465_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	2.9e-34
WP_039817891.1|1933461_1934961_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_039817888.1|1935094_1935328_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	45.8	3.2e-08
WP_039817884.1|1935388_1938778_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.5	1.5e-303
WP_004177132.1|1938798_1939272_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|1939258_1939735_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_039817877.1|1939747_1940128_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	79.4	3.6e-57
WP_001067855.1|1943088_1943793_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
1948897:1948960	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 5
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	2807598	2818485	5373057		Escherichia_phage(87.5%)	9	NA	NA
WP_032433071.1|2807598_2810706_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2810760_2812026_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2812056_2813145_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2813231_2813492_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004176269.1|2813789_2814650_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2814670_2815432_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2815692_2816595_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2816606_2817872_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2817864_2818485_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 6
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	3090513	3139951	5373057	integrase,holin,tail,terminase,transposase	Klebsiella_phage(21.15%)	64	3086578:3086593	3137257:3137272
3086578:3086593	attL	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_002901812.1|3090513_3090933_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_039110600.1|3091982_3092531_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	95.6	6.0e-90
WP_001067855.1|3093121_3093826_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_074091222.1|3093872_3096920_-	kinase	NA	A0A286S259	Klebsiella_phage	96.9	0.0e+00
WP_004152651.1|3096916_3097297_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_039110595.1|3097306_3097789_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	95.6	4.1e-82
WP_039110593.1|3097969_3098434_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	1.5e-57
WP_039110591.1|3098433_3101316_-|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.0	1.7e-98
WP_032416607.1|3101389_3101758_-	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	42.9	3.3e-15
WP_004217333.1|3101868_3102225_-	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_008807842.1|3102303_3102510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008807841.1|3102647_3103130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031591823.1|3103183_3104356_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|3104379_3104772_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_039110587.1|3104768_3105320_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	2.3e-28
WP_004217344.1|3105321_3105705_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_040246471.1|3105691_3105925_-	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	4.4e-10
WP_004190649.1|3105934_3106189_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	8.0e-21
WP_023300922.1|3106190_3106586_-	hypothetical protein	NA	A0A0S2SYB7	Pseudomonas_phage	43.3	3.3e-13
WP_129321712.1|3106626_3106899_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_004190653.1|3106907_3107861_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_032423789.1|3107871_3108657_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.7e-66
WP_004227000.1|3108770_3108947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039110586.1|3109187_3110300_-	phage Mu F like family protein	NA	I6PD76	Cronobacter_phage	55.1	2.5e-111
WP_008807834.1|3110283_3111684_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	9.2e-127
WP_004190663.1|3111683_3112991_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_008807832.1|3112968_3113961_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	35.3	1.3e-29
WP_004218558.1|3114823_3115069_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_123618920.1|3115503_3115716_-	hypothetical protein	NA	A0A286N2Q9	Klebsiella_phage	71.4	7.8e-22
WP_023313108.1|3116027_3116303_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	43.8	4.7e-11
WP_039110584.1|3116299_3116647_-	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	69.6	1.6e-35
WP_023301209.1|3116643_3117183_-	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.3	7.4e-101
WP_031281240.1|3117179_3117479_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	98.0	1.9e-45
WP_049001106.1|3118091_3118538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020805457.1|3118443_3118701_-	hypothetical protein	NA	A0A286N2Q3	Klebsiella_phage	96.5	5.4e-41
WP_039110580.1|3119035_3119857_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	9.0e-98
WP_020804605.1|3119972_3120329_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	3.3e-41
WP_020804598.1|3120325_3120622_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_020804595.1|3120830_3121427_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	80.1	2.2e-90
WP_004184503.1|3121805_3122039_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.9e-25
WP_032413665.1|3122789_3123089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804596.1|3123184_3123613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804600.1|3123616_3123838_-	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.3e-11
WP_020804604.1|3123834_3124089_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.6	1.4e-09
WP_020804603.1|3124081_3124285_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	84.8	3.8e-26
WP_039110576.1|3124281_3125067_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	53.3	4.8e-64
WP_032417027.1|3125059_3125395_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	1.3e-10
WP_032417026.1|3125402_3126152_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	83.1	1.3e-119
WP_023286278.1|3126154_3127063_-	hypothetical protein	NA	V5URT9	Shigella_phage	54.1	1.7e-89
WP_020804480.1|3127077_3127266_-	ClpX C4-type zinc finger	NA	NA	NA	NA	NA
WP_023287506.1|3127353_3127890_-	bacteriophage regulatory protein CII	NA	K7PJT7	Enterobacteria_phage	70.4	2.1e-63
WP_029503646.1|3127892_3128126_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	61.6	2.1e-20
WP_039110572.1|3128230_3128626_+	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	74.0	1.4e-48
WP_136085610.1|3128643_3128742_+	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_022631177.1|3130134_3130443_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	62.2	1.7e-25
WP_004179600.1|3130739_3130931_+	YebW family protein	NA	NA	NA	NA	NA
WP_012967861.1|3130939_3131095_+	DNA breaking-rejoining protein	NA	H6WRX3	Salmonella_phage	75.0	1.2e-14
WP_039110567.1|3131232_3134271_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	57.0	3.0e-292
WP_039110565.1|3134283_3135393_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.2	1.1e-183
WP_071836884.1|3135433_3135673_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	67.5	8.8e-22
WP_038807825.1|3135893_3137111_-|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	5.6e-120
WP_004151901.1|3137257_3138148_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
3137257:3137272	attR	TATGCCCTACGATAGC	NA	NA	NA	NA
WP_004140266.1|3138147_3139140_+	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004140269.1|3139141_3139951_+	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
>prophage 7
NZ_CP018695	Klebsiella pneumoniae strain Kp_Goe_149832 chromosome, complete genome	5373057	3528731	3538196	5373057	tRNA,protease	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_032432850.1|3528731_3530453_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3530497_3531199_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3531552_3531771_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3531892_3534172_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3534202_3534520_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3534845_3535067_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004209695.1|3535143_3537084_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3537080_3538196_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP018696	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence	246755	50990	59219	246755	transposase	Burkholderia_phage(33.33%)	10	NA	NA
WP_074091250.1|50990_51959_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	3.8e-180
WP_004196710.1|52028_52607_+	HNH endonuclease	NA	W0LI46	Edwardsiella_phage	57.6	1.2e-40
WP_004181824.1|52597_52912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042919309.1|53036_53447_+	hypothetical protein	NA	Q71TH9	Escherichia_phage	60.8	4.6e-42
WP_004181826.1|53631_53991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004026468.1|54221_54665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026466.1|54918_55179_+	hypothetical protein	NA	A0A0M3LSW2	Mannheimia_phage	41.0	5.9e-11
WP_004026465.1|55211_55646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075043065.1|56541_57927_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	3.1e-106
WP_074091226.1|58016_59219_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.1	1.1e-35
>prophage 2
NZ_CP018696	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence	246755	81991	94297	246755		Escherichia_phage(30.77%)	20	NA	NA
WP_004026417.1|81991_82312_+	hypothetical protein	NA	J9Q750	Salmonella_phage	50.9	2.2e-28
WP_004026416.1|82392_82707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197205.1|82827_83079_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	76.7	1.9e-22
WP_004026415.1|83244_83463_+	hypothetical protein	NA	R9TRD3	Aeromonas_phage	66.7	4.4e-20
WP_004026414.1|83555_84053_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	67.1	2.6e-23
WP_004026413.1|84049_84238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197209.1|84715_84943_+	hypothetical protein	NA	A9YWV3	Burkholderia_phage	49.4	1.5e-10
WP_004026412.1|84939_85584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024198083.1|86000_86387_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	85.1	3.7e-17
WP_004026408.1|87088_87304_+	hypothetical protein	NA	J9Q804	Salmonella_phage	51.4	6.1e-14
WP_004026407.1|87641_88124_+	hypothetical protein	NA	A0A077SLK5	Escherichia_phage	58.3	4.4e-12
WP_077273426.1|88207_88804_+	DUF551 domain-containing protein	NA	A0A0S1S1U7	Klebsiella_phage	92.5	2.9e-21
WP_004026403.1|88806_88992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074091228.1|89261_89534_+	hypothetical protein	NA	I7B2L9	Escherichia_phage	50.0	2.5e-12
WP_004026397.1|89597_89759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026395.1|90303_90753_+	hypothetical protein	NA	A0A1I9KFG8	Aeromonas_phage	45.2	2.9e-18
WP_004026394.1|90822_91431_+	hypothetical protein	NA	K4JV11	Caulobacter_phage	42.2	1.5e-25
WP_014386579.1|91716_92172_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_004026392.1|92232_92397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004197197.1|93055_94297_+	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	28.9	6.7e-12
>prophage 3
NZ_CP018696	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-1, complete sequence	246755	162302	194960	246755	transposase,protease	Salmonella_phage(23.08%)	31	NA	NA
WP_074091247.1|162302_163283_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	97.9	2.8e-183
WP_074091248.1|164331_167322_+	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	23.1	2.0e-09
WP_074091249.1|167894_168863_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	6.5e-180
WP_077273424.1|169012_169108_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077273423.1|169150_169312_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077273422.1|169485_170097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074091250.1|170363_171332_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	3.8e-180
WP_074091252.1|172570_173206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107646847.1|173358_173622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074091250.1|173694_174663_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	3.8e-180
WP_004026629.1|175431_175830_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_074091254.1|176232_177051_-	DNA repair protein	NA	NA	NA	NA	NA
WP_042014906.1|177160_177655_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	34.9	2.1e-17
WP_038992356.1|177837_179109_+	DUF1173 family protein	NA	NA	NA	NA	NA
WP_074091255.1|180101_180704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074091256.1|180963_181695_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_016947102.1|181927_182686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004181725.1|182751_183141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119906220.1|183168_183498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004026615.1|183725_184373_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_016947104.1|184709_185951_-	VWA domain-containing protein	NA	A0A2D1GNA9	Pseudoalteromonas_phage	25.1	4.8e-10
WP_004026611.1|186035_186611_-	tellurium resistance cAMP binding protein TerE	NA	K4JRX3	Caulobacter_phage	42.6	9.6e-30
WP_004026609.1|186697_187276_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	40.8	1.9e-33
WP_004026607.1|187314_188355_-	tellurium resistance membrane protein TerC	NA	K7QKE8	Escherichia_phage	46.5	1.8e-71
WP_004026604.1|188378_188834_-	tellurium resistance membrane protein TerB	NA	NA	NA	NA	NA
WP_025368659.1|188856_190008_-	tellurium resistance system protein TerA	NA	NA	NA	NA	NA
WP_074091257.1|190004_190589_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.4	1.2e-11
WP_046654855.1|190900_191959_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_074091263.1|191970_193113_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.9	8.3e-33
WP_004181732.1|193105_193879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060611410.1|193880_194960_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.1	1.3e-40
>prophage 1
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	0	7290	61010	integrase	Escherichia_phage(60.0%)	8	6493:6504	9112:9123
WP_004118291.1|171_1443_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000064120.1|1524_2499_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_000368714.1|2498_3704_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|4118_4388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|4564_5431_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|5965_6070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|6198_6456_+	hypothetical protein	NA	NA	NA	NA	NA
6493:6504	attL	CAGCATCATTCT	NA	NA	NA	NA
WP_000015958.1|6513_7290_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000015958.1|6513_7290_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
9112:9123	attR	CAGCATCATTCT	NA	NA	NA	NA
>prophage 2
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	14137	15621	61010		Escherichia_phage(66.67%)	3	NA	NA
WP_069346845.1|14137_14794_-	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	1.7e-06
WP_000493286.1|15029_15359_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	44.2	2.4e-09
WP_000780222.1|15339_15621_+	helix-turn-helix transcriptional regulator	NA	A0A2I6TC97	Escherichia_phage	38.0	1.3e-08
>prophage 3
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	21966	31438	61010	transposase	Escherichia_phage(25.0%)	11	NA	NA
WP_000777554.1|21966_22440_+	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_000679427.1|23143_23491_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|23484_24324_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|24451_24952_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|25458_26223_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_019725122.1|26563_27100_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	60.6	6.8e-46
WP_001067855.1|27111_27816_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001535719.1|27882_29280_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.2	1.1e-58
WP_019725138.1|29427_30075_-	DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	48.3	3.9e-48
WP_012477564.1|30138_30729_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|30865_31438_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
>prophage 4
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	35547	40105	61010	transposase	Enterobacteria_phage(50.0%)	4	NA	NA
WP_000027057.1|35547_36408_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|36590_37148_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_040154863.1|37711_38974_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|39229_40105_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
>prophage 5
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	43801	46901	61010	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_012600012.1|43801_43981_+	hypothetical protein	NA	A0A2H4JB52	uncultured_Caudovirales_phage	60.3	6.8e-11
WP_000654802.1|45932_46901_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	1.1e-184
>prophage 6
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	52155	54135	61010	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_040178261.1|52155_53406_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001067858.1|53430_54135_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 7
NZ_CP018699	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-4, complete sequence	61010	58857	60345	61010		Pseudomonas_phage(100.0%)	1	NA	NA
WP_023300763.1|58857_60345_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.8e-32
>prophage 1
NZ_CP018697	Klebsiella pneumoniae strain Kp_Goe_149832 plasmid pKp_Goe_832-5, complete sequence	79806	7591	69339	79806	capsid,terminase,portal,tail,head	Klebsiella_phage(87.04%)	58	NA	NA
WP_048292315.1|7591_9091_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	74.7	2.2e-150
WP_023339380.1|9169_10135_-	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	1.5e-155
WP_023339381.1|10137_11301_-	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_023339381.1|12335_13499_+	plasmid-partitioning protein SopA	NA	Q6UAV7	Klebsiella_phage	98.4	2.1e-225
WP_077274075.1|13501_14593_+	ParB/RepB/Spo0J family plasmid partition protein	NA	Q6UAV8	Klebsiella_phage	86.9	7.4e-156
WP_048292315.1|14543_16043_-|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	74.7	2.2e-150
WP_074091266.1|16111_28816_-	DUF1983 domain-containing protein	NA	Q6UAW1	Klebsiella_phage	47.1	0.0e+00
WP_032447254.1|28878_29472_-|tail	tail assembly protein	tail	Q6UAW2	Klebsiella_phage	80.7	3.7e-85
WP_020803186.1|29488_30316_-	hypothetical protein	NA	A0A0P0IYG9	Acinetobacter_phage	44.0	2.3e-08
WP_039814703.1|30362_31073_-	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	6.7e-134
WP_020803197.1|31074_31830_-|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.1	6.7e-124
WP_017898999.1|31826_32165_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	88.4	2.4e-57
WP_048292313.1|32164_35521_-|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	86.6	0.0e+00
WP_014228914.1|35753_36119_-|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_014228913.1|36176_36638_-|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228912.1|36669_37062_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	3.5e-60
WP_048263894.1|37067_37457_-	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	84.5	4.0e-56
WP_014228910.1|37437_37776_-|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	91.1	5.6e-54
WP_039814662.1|37772_38090_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_048292312.1|38070_38358_-	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	77.8	7.1e-18
WP_048292311.1|38416_39703_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	86.0	5.4e-206
WP_048292310.1|39780_40701_-	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	88.2	2.5e-149
WP_032413533.1|40737_41997_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.5	8.9e-222
WP_048292309.1|42169_43879_-|terminase	terminase large subunit	terminase	Q6UAY0	Klebsiella_phage	95.3	0.0e+00
WP_032408957.1|43913_44348_-|terminase	P27 family phage terminase small subunit	terminase	Q6UAY1	Klebsiella_phage	95.8	2.4e-73
WP_077256079.1|44764_45196_-	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	59.9	7.6e-40
WP_032408958.1|45192_45477_-	hypothetical protein	NA	Q6UAS1	Klebsiella_phage	37.5	3.1e-05
WP_072072213.1|45473_45836_-	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	94.2	2.4e-63
WP_053065617.1|45819_46881_-	hypothetical protein	NA	Q6UAS3	Klebsiella_phage	38.3	8.8e-37
WP_032408961.1|47050_47350_-	DUF4406 domain-containing protein	NA	Q6UAS4	Klebsiella_phage	96.0	3.0e-51
WP_117037470.1|47461_47656_-	hypothetical protein	NA	Q6UAS6	Klebsiella_phage	89.5	1.5e-19
WP_040118545.1|47603_48080_-	hypothetical protein	NA	Q6UAS7	Klebsiella_phage	79.7	1.7e-61
WP_048292308.1|48096_48588_-	hypothetical protein	NA	Q6UAS8	Klebsiella_phage	90.2	4.1e-82
WP_023339388.1|48584_48896_-	hypothetical protein	NA	Q6UAS9	Klebsiella_phage	89.1	6.3e-44
WP_048292307.1|48954_50016_-	site-specific DNA-methyltransferase	NA	Q6UAT0	Klebsiella_phage	92.9	1.0e-170
WP_032408967.1|50333_50561_-	hypothetical protein	NA	Q6UAT1	Klebsiella_phage	84.0	1.6e-28
WP_023339391.1|50572_50794_-	hypothetical protein	NA	O64358	Escherichia_phage	90.4	3.0e-32
WP_023339392.1|50964_51273_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	Q6UAT3	Klebsiella_phage	94.2	3.9e-46
WP_023339393.1|51272_51560_+	helix-turn-helix transcriptional regulator	NA	Q6UAT4	Klebsiella_phage	96.8	1.7e-43
WP_023339395.1|51911_52139_-	hypothetical protein	NA	O64355	Escherichia_phage	80.3	2.8e-25
WP_048292306.1|52159_52486_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	94.4	1.1e-51
WP_023339397.1|52478_52724_-	hypothetical protein	NA	G8C7U9	Escherichia_phage	83.1	5.1e-25
WP_048292305.1|53324_53933_-	3'-5' exonuclease	NA	Q6UAU3	Klebsiella_phage	88.5	3.0e-98
WP_032408971.1|54344_55082_-	phage antitermination Q family protein	NA	Q6UAU4	Klebsiella_phage	84.5	2.2e-119
WP_032408972.1|55071_55281_-	Cro/Cl family transcriptional regulator	NA	Q6UAU5	Klebsiella_phage	92.8	7.7e-30
WP_048292304.1|55361_55970_+	XRE family transcriptional regulator	NA	Q6UAU6	Klebsiella_phage	92.6	1.3e-104
WP_074091265.1|56220_60225_+	origin of replication binding family protein	NA	A0A2I6TD01	Escherichia_phage	81.3	0.0e+00
WP_032413543.1|60217_60424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032413544.1|60410_60746_+	hypothetical protein	NA	O64345	Escherichia_phage	66.4	1.5e-38
WP_114143876.1|60845_61370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077273427.1|61396_62530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162780216.1|62884_63043_+	ash family protein	NA	O21968	Escherichia_phage	72.5	3.7e-08
WP_032413547.1|63057_63222_+	host cell division inhibitor Icd-like protein	NA	Q6UAV3	Klebsiella_phage	96.3	2.8e-19
WP_040108080.1|63218_63449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065519960.1|63445_64225_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	80.5	9.1e-116
WP_060577966.1|64279_66202_-	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
WP_060577966.1|66582_68505_+	protelomerase	NA	Q6UAV6	Klebsiella_phage	93.4	0.0e+00
WP_065519960.1|68559_69339_-	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	80.5	9.1e-116
