The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	133470	142884	5073712		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|133470_134091_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|134083_135349_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|135360_136263_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|136523_137285_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|137305_138166_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|138463_138724_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|138810_139899_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|139929_141195_-	MFS transporter	NA	NA	NA	NA	NA
WP_160463746.1|141249_142884_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
>prophage 2
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	630878	687145	5073712	plate,protease,transposase	Microcystis_virus(27.27%)	56	NA	NA
WP_004175538.1|630878_631322_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_020806091.1|631324_631861_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_072198475.1|631841_632858_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_032411805.1|632887_634651_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032411808.1|634784_638195_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910497.1|639344_639611_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|639908_640094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093175.1|640354_640489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014343198.1|640831_641404_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_004164123.1|641367_641721_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_064182053.1|641896_642670_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.1	1.2e-11
WP_038435084.1|642811_642940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|642965_643859_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_032410376.1|643880_643997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|644042_644936_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_014343204.1|644957_645269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|645286_646315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|646776_647283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004200304.1|647279_647789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425067.1|647789_649145_-	S-type Pyocin	NA	NA	NA	NA	NA
WP_060614320.1|649438_649948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|650184_650691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425068.1|650687_651197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072198477.1|651273_652242_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425069.1|652286_653618_-	S-type Pyocin	NA	NA	NA	NA	NA
WP_032425070.1|653641_656128_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425071.1|656586_658284_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004184632.1|658287_658941_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004899025.1|658937_660278_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_032423435.1|660515_660677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910650.1|660846_661176_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910652.1|661290_661830_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_072159826.1|661855_662647_-	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910657.1|662744_663227_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_020801945.1|663336_664236_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004145468.1|664210_665020_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_032425072.1|665031_666327_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_020801827.1|666630_667557_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910717.1|667655_668132_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004180410.1|668181_669825_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910720.1|670108_671002_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175491.1|671007_671727_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_032425073.1|671723_672599_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	41.5	9.5e-05
WP_060614333.1|672595_673882_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_004175489.1|673891_674806_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_075995074.1|674915_675974_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004225356.1|676263_676410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032425474.1|676461_678756_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_032425074.1|678784_679993_-	propionate kinase	NA	NA	NA	NA	NA
WP_004145486.1|680020_681352_-	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910762.1|681377_682367_-	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_023286625.1|682460_683402_-	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_004219597.1|683578_683722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145488.1|684019_684142_+	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_032425076.1|684973_685960_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_032425077.1|686398_687145_-|protease	proteasome-type protease	protease	NA	NA	NA	NA
>prophage 3
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	885403	897345	5073712	transposase	Escherichia_phage(22.22%)	11	NA	NA
WP_004180506.1|885403_886819_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_038435495.1|887898_888903_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_001741931.1|888972_889113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004144151.1|889303_889426_+	small membrane protein	NA	NA	NA	NA	NA
WP_004099053.1|889678_890647_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_000704907.1|890915_892082_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_040230680.1|892263_892818_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.3e-52
WP_040230682.1|892832_893723_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	9.6e-29
WP_023278825.1|893754_894624_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_075995067.1|894650_895715_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.9e-104
WP_000043542.1|895938_897345_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 4
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	938169	945074	5073712	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004149058.1|938169_939648_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
WP_004890796.1|939644_940367_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004144192.1|940685_942047_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004151134.1|942289_943186_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_024264506.1|943426_944200_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004180551.1|944210_945074_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 5
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	1350096	1435654	5073712	portal,capsid,integrase,lysis,tRNA,transposase,plate,coat,terminase,head,tail	Salmonella_phage(72.55%)	94	1394791:1394837	1431357:1431403
WP_002914079.1|1350096_1350834_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|1350965_1352297_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|1352342_1352726_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|1353039_1353729_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|1353786_1354872_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|1355075_1355501_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|1355570_1356269_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004188841.1|1356303_1358955_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|1359075_1360431_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|1360472_1360796_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|1360799_1362098_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|1368063_1370637_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|1370766_1371498_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|1371494_1372475_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|1372606_1373344_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|1373614_1373950_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|1374056_1374104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|1374204_1375365_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|1375361_1376234_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|1376296_1377418_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|1377427_1378498_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|1378840_1379350_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|1379342_1380566_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|1380579_1381062_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|1381070_1382441_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|1382497_1382956_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004220183.1|1382945_1383083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914145.1|1383075_1383423_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|1383462_1384230_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|1384261_1384810_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|1384828_1385077_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|1385336_1386701_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|1386864_1387656_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|1387675_1388962_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|1389081_1389672_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|1389796_1390675_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|1390761_1392423_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004145681.1|1392448_1392589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914160.1|1392570_1392912_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|1392978_1393269_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|1393258_1393735_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|1393845_1394328_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1394791:1394837	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|1394931_1395309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|1395336_1395555_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|1395621_1396716_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|1396712_1397198_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_072093161.1|1397194_1399591_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|1399817_1399937_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|1399951_1400251_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|1400303_1400819_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|1400828_1402001_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|1402149_1403223_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|1403274_1404393_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|1404402_1406352_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|1406353_1407025_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|1407017_1407926_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|1407912_1408275_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|1408271_1408844_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|1408938_1409805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|1409827_1410274_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|1410266_1410689_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|1410651_1410810_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|1410784_1411213_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|1411209_1411593_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|1411597_1412107_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|1412087_1412303_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|1412306_1412510_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|1412509_1412974_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|1413069_1413723_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|1413726_1414779_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|1414795_1415629_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_104022053.1|1415769_1417533_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.6	0.0e+00
WP_004151006.1|1417532_1418576_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|1418632_1418902_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151007.1|1419423_1420425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1420424_1421504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|1422268_1422502_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|1422513_1422702_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151012.1|1422864_1425249_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|1425245_1426097_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|1426093_1426321_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|1426320_1426554_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|1426621_1426960_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|1426923_1427124_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|1427131_1427641_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|1427673_1427916_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|1428038_1428668_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|1428670_1429696_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151021.1|1429692_1431243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151022.1|1431677_1432478_-	hypothetical protein	NA	NA	NA	NA	NA
1431357:1431403	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_002914178.1|1432602_1433487_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914180.1|1433698_1434271_+	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_002914181.1|1434281_1434644_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004099053.1|1434685_1435654_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
>prophage 6
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	2152408	2201251	5073712	portal,capsid,protease,tRNA,terminase,head,tail	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|2152408_2152903_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|2152906_2153545_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|2153514_2153799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|2153856_2154249_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|2154264_2154693_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|2154958_2156086_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|2156276_2156675_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|2156848_2158216_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|2158303_2159362_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|2159498_2160437_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|2160851_2161322_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|2161697_2161961_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|2162059_2162326_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|2162376_2162652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|2162731_2164699_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|2164704_2165637_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|2165644_2165848_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|2165979_2166909_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|2166944_2168390_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|2168478_2172276_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|2172313_2173783_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|2173785_2174367_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|2174374_2174863_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|2174862_2175855_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|2175925_2176969_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|2177274_2179215_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|2179294_2179486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|2179714_2180716_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|2180715_2181324_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|2181547_2182000_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|2182022_2182490_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|2182500_2183850_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|2183960_2184203_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|2184192_2185644_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|2185655_2186537_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|2186894_2187860_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2187884_2188181_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|2188334_2188526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|2188528_2190190_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|2190173_2190530_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|2190660_2190813_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|2190805_2191249_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|2191248_2191548_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|2191544_2191880_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|2191876_2193118_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|2193119_2193680_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|2193731_2194898_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|2195161_2195674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|2195722_2196058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|2196400_2198536_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|2198535_2198901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|2198897_2199266_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004218267.1|2199364_2199493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|2199569_2199758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|2199750_2199969_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_004150969.1|2200471_2201251_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 7
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	3294184	3300009	5073712		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|3294184_3294751_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|3294768_3295014_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|3295010_3295748_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|3296308_3296575_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_072093163.1|3296577_3297120_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|3297116_3297344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|3297340_3297661_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|3297675_3300009_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 8
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	3769560	3781214	5073712	integrase	Enterobacteria_phage(70.0%)	15	3757694:3757708	3780751:3780765
3757694:3757708	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|3769560_3771894_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|3771905_3772226_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004219964.1|3772222_3772402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|3772446_3772998_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|3773000_3773267_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_004903606.1|3773371_3773509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889917.1|3773808_3774546_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|3774542_3774788_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|3774805_3775372_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_020802988.1|3775444_3775594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152979.1|3775940_3776366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|3776365_3777316_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|3777303_3778494_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|3778846_3780100_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|3780110_3781214_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
3780751:3780765	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 9
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	3951061	4010956	5073712	protease,integrase,transposase,tRNA	Escherichia_phage(37.5%)	54	3948229:3948243	3973089:3973103
3948229:3948243	attL	CGACAGCGCCATCGC	NA	NA	NA	NA
WP_001067858.1|3951061_3951766_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|3952310_3953087_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067858.1|3953200_3953905_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_104022071.1|3954207_3954738_+	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_000602738.1|3955159_3955912_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_004152391.1|3957419_3959135_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|3959244_3962274_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|3962380_3963406_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|3963402_3964182_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_015062847.1|3964568_3965450_+	carbapenem-hydrolyzing class A beta-lactamase KPC-4	NA	A0A1B0VBP7	Salmonella_phage	52.5	1.1e-74
WP_004152397.1|3965699_3967019_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	NA	NA	NA	NA
WP_158648848.1|3967337_3967508_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_002892260.1|3967954_3968632_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	33.5	7.8e-23
WP_002892258.1|3968772_3969690_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_004151325.1|3969686_3970145_+	NfeD family protein	NA	NA	NA	NA	NA
WP_002892208.1|3970141_3970552_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_162493474.1|3970604_3973160_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.0	1.6e-113
3973089:3973103	attR	GCGATGGCGCTGTCG	NA	NA	NA	NA
WP_004151327.1|3973291_3974086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892205.1|3974288_3974768_+|tRNA	Cys-tRNA(Pro)/Cys-tRNA(Cys) deacylase YbaK	tRNA	NA	NA	NA	NA
WP_002892203.1|3974873_3976526_-	bifunctional UDP-sugar hydrolase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_002892200.1|3976821_3978042_+	MFS transporter	NA	NA	NA	NA	NA
WP_002892197.1|3978042_3978156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004217162.1|3978176_3978299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892195.1|3978267_3979944_+	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_002892192.1|3979979_3981284_-	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_002892189.1|3981347_3982310_-	ferrochelatase	NA	NA	NA	NA	NA
WP_002892184.1|3982438_3983083_-	adenylate kinase	NA	NA	NA	NA	NA
WP_002892181.1|3983305_3985180_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	6.4e-115
WP_002892177.1|3985291_3985897_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_002892173.1|3985896_3986229_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_004151328.1|3986286_3988194_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	38.2	2.3e-43
WP_002892145.1|3988286_3988838_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.5	3.9e-28
WP_002892144.1|3988988_3989366_-	DUF454 family protein	NA	NA	NA	NA	NA
WP_002892142.1|3989435_3989963_+	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_002892136.1|3989975_3990149_+	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_002892131.1|3990216_3991116_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.1e-63
WP_004151329.1|3991151_3994499_-	mechanosensitive channel MscK	NA	NA	NA	NA	NA
WP_002892080.1|3994628_3995279_-	multidrug efflux transporter transcriptional repressor AcrR	NA	NA	NA	NA	NA
WP_085955245.1|3995368_3996560_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_001067858.1|3996676_3997381_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002892263.1|3998032_3998887_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004221682.1|3998945_3999755_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004196998.1|3999744_4000368_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004151324.1|4000338_4001025_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_004147400.1|4001021_4003436_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_004219504.1|4003412_4003526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004142997.1|4003617_4004763_+	porin	NA	NA	NA	NA	NA
WP_004151323.1|4004870_4005947_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004143002.1|4006058_4007126_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151322.1|4007122_4007632_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004151321.1|4007728_4008067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151320.1|4008174_4008897_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151319.1|4008900_4009395_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004143010.1|4009570_4010956_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
>prophage 10
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	4380179	4417515	5073712	portal,capsid,integrase,lysis,plate,terminase,head,tail	Salmonella_phage(85.0%)	48	4380087:4380105	4417587:4417605
4380087:4380105	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|4380179_4381160_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_004178082.1|4381647_4383135_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|4383233_4384178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|4384189_4385068_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|4385213_4385435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|4385467_4385977_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|4385984_4386185_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|4386148_4386490_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|4386557_4386791_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|4386790_4387018_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|4387014_4387872_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|4387868_4390283_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_001154434.1|4390436_4390625_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|4390635_4390869_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|4390983_4391661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|4391936_4393679_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|4393740_4394766_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|4394765_4396532_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|4396674_4397508_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|4397524_4398583_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|4398586_4399237_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|4399332_4399797_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|4399796_4400000_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|4400003_4400219_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|4400199_4400709_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|4400713_4401097_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|4401093_4401522_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|4401508_4401655_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|4401617_4402049_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|4402041_4402488_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004199112.1|4402484_4402994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226282.1|4402992_4403157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|4403271_4403844_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|4403840_4404203_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|4404189_4405098_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|4405090_4405690_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|4405691_4408643_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|4408646_4409378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004232615.1|4409416_4409578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|4409607_4410684_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|4410822_4411995_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|4412004_4412520_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|4412572_4412872_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|4412886_4413006_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_162493475.1|4413232_4415626_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	43.2	3.8e-104
WP_002896224.1|4415622_4416108_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|4416104_4417205_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|4417296_4417515_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
4417587:4417605	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 11
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	4451931	4461395	5073712	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|4451931_4453047_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|4453043_4454984_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|4455060_4455282_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|4455607_4455925_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|4455955_4458235_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|4458355_4458574_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004141853.1|4458927_4459647_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|4459673_4461395_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 12
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	4884988	4928036	5073712	integrase,transposase	Klebsiella_phage(34.04%)	62	4883069:4883083	4892009:4892023
4883069:4883083	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|4884988_4885750_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|4885966_4887499_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|4887697_4888246_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|4888442_4889624_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|4889604_4889847_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|4889806_4889953_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|4890025_4890259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218013.1|4890501_4890615_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_004152151.1|4890710_4890935_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|4890924_4891635_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|4891640_4892159_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
4892009:4892023	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|4892263_4893091_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|4893087_4893282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|4893278_4893704_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004146412.1|4893700_4893823_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152157.1|4893890_4894145_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004218017.1|4894137_4894299_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152159.1|4894672_4894861_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|4894853_4895168_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|4895338_4896007_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|4896104_4896326_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|4896902_4898561_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004218023.1|4898547_4899525_+	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|4899521_4899998_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|4899994_4900777_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004152168.1|4900843_4900999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|4901036_4901165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004146526.1|4901182_4901431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|4901433_4901964_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|4901960_4902350_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|4902584_4902905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|4903270_4903759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|4904247_4905439_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152173.1|4906653_4908105_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|4908160_4908709_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|4908760_4909963_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|4909966_4910461_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|4910472_4911414_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|4911453_4911735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|4911703_4912123_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|4912119_4912626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|4912625_4913012_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|4913106_4913547_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|4913550_4914696_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004199809.1|4914706_4915147_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152564.1|4915150_4915576_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|4915611_4915764_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|4915753_4917757_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004225238.1|4917942_4918356_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004217362.1|4918431_4918659_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|4918661_4919684_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|4919683_4920025_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004173705.1|4920077_4920263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225248.1|4920515_4920866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|4920919_4921573_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|4921574_4921928_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|4921927_4923124_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|4923120_4923894_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004231600.1|4924368_4924533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|4924653_4924785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|4924759_4924957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343022.1|4925012_4928036_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
>prophage 13
NZ_CP018676	Klebsiella pneumoniae strain CAV1217 chromosome, complete genome	5073712	4979843	5043120	5073712	tail,terminase,tRNA,holin	Escherichia_phage(16.36%)	73	NA	NA
WP_002902419.1|4979843_4980587_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
WP_004148192.1|4980866_4981850_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_004151591.1|4982375_4983749_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004179591.1|4983794_4984730_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
WP_075995094.1|4984778_4986017_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.1	1.0e-161
WP_004179593.1|4986017_4986230_-	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	71.8	8.4e-24
WP_023282473.1|4986294_4986534_-	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	83.3	2.7e-31
WP_075995093.1|4986574_4987663_-	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	2.8e-107
WP_075995092.1|4987675_4990777_-	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	59.1	1.1e-278
WP_016160782.1|4990914_4991070_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	73.1	5.7e-14
WP_004179600.1|4991078_4991270_-	YebW family protein	NA	NA	NA	NA	NA
WP_048230998.1|4991698_4992055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526640.1|4992151_4992415_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_040225552.1|4992417_4992954_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	4.1e-59
WP_103857350.1|4993358_4994216_+	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	63.7	4.7e-89
WP_064145491.1|4994212_4994926_+	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	58.4	9.0e-70
WP_064190507.1|4994918_4995287_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	3.7e-11
WP_016946301.1|4995283_4995487_+	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	86.4	1.3e-26
WP_075995091.1|4995479_4995734_+	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	7.0e-09
WP_075995090.1|4995730_4995967_+	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.4e-13
WP_064190503.1|4996828_4997698_+	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	42.0	9.4e-13
WP_064173263.1|4998174_4999182_+	DNA adenine methylase	NA	NA	NA	NA	NA
WP_074189154.1|4999183_5000203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064173262.1|5000206_5001319_-	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	24.2	3.0e-19
WP_065781843.1|5001650_5001884_+	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.2e-25
WP_004184501.1|5001962_5002184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103857333.1|5002241_5002841_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	8.6e-90
WP_020804598.1|5003049_5003346_+	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_103857334.1|5003342_5003699_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	4.4e-41
WP_023282413.1|5003814_5004636_+	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	4.0e-98
WP_142906623.1|5005322_5005718_+	hypothetical protein	NA	G8C7V8	Escherichia_phage	73.8	3.8e-46
WP_012967892.1|5005704_5005986_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	3.8e-32
WP_063106142.1|5005985_5006612_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	7.6e-89
WP_023304957.1|5006817_5007000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063106143.1|5007085_5007367_+	hypothetical protein	NA	G8C7W3	Escherichia_phage	69.9	6.7e-29
WP_131275234.1|5007401_5007677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103857336.1|5007806_5008811_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
WP_103857337.1|5008788_5010096_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	4.0e-148
WP_103857338.1|5010095_5011496_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	7.1e-127
WP_103857339.1|5011479_5012592_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.4	7.4e-111
WP_103857340.1|5012676_5013462_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	6.0e-67
WP_103857341.1|5013472_5014426_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.7	3.2e-131
WP_158280597.1|5014434_5014707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088678773.1|5014747_5015143_+	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	1.6e-12
WP_103857342.1|5015144_5015399_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	1.8e-20
WP_040975900.1|5015408_5015642_+	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_103857343.1|5015628_5016012_+	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	1.2e-20
WP_103857344.1|5016013_5016565_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	3.9e-28
WP_004190640.1|5016561_5016954_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_103857345.1|5016977_5018150_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_103857346.1|5018203_5018686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121496572.1|5018823_5019021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103857347.1|5019109_5019451_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_103857348.1|5019552_5022891_+|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.5	4.9e-94
WP_015958316.1|5022974_5023310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004190622.1|5023623_5024088_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_073557850.1|5024268_5024751_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	93.8	4.5e-81
WP_103857349.1|5024760_5025141_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	1.4e-69
WP_131275233.1|5025137_5028197_+	kinase	NA	A0A286S259	Klebsiella_phage	90.8	0.0e+00
WP_104022025.1|5028274_5030803_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	59.9	2.3e-35
WP_103857365.1|5030812_5031088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104022024.1|5031178_5031937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104022023.1|5031939_5033691_-	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	54.1	1.7e-24
WP_042920289.1|5033781_5034360_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.3	6.1e-93
WP_040206344.1|5034410_5034833_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_023332914.1|5035838_5037326_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_004179627.1|5037404_5037824_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_075995087.1|5037825_5039091_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.8	3.5e-210
WP_075995086.1|5039150_5039765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075995085.1|5039788_5040460_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	9.0e-80
WP_004140161.1|5041093_5041528_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_002902432.1|5041609_5041822_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_002902433.1|5041965_5043120_-	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
>prophage 1
NZ_CP018674	Klebsiella pneumoniae strain CAV1217 plasmid pCAV1217-71, complete sequence	70606	16954	55114	70606	transposase,integrase	Stx2-converting_phage(20.0%)	45	23102:23118	43190:43206
WP_015632444.1|16954_18544_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	66.1	1.9e-189
WP_032414478.1|18573_18924_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_015632445.1|18920_19328_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_086581494.1|19403_19544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087893729.1|19574_20847_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	81.7	2.8e-146
WP_016162080.1|21008_21260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632446.1|21300_23229_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
23102:23118	attL	CGCCGGAAACGCTGGTC	NA	NA	NA	NA
WP_016162079.1|23231_23543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632448.1|23938_24271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|24541_24862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162076.1|24915_25149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632450.1|25840_26278_-	antirestriction protein	NA	NA	NA	NA	NA
WP_015632451.1|26447_27308_-	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.6	2.8e-17
WP_032441934.1|27381_27561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|27704_28064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632453.1|28657_29095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|29222_29711_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_015632455.1|29707_30166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632456.1|30318_30747_-	partitioning protein	NA	NA	NA	NA	NA
WP_015632457.1|30739_31720_-	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632458.1|32080_32263_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632459.1|32288_32732_+	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_016162072.1|33073_33301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|33730_33988_+	helix-turn-helix transcriptional regulator	NA	H2DE32	Erwinia_phage	56.4	5.1e-07
WP_015632462.1|34191_34758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632463.1|34799_35144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015632464.1|35288_35594_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632465.1|35593_35812_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632467.1|36592_37024_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_016162068.1|37023_38295_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_004098982.1|38706_39582_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_006788217.1|40951_41131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|41562_42357_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_024191724.1|43622_43934_-	hypothetical protein	NA	NA	NA	NA	NA
43190:43206	attR	GACCAGCGTTTCCGGCG	NA	NA	NA	NA
WP_040214038.1|43967_44297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103857363.1|44455_44791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064174377.1|44856_47976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060415434.1|48291_48528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060415435.1|48524_49100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162063.1|49641_50346_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_001067855.1|51498_52203_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001326844.1|52435_52597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|52593_53205_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001568067.1|53258_53540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000227969.1|54037_55114_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018675	Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence	181436	43669	101774	181436	transposase,protease,integrase	uncultured_Caudovirales_phage(29.41%)	53	35412:35426	56505:56519
35412:35426	attL	AAAGCTGCACGTTAT	NA	NA	NA	NA
WP_001515717.1|43669_44410_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004099053.1|45016_45985_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_004152065.1|46619_47567_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|47593_47905_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|47924_48893_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|49565_49823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|50424_51879_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|52861_54139_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|54201_56199_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|57238_58446_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
56505:56519	attR	ATAACGTGCAGCTTT	NA	NA	NA	NA
WP_004178091.1|59874_60306_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|60556_62032_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|62024_62705_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|62894_64280_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|64308_64662_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|64775_66068_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|66078_69225_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|69311_69752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|69878_72326_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|72366_72564_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|72597_73335_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|73623_74073_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|74306_76124_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|76123_77020_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|77059_77440_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|77444_78374_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|78428_79109_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|79105_80506_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|80722_81157_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|81388_81568_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|83310_83820_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|83869_84367_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|84698_85025_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|85021_85735_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|85743_86289_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|86364_86727_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|88623_89160_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|89192_89618_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|89630_90920_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|90967_92719_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|92736_93099_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|93148_93499_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|93856_94126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|94113_94689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|94719_95214_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|95257_95626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|95659_95863_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|95911_96169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|96244_96499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|96674_96941_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|96928_97411_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|97622_98969_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|100811_101774_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP018675	Klebsiella pneumoniae strain CAV1217 plasmid pKPC_CAV1217, complete sequence	181436	107261	165695	181436	integrase,transposase,bacteriocin	Escherichia_phage(50.0%)	54	116123:116182	159612:160433
WP_004118209.1|107261_107525_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|108726_109707_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|110915_111785_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|111778_112789_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|112797_113625_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|113633_114497_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|114493_115321_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
116123:116182	attL	CCGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067855.1|116176_116881_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_104022016.1|116916_122169_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152303.1|122248_122974_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004178053.1|123132_123729_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152301.1|123748_124096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178052.1|124310_124856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|125212_127534_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|127535_127814_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|128154_128634_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|128954_129233_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|129449_129527_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|129519_130377_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093215.1|130427_130586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408758.1|130670_130805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004193160.1|131044_131263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158648848.1|131560_131731_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|132049_133369_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_015062847.1|133618_134500_-	carbapenem-hydrolyzing class A beta-lactamase KPC-4	NA	A0A1B0VBP7	Salmonella_phage	52.5	1.1e-74
WP_004152394.1|134886_135666_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|135662_136688_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|136794_139824_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|139933_141649_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000602738.1|143156_143909_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_104022036.1|144330_145356_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|145584_146361_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_158649105.1|146474_146894_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.3e-71
WP_001067855.1|146905_147610_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000496058.1|148779_149097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|149146_149440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|149449_149731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749963.1|149739_150474_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024129965.1|150537_150888_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749964.1|150903_151248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|151244_151559_+	KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|151594_151906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104022057.1|152114_152603_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|152607_152814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104022030.1|153195_154629_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|154662_155877_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|156137_156902_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|157408_157909_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|158036_158876_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|158869_159217_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067855.1|159665_160370_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_020277917.1|160840_161614_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
159612:160433	attR	CCGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
WP_020277915.1|163075_164044_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_033488203.1|164033_165695_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
