The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	16924	23829	5208900	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|16924_17788_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_024264506.1|17798_18572_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|18812_19709_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|19951_21313_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004890796.1|21631_22354_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|22350_23829_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 2
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	64654	76596	5208900	transposase	Enterobacteria_phage(22.22%)	11	NA	NA
WP_000043542.1|64654_66061_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_075995067.1|66284_67349_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.9e-104
WP_023278825.1|67375_68245_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_040230682.1|68276_69167_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	9.6e-29
WP_040230680.1|69181_69736_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.3e-52
WP_000704907.1|69917_71084_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004099053.1|71352_72321_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_004144151.1|72573_72696_-	small membrane protein	NA	NA	NA	NA	NA
WP_001741931.1|72886_73027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435495.1|73096_74101_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_004180506.1|75180_76596_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
>prophage 3
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	274856	331360	5208900	transposase,plate,protease	Microcystis_virus(25.0%)	54	NA	NA
WP_032425077.1|274856_275603_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032425076.1|276041_277028_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|277859_277982_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|278279_278423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023286625.1|278599_279541_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|279634_280624_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|280649_281981_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|282008_283217_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|283245_285540_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_004225356.1|285591_285738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995074.1|286027_287086_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|287195_288110_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|288119_289406_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|289402_290278_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	8.9e-11
WP_004175491.1|290274_290994_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|290999_291893_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|292176_293820_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|293869_294346_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|294444_295371_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|295674_296970_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004145468.1|296981_297791_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020801945.1|297765_298665_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|298774_299257_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_072159826.1|299354_300146_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910652.1|300171_300711_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|300825_301155_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032423435.1|301324_301486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004899025.1|301723_303064_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004184632.1|303060_303714_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_032425071.1|303717_305415_+	OmpA family protein	NA	NA	NA	NA	NA
WP_032425070.1|305873_308360_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_032425069.1|308383_309715_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_072198477.1|309759_310728_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425068.1|310804_311314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|311310_311817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614320.1|312053_312563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|314019_315000_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004200304.1|315412_315922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|315918_316425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|316886_317915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343204.1|317932_318244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|318265_319159_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_032410376.1|319204_319321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|319342_320236_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|320261_320390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064182053.1|320531_321305_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.1	1.2e-11
WP_004164123.1|321480_321834_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343198.1|321797_322370_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_162493486.1|322712_322847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|323107_323293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|323590_323857_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032411808.1|325006_328417_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032411805.1|328550_330314_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_072198475.1|330343_331360_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 4
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	841835	851249	5208900		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|841835_843470_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|843524_844790_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|844820_845909_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|845995_846256_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|846553_847414_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|847434_848196_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|848456_849359_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|849370_850636_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|850628_851249_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	1015312	1080500	5208900	tRNA,terminase,holin,tail	Enterobacteria_phage(16.07%)	74	NA	NA
WP_002902433.1|1015312_1016467_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
WP_002902432.1|1016610_1016823_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004140161.1|1016904_1017339_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_075995085.1|1017972_1018644_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	9.0e-80
WP_075995086.1|1018667_1019282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995087.1|1019341_1020607_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.8	3.5e-210
WP_004179627.1|1020608_1021028_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_023332914.1|1021106_1022594_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_040206344.1|1023599_1024022_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_042920289.1|1024072_1024651_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	97.3	6.1e-93
WP_104022023.1|1024741_1026493_+	GDSL family lipase	NA	A0A286S1P0	Klebsiella_phage	54.1	1.7e-24
WP_104022024.1|1026495_1027254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103857365.1|1027344_1027620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104022025.1|1027629_1030158_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	59.9	2.3e-35
WP_131275233.1|1030235_1033295_-	kinase	NA	A0A286S259	Klebsiella_phage	90.8	0.0e+00
WP_103857349.1|1033291_1033672_-	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	96.0	1.4e-69
WP_073557850.1|1033681_1034164_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	93.8	4.5e-81
WP_004190622.1|1034344_1034809_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	68.4	3.0e-58
WP_015958316.1|1035122_1035458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103857348.1|1035541_1038880_-|tail	phage tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.5	4.9e-94
WP_103857347.1|1038981_1039323_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	43.3	2.6e-06
WP_121496572.1|1039411_1039609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103857346.1|1039746_1040229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103857345.1|1040282_1041455_-	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	9.4e-24
WP_004190640.1|1041478_1041871_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_103857344.1|1041867_1042419_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.3	3.9e-28
WP_103857343.1|1042420_1042804_-	glutamate 5-kinase	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	1.2e-20
WP_040975900.1|1042790_1043024_-	hypothetical protein	NA	A0A1V0E8A3	Vibrio_phage	49.2	1.3e-09
WP_103857342.1|1043033_1043288_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	51.2	1.8e-20
WP_088678773.1|1043289_1043685_-	protein singed	NA	A0A0S2SYB7	Pseudomonas_phage	42.5	1.6e-12
WP_158280597.1|1043725_1043998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103857341.1|1044006_1044960_-	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	73.7	3.2e-131
WP_103857340.1|1044970_1045756_-	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	6.0e-67
WP_103857339.1|1045840_1046953_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.4	7.4e-111
WP_103857338.1|1046936_1048337_-	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.3	7.1e-127
WP_103857337.1|1048336_1049644_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.7	4.0e-148
WP_103857336.1|1049621_1050626_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.0	1.3e-37
WP_158648847.1|1050713_1051031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063106143.1|1051065_1051347_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	69.9	6.7e-29
WP_023304957.1|1051432_1051615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063106142.1|1051820_1052447_-	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	76.3	7.6e-89
WP_012967892.1|1052446_1052728_-|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	72.0	3.8e-32
WP_142906623.1|1052714_1053110_-	hypothetical protein	NA	G8C7V8	Escherichia_phage	73.8	3.8e-46
WP_023282413.1|1053796_1054618_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	67.1	4.0e-98
WP_103857334.1|1054733_1055090_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6W0	Enterobacteria_phage	63.2	4.4e-41
WP_020804598.1|1055086_1055383_-	DUF1364 domain-containing protein	NA	E5AGG0	Erwinia_phage	74.5	1.7e-35
WP_103857333.1|1055591_1056191_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.4	8.6e-90
WP_004184501.1|1056248_1056470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065781843.1|1056548_1056782_-	DinI-like family protein	NA	K7PM44	Enterobacteria_phage	68.8	2.2e-25
WP_004178082.1|1056860_1058348_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_064173262.1|1059023_1060136_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	24.2	3.0e-19
WP_074189154.1|1060139_1061159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064173263.1|1061160_1062168_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_064190503.1|1062644_1063514_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	42.0	9.4e-13
WP_075995090.1|1064375_1064612_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.4e-13
WP_075995091.1|1064608_1064863_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	7.0e-09
WP_016946301.1|1064855_1065059_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	86.4	1.3e-26
WP_064190507.1|1065055_1065424_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	3.7e-11
WP_064145491.1|1065416_1066130_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	58.4	9.0e-70
WP_103857350.1|1066126_1066984_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	63.7	4.7e-89
WP_040225552.1|1067389_1067926_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	4.1e-59
WP_071526640.1|1067928_1068192_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048230998.1|1068288_1068645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|1069073_1069265_+	YebW family protein	NA	NA	NA	NA	NA
WP_016160782.1|1069273_1069429_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	73.1	5.7e-14
WP_075995092.1|1069566_1072668_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	59.1	1.1e-278
WP_075995093.1|1072680_1073769_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	2.8e-107
WP_023282473.1|1073809_1074049_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	83.3	2.7e-31
WP_004179593.1|1074113_1074326_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	71.8	8.4e-24
WP_075995094.1|1074326_1075565_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.1	1.0e-161
WP_004179591.1|1075613_1076549_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
WP_004151591.1|1076594_1077968_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|1078493_1079477_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_002902419.1|1079756_1080500_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
>prophage 6
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	1132307	1175355	5208900	transposase,integrase	Klebsiella_phage(35.42%)	63	1166468:1166482	1172477:1172491
WP_014343022.1|1132307_1135331_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|1135386_1135584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|1135558_1135690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|1135810_1135975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|1136449_1137223_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|1137219_1138416_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|1138415_1138769_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|1138770_1139424_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|1139477_1139828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|1140080_1140266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|1140318_1140660_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|1140659_1141682_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|1141684_1141912_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|1141987_1142401_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|1142586_1144590_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|1144579_1144732_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|1144767_1145193_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|1145196_1145637_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|1145647_1146793_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|1146796_1147237_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|1147331_1147718_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|1147717_1148224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|1148220_1148640_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|1148608_1148890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|1148929_1149871_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|1149882_1150377_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|1150380_1151583_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|1151634_1152183_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|1152238_1153690_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_085955245.1|1154903_1156096_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004218030.1|1156584_1157073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|1157438_1157759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|1157993_1158383_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|1158379_1158910_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|1158912_1159161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|1159178_1159307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|1159344_1159500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|1159566_1160349_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|1160345_1160822_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|1160818_1161796_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|1161782_1163441_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152163.1|1163749_1164043_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	97.6	2.8e-38
WP_004152162.1|1164017_1164239_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|1164336_1165005_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|1165175_1165490_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|1165482_1165671_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|1166044_1166206_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|1166198_1166453_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
1166468:1166482	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|1166520_1166643_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|1166639_1167065_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|1167061_1167256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|1167252_1168080_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|1168184_1168703_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|1168708_1169419_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|1169408_1169633_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|1169728_1169842_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|1170084_1170318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|1170390_1170537_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|1170496_1170739_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|1170719_1171901_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|1172097_1172646_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
1172477:1172491	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|1172844_1174377_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|1174593_1175355_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 7
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	1543995	1583167	5208900	integrase,transposase,tRNA	Escherichia_phage(31.25%)	47	1546047:1546106	1582399:1583219
WP_002898206.1|1543995_1545396_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.8	1.0e-80
1546047:1546106	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|1546110_1546815_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000496058.1|1547984_1548302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|1548351_1548645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|1548654_1548936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104022027.1|1548944_1549346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162063.1|1549336_1550041_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_060415435.1|1550582_1551158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060415434.1|1551154_1551391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064174377.1|1551706_1554826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103857363.1|1554891_1555227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040214038.1|1555385_1555715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024191724.1|1555748_1556060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162067.1|1556124_1557129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632375.1|1557326_1558121_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	88.7	5.5e-52
WP_006788217.1|1558552_1558732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197649.1|1558851_1559478_-	ParA family plasmid-partitioning AAA ATPase	NA	NA	NA	NA	NA
WP_004098982.1|1560102_1560978_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	56.4	5.6e-82
WP_016162068.1|1561389_1562661_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.0	2.6e-152
WP_015632467.1|1562660_1563092_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.7	7.2e-30
WP_015632465.1|1563872_1564091_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_015632464.1|1564090_1564396_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_015632463.1|1564540_1564885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632462.1|1564926_1565493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162071.1|1565696_1565954_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	46.1	4.3e-06
WP_016162072.1|1566383_1566611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632459.1|1566952_1567396_-	hypothetical protein	NA	A0A0R6PJ17	Moraxella_phage	33.8	4.6e-16
WP_015632458.1|1567421_1567604_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	48.3	2.0e-05
WP_015632457.1|1567964_1568945_+	partitioning protein	NA	A0A0A7NPX4	Enterobacteria_phage	49.4	2.3e-76
WP_015632456.1|1568937_1569366_+	partitioning protein	NA	NA	NA	NA	NA
WP_015632455.1|1569518_1569977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632454.1|1569973_1570462_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_015632453.1|1570589_1571027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016162075.1|1571620_1571980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032441934.1|1572123_1572303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632451.1|1572376_1573237_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	23.6	8.2e-17
WP_015632450.1|1573406_1573844_+	antirestriction protein	NA	NA	NA	NA	NA
WP_016162076.1|1574535_1574769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015632449.1|1574822_1575143_+	hypothetical protein	NA	J9Q750	Salmonella_phage	36.8	2.6e-16
WP_015632448.1|1575413_1575746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162079.1|1576141_1576453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104022028.1|1576455_1577148_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_001067858.1|1577093_1577798_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_104022029.1|1577788_1578799_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_020277915.1|1578788_1579757_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_020277917.1|1581218_1581992_-	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	26.0	9.6e-09
WP_001067855.1|1582462_1583167_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
1582399:1583219	attR	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGTGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCGCGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 8
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	1641831	1734782	5208900	tRNA,head,terminase,capsid,tail,portal,integrase,lysis,plate,protease	Salmonella_phage(57.63%)	97	1697357:1697375	1734857:1734875
WP_002898139.1|1641831_1643124_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|1643214_1644558_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|1644566_1645178_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|1645300_1649554_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|1649689_1650184_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|1650467_1650599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|1650716_1651685_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|1651799_1653566_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|1653566_1655288_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.4	3.4e-14
WP_004141853.1|1655314_1656034_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|1656387_1656606_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|1656726_1659006_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|1659036_1659354_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|1659679_1659901_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|1659977_1661918_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|1661914_1663030_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|1663176_1664835_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|1665254_1665950_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|1666065_1666965_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|1667108_1668761_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|1668771_1669740_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|1669951_1670386_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|1670537_1672256_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|1672294_1673296_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|1673306_1674749_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|1674836_1675850_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|1675846_1676677_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|1676708_1677848_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|1678725_1679241_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|1679467_1680196_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|1680216_1680948_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|1680954_1681671_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|1681670_1682339_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|1682522_1683254_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|1683296_1684769_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|1684765_1685482_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|1685560_1686688_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|1686729_1687218_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|1687275_1688121_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|1688117_1689071_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|1689081_1690248_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|1690378_1691491_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|1691839_1692319_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|1692407_1693310_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|1694131_1694419_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|1694621_1694885_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|1694891_1695275_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|1695541_1697227_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|1697218_1697341_-	hypothetical protein	NA	NA	NA	NA	NA
1697357:1697375	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|1697446_1697665_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|1697756_1698857_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|1698853_1699339_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_162493475.1|1699335_1701729_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	43.2	3.8e-104
WP_002896220.1|1701955_1702075_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|1702089_1702389_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|1702441_1702957_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|1702966_1704139_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|1704277_1705354_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|1705383_1705545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|1705583_1706315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|1706318_1709270_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|1709271_1709871_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|1709863_1710772_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|1710758_1711121_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|1711117_1711690_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|1711804_1711969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|1711967_1712477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|1712473_1712920_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|1712912_1713344_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|1713306_1713453_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|1713439_1713868_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|1713864_1714248_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|1714252_1714762_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|1714742_1714958_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|1714961_1715165_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|1715164_1715629_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|1715724_1716375_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|1716378_1717437_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|1717453_1718287_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|1718429_1720196_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|1720195_1721221_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|1721282_1723025_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|1723300_1723978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|1724092_1724326_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|1724336_1724525_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|1724678_1727093_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|1727089_1727947_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|1727943_1728171_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|1728170_1728404_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|1728471_1728813_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|1728776_1728977_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|1728984_1729494_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|1729526_1729748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1729893_1730772_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|1730783_1731728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|1731826_1733314_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|1733801_1734782_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
1734857:1734875	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 9
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	2080717	2128794	5208900	integrase,transposase,protease,tRNA	Escherichia_phage(22.22%)	41	2099013:2099029	2130001:2130017
WP_002892491.1|2080717_2082235_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.3	9.5e-85
WP_004151795.1|2082566_2084042_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	29.0	6.9e-48
WP_002892486.1|2084101_2086249_-	lysine decarboxylase CadA	NA	NA	NA	NA	NA
WP_002892484.1|2086331_2087666_-	cadaverine/lysine antiporter	NA	NA	NA	NA	NA
WP_075995106.1|2088031_2089606_-	CadC family transcriptional regulator	NA	NA	NA	NA	NA
WP_002892402.1|2089898_2090171_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_002892400.1|2090271_2091192_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	5.4e-51
WP_002892397.1|2091702_2092569_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001067858.1|2093337_2094042_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_002892263.1|2094693_2095548_-	co-chaperone YbbN	NA	NA	NA	NA	NA
WP_004221682.1|2095606_2096416_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004196998.1|2096405_2097029_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_004151324.1|2096999_2097686_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.7	2.1e-31
WP_004147400.1|2097682_2100097_+	ABC transporter permease	NA	NA	NA	NA	NA
2099013:2099029	attL	ACCGCCTGCTGCGCCAG	NA	NA	NA	NA
WP_004219504.1|2100073_2100187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004142997.1|2100278_2101424_+	porin	NA	NA	NA	NA	NA
WP_004151323.1|2101531_2102608_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_004143002.1|2102719_2103787_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_004151322.1|2103783_2104293_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_004151321.1|2104389_2104728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151320.1|2104835_2105558_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_004151319.1|2105561_2106056_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_004143010.1|2106231_2107617_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|2107662_2107875_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|2107876_2108743_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
WP_002892360.1|2109620_2109914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002892366.1|2110309_2110711_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_002892370.1|2110789_2110960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004142684.1|2111284_2111425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198770.1|2111470_2112775_+	citrate synthase	NA	NA	NA	NA	NA
WP_002892375.1|2112827_2113133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002892378.1|2113110_2113773_-	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151792.1|2114244_2114805_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_002892383.1|2114863_2115559_+	molecular chaperone	NA	NA	NA	NA	NA
WP_002892386.1|2115569_2118005_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001067858.1|2118409_2119114_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001199192.1|2119227_2120004_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_104022036.1|2120232_2121258_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|2121679_2122432_-|transposase	IS6 family transposase	transposase	A0A0N9RU54	Staphylococcus_phage	38.7	2.4e-33
WP_004152391.1|2123939_2125655_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|2125764_2128794_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
2130001:2130017	attR	CTGGCGCAGCAGGCGGT	NA	NA	NA	NA
>prophage 10
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	2379164	2390818	5208900	integrase	Enterobacteria_phage(70.0%)	15	2379016:2379029	2383229:2383242
2379016:2379029	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|2379164_2380268_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|2380278_2381532_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|2381884_2383075_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|2383062_2384013_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
2383229:2383242	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|2384012_2384438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|2384784_2384934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|2385006_2385573_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|2385590_2385836_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|2385832_2386570_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|2386869_2387007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|2387111_2387378_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|2387380_2387932_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|2387976_2388156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|2388152_2388473_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|2388484_2390818_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 11
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	2859064	2864889	5208900		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|2859064_2861398_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|2861412_2861733_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|2861729_2861957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|2861953_2862496_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|2862498_2862765_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|2863325_2864063_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|2864059_2864305_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|2864322_2864889_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 12
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	3892236	3962920	5208900	tRNA,head,capsid,terminase,tail,portal,integrase,transposase,protease	uncultured_Caudovirales_phage(60.0%)	73	3909844:3909861	3925839:3925856
WP_002919147.1|3892236_3893184_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|3893198_3893708_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|3893836_3894961_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|3894932_3895406_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|3895431_3895974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|3895978_3896551_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|3896554_3897373_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|3897369_3897627_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|3897602_3898157_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|3903952_3904174_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|3904467_3907578_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|3907590_3908730_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|3909108_3909759_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
3909844:3909861	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|3910034_3911261_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|3911353_3912295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|3912476_3912761_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|3912771_3913551_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_024194847.1|3913674_3913869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|3914053_3914272_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|3914264_3914453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|3914529_3914658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|3914756_3915125_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|3915121_3915487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|3915486_3917622_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|3917964_3918300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|3918348_3918861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|3919124_3920291_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|3920342_3920903_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|3920904_3922146_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|3922142_3922478_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|3922474_3922774_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|3922773_3923217_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|3923209_3923362_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|3923492_3923849_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|3923832_3925494_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_004150954.1|3925496_3925688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|3925841_3926138_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
3925839:3925856	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004144972.1|3926162_3927128_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|3927485_3928367_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_002918742.1|3928378_3929830_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|3929819_3930062_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|3930172_3931522_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|3931532_3932000_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918732.1|3932022_3932475_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918689.1|3932698_3933307_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918688.1|3933306_3934308_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918687.1|3934536_3934728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085955245.1|3936031_3937223_+|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_002918653.1|3938359_3939403_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|3939473_3940466_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|3940465_3940954_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|3940961_3941543_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|3941545_3943015_+	ribonuclease G	NA	NA	NA	NA	NA
WP_004150952.1|3943052_3946850_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918642.1|3946938_3948384_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|3948419_3949349_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|3949480_3949684_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|3949691_3950624_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|3950629_3952597_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|3952676_3952952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918627.1|3953002_3953269_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918626.1|3953367_3953631_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|3954006_3954477_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|3954891_3955830_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918568.1|3955966_3957025_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918566.1|3957112_3958480_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|3958653_3959052_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|3959242_3960370_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|3960635_3961064_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|3961079_3961472_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|3961529_3961814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|3961783_3962422_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|3962425_3962920_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 13
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	4680505	4732698	5208900	coat,head,tRNA,terminase,capsid,tail,portal,integrase,lysis,transposase,plate	Salmonella_phage(84.09%)	67	4684757:4684803	4721324:4721370
WP_004099053.1|4680505_4681474_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_002914181.1|4681515_4681878_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002914180.1|4681888_4682461_-	flavin oxidoreductase	NA	NA	NA	NA	NA
WP_002914178.1|4682672_4683557_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151022.1|4683681_4684482_+	hypothetical protein	NA	NA	NA	NA	NA
4684757:4684803	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151021.1|4684916_4686467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151020.1|4686463_4687489_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|4687491_4688121_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|4688243_4688486_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|4688518_4689028_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|4689035_4689236_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|4689199_4689538_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|4689605_4689839_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|4689838_4690066_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|4690062_4690914_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|4690910_4693295_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|4693457_4693646_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|4693657_4693891_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|4693986_4694670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|4694656_4695736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|4695735_4696737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|4697258_4697528_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|4697584_4698628_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_104022053.1|4698627_4700391_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.6	0.0e+00
WP_004151004.1|4700531_4701365_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|4701381_4702434_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|4702437_4703091_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|4703186_4703651_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|4703650_4703854_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|4703857_4704073_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|4704053_4704563_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|4704567_4704951_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|4704947_4705376_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|4705350_4705509_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|4705471_4705894_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|4705886_4706333_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|4706355_4707222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|4707316_4707889_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|4707885_4708248_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|4708234_4709143_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|4709135_4709807_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|4709808_4711758_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|4711767_4712886_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|4712937_4714011_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|4714159_4715332_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|4715341_4715857_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|4715909_4716209_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|4716223_4716343_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|4716569_4718966_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|4718962_4719448_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|4719444_4720539_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|4720605_4720824_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|4720851_4721229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|4721832_4722315_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4721324:4721370	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|4722425_4722902_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|4722891_4723182_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|4723248_4723590_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|4723571_4723712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|4723737_4725399_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|4725485_4726364_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|4726488_4727079_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|4727198_4728485_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|4728504_4729296_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|4729459_4730824_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|4731083_4731332_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|4731350_4731899_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|4731930_4732698_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP018352	Klebsiella pneumoniae strain CAV1417 chromosome, complete genome	5208900	5024568	5075721	5208900	transposase	Escherichia_phage(31.25%)	47	NA	NA
WP_002913072.1|5024568_5025522_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	54.1	1.1e-67
WP_004140864.1|5025497_5025632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002913070.1|5025796_5026339_+	membrane protein	NA	NA	NA	NA	NA
WP_004151110.1|5026441_5027638_+	nicotinamide mononucleotide deamidase-related protein YfaY	NA	NA	NA	NA	NA
WP_002913046.1|5027842_5028628_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004175029.1|5028638_5029844_+	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.0	7.9e-26
WP_002913045.1|5029886_5031176_+	MFS transporter	NA	NA	NA	NA	NA
WP_002913043.1|5031190_5031994_+	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_002913041.1|5032015_5033194_-	anaerobic glycerol-3-phosphate dehydrogenase subunit C	NA	NA	NA	NA	NA
WP_004151111.1|5033190_5034450_-	glycerol-3-phosphate dehydrogenase subunit GlpB	NA	NA	NA	NA	NA
WP_002913020.1|5034439_5036062_-	anaerobic glycerol-3-phosphate dehydrogenase subunit A	NA	NA	NA	NA	NA
WP_002913019.1|5036333_5037680_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_002913018.1|5037689_5038760_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	52.6	2.1e-09
WP_002913017.1|5039223_5039478_-	2Fe-2S ferredoxin-like protein	NA	G9IAA2	Pseudomonas_phage	65.3	8.2e-26
WP_004140835.1|5039477_5040608_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.7	1.0e-176
WP_002913016.1|5040709_5042995_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.6	2.5e-283
WP_002913014.1|5043339_5044068_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_032419896.1|5044214_5046848_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	31.0	1.3e-94
WP_002913009.1|5046979_5049820_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	25.9	8.3e-42
WP_002913007.1|5049865_5050516_-	transcriptional regulator RcsB	NA	NA	NA	NA	NA
WP_002913006.1|5050531_5053189_-	phosphotransferase RcsD	NA	NA	NA	NA	NA
WP_001067855.1|5054356_5055061_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000679427.1|5055509_5055857_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|5055850_5056690_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000376623.1|5056817_5057318_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001389365.1|5057824_5058589_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004098817.1|5058849_5060064_+	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_104022030.1|5060097_5061531_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_001749967.1|5061912_5062119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104022057.1|5062123_5062612_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_001452736.1|5062820_5063132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|5063167_5063482_-	KikA protein	NA	NA	NA	NA	NA
WP_001749964.1|5063478_5063823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024129965.1|5063838_5064189_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749963.1|5064252_5064987_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000440698.1|5064995_5065277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|5065286_5065580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000496058.1|5065629_5065947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|5067116_5067821_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000239590.1|5068214_5069090_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|5069136_5069469_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_001067855.1|5071790_5072495_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000496058.1|5073664_5073982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|5074031_5074325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|5074334_5074616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104022027.1|5074624_5075026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016162063.1|5075016_5075721_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
>prophage 1
NZ_CP018351	Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence	184940	19983	51607	184940	transposase	Escherichia_phage(72.73%)	26	NA	NA
WP_001067855.1|19983_20688_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427614.1|21443_22448_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001567377.1|23168_23663_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001567378.1|23652_24114_-	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_021243014.1|24137_24275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001567380.1|24348_24855_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_001567381.1|24885_25146_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001567382.1|25358_25916_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001567383.1|26012_26279_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|26377_27082_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_020277920.1|27210_27792_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|28306_29011_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016162063.1|30376_31081_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_001097412.1|32482_33046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348195.1|33069_33444_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001515734.1|33508_34072_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000046891.1|34314_34650_+	thermonuclease family protein	NA	G8DH70	Emiliania_huxleyi_virus	35.7	2.8e-05
WP_001067855.1|35523_36228_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016162063.1|38500_39205_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000509966.1|39528_40134_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_022631502.1|41299_41500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101446.1|41830_42856_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_013815099.1|43174_44143_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.0e-185
WP_004099052.1|44515_46708_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_016162063.1|47464_48169_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_016162063.1|50902_51607_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
>prophage 2
NZ_CP018351	Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-185, complete sequence	184940	80358	121188	184940	transposase,protease,bacteriocin	Escherichia_phage(40.0%)	36	NA	NA
WP_020314316.1|80358_81705_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|83547_84510_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|84496_85246_-	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152115.1|85483_85681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|85680_88476_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|88590_89160_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|89194_89476_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|89719_89983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|89997_90261_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|91462_92443_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|93651_94521_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|94514_95525_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|95533_96361_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|96369_97233_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|97229_98057_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_001067855.1|98912_99617_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_104022016.1|99652_104905_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_004152303.1|104984_105710_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
WP_004178053.1|105867_106464_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_004152301.1|106483_106831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178052.1|107045_107591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178051.1|107947_110269_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|110270_110549_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|110889_111369_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|111689_111968_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|112184_112262_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|112254_113112_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_072093215.1|113162_113321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408758.1|113405_113540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977766.1|114155_114491_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_000227969.1|115715_116792_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001568067.1|117289_117571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|117624_118236_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001326844.1|118232_118394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|118626_119331_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_016162063.1|120483_121188_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
>prophage 1
NZ_CP018350	Klebsiella pneumoniae strain CAV1417 plasmid pCAV1417-67, complete sequence	66920	8324	17762	66920	integrase	Escherichia_phage(42.86%)	10	5908:5925	21339:21356
5908:5925	attL	GATTTATTCAACAAAGCC	NA	NA	NA	NA
WP_000015958.1|8324_9101_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|9158_9416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|9544_9649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|10178_11045_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|11221_11491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|11905_13111_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064119.1|13110_14085_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_001754953.1|14166_15438_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000776034.1|15437_15869_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|16274_17762_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
21339:21356	attR	GATTTATTCAACAAAGCC	NA	NA	NA	NA
