The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	1142498	1208965	5497872	lysis,terminase,integrase,head,portal,plate,tRNA,tail,capsid	Salmonella_phage(76.09%)	77	1162299:1162345	1197591:1197637
WP_032418442.1|1142498_1143374_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_071844616.1|1144327_1144492_+	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_032418443.1|1145335_1146694_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_123836165.1|1146703_1147249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418444.1|1147270_1147720_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	63.8	1.8e-44
WP_032418445.1|1148093_1148252_-	hypothetical protein	NA	A0A218M4L1	Erwinia_phage	68.0	3.2e-12
WP_071844617.1|1148736_1148943_-	hypothetical protein	NA	A0A1B5FPB7	Escherichia_phage	55.3	7.4e-09
WP_032418447.1|1149383_1150397_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_032418448.1|1150407_1151388_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_032418449.1|1151384_1151759_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_032418451.1|1151755_1152277_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_032418453.1|1152389_1152674_-	transcriptional regulator	NA	A0A2I7S995	Vibrio_phage	64.7	4.6e-17
WP_087757875.1|1152768_1153125_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073546842.1|1153443_1155513_-	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	8.7e-73
WP_032418458.1|1155548_1155764_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_032418459.1|1156245_1160049_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_032418460.1|1160237_1160885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418461.1|1160886_1162134_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	61.8	8.5e-140
1162299:1162345	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_032418462.1|1162430_1163477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000155498.1|1163466_1164507_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	92.7	1.7e-189
WP_031591564.1|1164510_1165143_-	helix-turn-helix domain-containing protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	3.8e-64
WP_000102105.1|1165259_1165502_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_031591568.1|1165534_1166044_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	3.9e-83
WP_000956190.1|1166051_1166252_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	100.0	2.4e-33
WP_031591570.1|1166215_1166557_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	1.7e-55
WP_016529331.1|1166624_1166858_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	1.2e-31
WP_031591572.1|1166857_1167085_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_031591574.1|1167081_1167939_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.1e-159
WP_031591576.1|1167935_1170350_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.6	0.0e+00
WP_001154434.1|1170503_1170692_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1170702_1170936_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1171050_1171728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000497736.1|1172006_1173158_+	TIGR02391 family protein	NA	NA	NA	NA	NA
WP_032418464.1|1173209_1174244_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.3	5.9e-171
WP_031591583.1|1174243_1176010_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.1	0.0e+00
WP_002895967.1|1176152_1176986_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_031591585.1|1177002_1178061_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.9e-180
WP_000059191.1|1178064_1178715_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_031591589.1|1178810_1179275_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.1e-76
WP_031591593.1|1179274_1179478_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	5.2e-31
WP_000171568.1|1179481_1179697_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_031591597.1|1179677_1180193_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.8	4.0e-88
WP_031591599.1|1180189_1180618_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.5e-59
WP_001039947.1|1180713_1181145_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.3e-71
WP_031591600.1|1181137_1181602_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.6	5.5e-60
WP_031591601.1|1181689_1183201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591602.1|1183327_1183906_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	1.6e-93
WP_031591604.1|1183902_1184262_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_031591606.1|1184248_1185157_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086836.1|1185149_1185755_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_031591609.1|1185751_1187473_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.9	3.5e-152
WP_050486392.1|1187472_1187655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077255116.1|1187635_1187788_-|tail	tail fiber assembly protein	tail	U5P083	Shigella_phage	71.1	5.8e-11
WP_032418466.1|1188451_1189018_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.1e-85
WP_031591343.1|1189160_1190333_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.2	2.5e-202
WP_001504081.1|1190342_1190858_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281009.1|1190912_1191215_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|1191229_1191349_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_032418469.1|1191341_1194419_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
WP_016529761.1|1194415_1194901_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	4.8e-67
WP_032418471.1|1194897_1195998_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	4.2e-175
WP_000972389.1|1196088_1196307_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	71.9	1.9e-18
WP_000380485.1|1196568_1196742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031591352.1|1196710_1197484_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_002914164.1|1198098_1198581_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1197591:1197637	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_071549035.1|1198691_1199168_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1199157_1199448_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1199514_1199856_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004174799.1|1200003_1201665_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1201751_1202630_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_004174800.1|1202754_1203345_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1203465_1204752_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1204771_1205563_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1205726_1207091_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1207350_1207599_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1207617_1208166_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_073546843.1|1208197_1208965_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	1310943	1325748	5497872	integrase	Morganella_phage(22.22%)	20	1295806:1295821	1330981:1330996
1295806:1295821	attL	GCGCTGCCGGGGATCC	NA	NA	NA	NA
WP_029602776.1|1310943_1312212_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	60.8	3.3e-147
WP_004866318.1|1312219_1313173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004866314.1|1313299_1313518_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_029602778.1|1313517_1313949_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	48.9	3.1e-25
WP_032730932.1|1313962_1314772_+	antA/AntB antirepressor family protein	NA	A0A0R6PJV6	Moraxella_phage	54.5	3.5e-30
WP_073546847.1|1314764_1314944_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_110109932.1|1315590_1315785_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_004213164.1|1315777_1315957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418506.1|1315953_1316457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418508.1|1316453_1316663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418509.1|1316659_1317286_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	37.8	1.8e-26
WP_032418510.1|1317295_1317646_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	69.1	8.9e-39
WP_032418512.1|1317638_1320089_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	38.0	1.1e-138
WP_048265897.1|1320396_1320795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418513.1|1320791_1321238_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_055314482.1|1321251_1321524_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162900878.1|1321593_1321914_+	superinfection immunity protein	NA	A0A0S2SY85	Pseudomonas_phage	45.4	3.9e-17
WP_032421631.1|1321943_1322321_+	hypothetical protein	NA	A0A0M4QWT0	Salmonella_phage	44.7	1.1e-21
WP_004140789.1|1322615_1322942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073546849.1|1322949_1325748_+	tape measure protein	NA	A0A1B1W284	Salmonella_phage	32.4	7.7e-48
1330981:1330996	attR	GCGCTGCCGGGGATCC	NA	NA	NA	NA
>prophage 3
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	1333744	1368256	5497872	integrase,tail,terminase	Salmonella_phage(44.44%)	42	1334210:1334223	1338891:1338904
WP_032418525.1|1333744_1335211_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.5e-87
1334210:1334223	attL	AAAGAGCGTCTGGT	NA	NA	NA	NA
WP_004151979.1|1335278_1336856_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_032418526.1|1337047_1338301_+|integrase	site-specific integrase	integrase	A0A1X9TCT6	Enterobacter_phage	83.6	3.5e-202
WP_032418527.1|1338562_1339225_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	75.5	4.7e-97
1338891:1338904	attR	ACCAGACGCTCTTT	NA	NA	NA	NA
WP_032418529.1|1339221_1339824_-	adenine methylase	NA	A0A193GYV6	Enterobacter_phage	92.4	4.0e-103
WP_023285452.1|1339820_1340327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009485474.1|1340323_1340482_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	80.8	8.7e-18
WP_009485475.1|1340474_1340768_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	4.0e-32
WP_004144294.1|1340877_1341126_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_032418530.1|1341176_1342199_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	4.0e-180
WP_004144292.1|1342208_1343108_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	91.0	6.5e-158
WP_004164029.1|1343104_1343404_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1343400_1343550_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004144290.1|1343770_1344352_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	7.1e-65
WP_004152538.1|1344506_1344740_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1344886_1345096_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1345095_1345863_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_032418532.1|1345859_1346645_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.7	3.7e-133
WP_032418534.1|1346764_1347112_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	81.7	1.9e-49
WP_032419436.1|1347304_1347706_+	hypothetical protein	NA	A0A2H4N7F5	Pectobacterium_phage	51.6	8.7e-22
WP_025860565.1|1347777_1347987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418536.1|1347983_1348238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032419437.1|1348237_1348501_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	65.5	3.5e-27
WP_032418538.1|1349194_1349434_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	51.7	8.6e-09
WP_032418539.1|1349433_1349772_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	79.1	3.1e-44
WP_032418540.1|1349846_1350104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418541.1|1350181_1350766_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.6	9.9e-91
WP_032418542.1|1350762_1352238_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.4	2.4e-279
WP_032413826.1|1352280_1352652_-	phage family protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	93.5	6.8e-61
WP_004152472.1|1353449_1353653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004149313.1|1353656_1355336_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	59.3	3.6e-194
WP_004152470.1|1355332_1355638_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1355919_1356318_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004197367.1|1356330_1357338_+	bbp17	NA	T1S9H9	Salmonella_phage	92.8	2.1e-181
WP_004152466.1|1357347_1357740_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_024622837.1|1357732_1358011_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	1.1e-20
WP_004197381.1|1358059_1358671_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	9.2e-47
WP_032418543.1|1358670_1361148_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.4	2.3e-266
WP_032418545.1|1361149_1361620_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	9.5e-44
WP_025860587.1|1361612_1362110_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	41.7	8.9e-24
WP_032418548.1|1362122_1364867_+	bacteriophage protein	NA	A0A193GYI3	Enterobacter_phage	39.7	3.9e-97
WP_032418549.1|1364866_1368256_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	2.4e-120
>prophage 4
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	1790818	1799197	5497872		Enterobacteria_phage(28.57%)	8	NA	NA
WP_032418677.1|1790818_1792225_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	1.8e-37
WP_032418679.1|1792447_1793512_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	4.4e-105
WP_004175258.1|1793538_1794408_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	5.7e-111
WP_004175259.1|1794439_1795330_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	2.8e-28
WP_021313307.1|1795344_1795899_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.6	1.9e-51
WP_004175261.1|1796078_1797245_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_032409012.1|1797670_1797793_-	small membrane protein	NA	NA	NA	NA	NA
WP_004175262.1|1798192_1799197_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.8e-31
>prophage 5
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	1922431	2056500	5497872	capsid,integrase,holin,portal,head,plate,tRNA,protease,tail,terminase	Enterobacteria_phage(23.33%)	149	1975194:1975212	2012942:2012960
WP_000059623.1|1922431_1923694_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.3	4.8e-74
WP_002911729.1|1924261_1925179_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_032418726.1|1925285_1926236_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_064147810.1|1926314_1927256_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004141160.1|1927634_1928555_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002911718.1|1928695_1929085_+	RidA family protein	NA	NA	NA	NA	NA
WP_004227143.1|1929750_1930551_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_004184758.1|1930843_1931836_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_032418728.1|1931837_1932065_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	3.8e-30
WP_050598702.1|1932372_1933281_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	61.6	9.8e-45
WP_055314381.1|1933273_1934350_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	2.1e-147
WP_032418730.1|1934477_1935263_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.2	1.4e-60
WP_032418731.1|1935262_1935562_-	hypothetical protein	NA	K7PJS4	Enterobacterial_phage	46.7	3.8e-14
WP_032418732.1|1935649_1936567_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	36.9	3.1e-46
WP_016530207.1|1937013_1937673_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_016530206.1|1937765_1937963_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_004213338.1|1937988_1938450_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	88.2	1.7e-69
WP_001208720.1|1938687_1938867_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	73.1	4.6e-15
WP_032418734.1|1938856_1939825_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	66.4	1.0e-84
WP_032418735.1|1940030_1940855_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.5	2.6e-113
WP_032418736.1|1940864_1941242_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	72.8	3.3e-47
WP_032418737.1|1941254_1942235_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
WP_032418738.1|1942248_1942827_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	1.7e-50
WP_032418739.1|1942978_1943218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057182115.1|1943388_1943688_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	84.8	1.5e-39
WP_032418741.1|1943684_1944224_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	2.0e-101
WP_032418742.1|1944220_1944568_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	81.7	2.1e-40
WP_032418743.1|1944564_1944840_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	70.3	3.9e-05
WP_032418744.1|1944790_1944985_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	87.3	4.6e-21
WP_022065473.1|1945342_1945588_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	98.8	1.6e-34
WP_032419453.1|1946099_1946450_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.7	4.6e-51
WP_004884285.1|1946581_1947076_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	92.0	1.2e-81
WP_032418747.1|1947072_1948803_+|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	83.4	9.2e-302
WP_004899640.1|1948997_1950227_+|portal	phage portal protein	portal	U5P411	Shigella_phage	81.5	1.7e-201
WP_004884313.1|1950213_1950867_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.4	2.1e-105
WP_021313628.1|1950881_1952090_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	84.5	9.9e-194
WP_021313627.1|1952128_1952332_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	1.4e-07
WP_021313626.1|1952328_1952649_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	43.1	4.8e-15
WP_032408655.1|1952657_1952996_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_019705270.1|1952992_1953442_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|1953438_1953786_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_021313623.1|1953842_1954547_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	2.5e-80
WP_029497345.1|1954577_1954982_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	56.9	3.2e-32
WP_032418748.1|1954984_1955290_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.6	1.4e-27
WP_016530182.1|1955363_1955597_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_032418749.1|1955657_1959044_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
WP_023301979.1|1959064_1959538_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_021313618.1|1959524_1960010_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	3.0e-53
WP_021313617.1|1960019_1960400_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_032418750.1|1960396_1963480_+	kinase	NA	A0A286S259	Klebsiella_phage	71.9	0.0e+00
WP_032419560.1|1965977_1966268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057184564.1|1966322_1968032_-	hypothetical protein	NA	H6X4Y8	Enterobacteria_phage	37.0	1.2e-16
WP_032418751.1|1968164_1968743_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	93.4	2.2e-90
WP_004892499.1|1968793_1969216_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	44.5	1.8e-25
WP_004216505.1|1969627_1969867_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	54.4	7.5e-21
WP_032418752.1|1969869_1970196_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	53.9	1.6e-26
WP_002911596.1|1970799_1971945_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.7	1.1e-117
WP_004151461.1|1972483_1972765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002911594.1|1972807_1973515_+	phosphohydrolase	NA	S4W232	Pandoravirus	27.7	2.8e-07
WP_073546856.1|1973591_1974992_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.7	1.9e-100
WP_032419454.1|1974972_1975467_+	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	50.7	9.7e-31
1975194:1975212	attL	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_004184683.1|1975441_1976353_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_002911591.1|1976536_1977448_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_032418754.1|1977562_1979242_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	41.1	3.1e-20
WP_002911589.1|1979541_1979763_-	YodD family protein	NA	NA	NA	NA	NA
WP_002911586.1|1979896_1980088_+	protein DsrB	NA	NA	NA	NA	NA
WP_002911561.1|1980120_1980744_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_004189223.1|1981116_1981551_+	lipoprotein	NA	NA	NA	NA	NA
WP_004189225.1|1981592_1983080_-	alpha-amylase	NA	NA	NA	NA	NA
WP_004141135.1|1983280_1984081_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004180445.1|1984176_1985163_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_002911547.1|1985178_1985847_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_004151455.1|1985843_1986596_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.4	2.2e-26
WP_002911542.1|1986913_1987636_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_002911541.1|1987703_1987928_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_002911539.1|1988389_1989046_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_002911538.1|1989042_1990875_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002911537.1|1990932_1991481_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_032418755.1|1992054_1993062_-|integrase	tyrosine-type recombinase/integrase	integrase	Q1I119	Pasteurella_virus	56.5	1.3e-103
WP_050598706.1|1993058_1993925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032418756.1|1993941_1994571_-	membrane protein	NA	NA	NA	NA	NA
WP_077261143.1|1994580_1995009_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	38.5	1.0e-07
WP_032418759.1|1995281_1995485_+	hypothetical protein	NA	P79674	Haemophilus_phage	37.1	6.4e-05
WP_050598721.1|1995707_1995905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418760.1|1995921_1996320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418761.1|1996329_1996602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418762.1|1996670_1996895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418763.1|1996891_1997470_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	41.1	3.2e-33
WP_032418764.1|1997478_1997706_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	49.0	5.5e-05
WP_032418765.1|1997702_1997897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418766.1|1997889_1998843_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.3	3.6e-82
WP_162900880.1|1998842_1999016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156851987.1|1999026_1999182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032418767.1|1999157_2000174_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	55.1	1.9e-97
WP_032418768.1|2000166_2002761_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	1.2e-196
WP_032418769.1|2002957_2003959_+	trypsin-like peptidase domain-containing protein	NA	NA	NA	NA	NA
WP_032418771.1|2004694_2005741_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	5.8e-142
WP_032418772.1|2005740_2007462_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	66.2	6.2e-226
WP_032418773.1|2007622_2008456_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.6	1.1e-95
WP_032418774.1|2008480_2009530_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	55.0	5.7e-105
WP_032418775.1|2009577_2010477_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	77.0	3.5e-87
WP_032418776.1|2010579_2011077_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	71.5	1.2e-60
WP_032418777.1|2011076_2011277_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	6.7e-15
WP_032418778.1|2011267_2011549_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.1e-18
WP_032418779.1|2011545_2012097_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	41.3	9.2e-30
WP_050598707.1|2012093_2012489_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_032418780.1|2012633_2013092_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.1	6.2e-32
2012942:2012960	attR	TCTGTTTAAGGTGCCGGCC	NA	NA	NA	NA
WP_032418781.1|2013088_2013730_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	48.3	1.5e-44
WP_032418782.1|2013729_2014308_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	62.6	5.1e-63
WP_032418783.1|2014304_2014673_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	58.3	2.3e-29
WP_032418784.1|2014659_2015559_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.9	6.2e-92
WP_032418785.1|2015551_2016148_+|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	46.3	1.5e-41
WP_032418787.1|2019531_2020689_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	49.8	2.5e-45
WP_032418788.1|2020816_2021305_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	65.0	1.6e-49
WP_032418789.1|2021316_2024256_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	44.2	2.6e-208
WP_101972624.1|2024236_2024413_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	69.8	1.5e-10
WP_032418790.1|2024409_2024709_-	hypothetical protein	NA	B9A7B2	Serratia_phage	73.7	3.1e-32
WP_032418791.1|2024763_2025279_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	70.0	2.6e-63
WP_032418792.1|2025278_2026460_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	1.2e-156
WP_032418793.1|2026613_2027768_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.7	4.2e-178
WP_044785060.1|2027812_2028061_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_004180444.1|2028447_2029329_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_023316206.1|2029427_2030096_+	YecA family protein	NA	NA	NA	NA	NA
WP_004151453.1|2030120_2031332_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_004175410.1|2031523_2031763_+	YecH family protein	NA	NA	NA	NA	NA
WP_004141101.1|2031798_2032296_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_020956668.1|2032353_2032533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911524.1|2034396_2034648_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_002911522.1|2034685_2036197_-	MFS transporter	NA	NA	NA	NA	NA
WP_004148869.1|2036262_2036421_+	succinate dehydrogenase	NA	NA	NA	NA	NA
WP_004175413.1|2036491_2037001_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_160525722.1|2037435_2037534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002911518.1|2037895_2038876_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_032418795.1|2038938_2040453_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A2R8FG22	Brazilian_cedratvirus	30.0	4.1e-11
WP_002911507.1|2040467_2041448_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_002911505.1|2041609_2042398_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_004175414.1|2042372_2043797_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_002911500.1|2043820_2044249_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_002911499.1|2044602_2046186_+	MFS transporter	NA	NA	NA	NA	NA
WP_004184668.1|2046190_2047330_+	glycoside hydrolase family 105 protein	NA	NA	NA	NA	NA
WP_004151452.1|2047391_2049125_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.8	1.4e-87
WP_002911491.1|2049360_2049930_+	VOC family protein	NA	NA	NA	NA	NA
WP_032418796.1|2050006_2050750_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_023316208.1|2050831_2051836_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_002911486.1|2051832_2052576_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.1e-25
WP_002911484.1|2052615_2053011_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_002911483.1|2053063_2053882_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	82.7	1.1e-60
WP_004145564.1|2053878_2054445_-	hydrolase	NA	NA	NA	NA	NA
WP_002911479.1|2054712_2056500_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	27.2	1.3e-11
>prophage 6
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	2859661	2870548	5497872		Escherichia_phage(87.5%)	9	NA	NA
WP_032419001.1|2859661_2862769_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_032419002.1|2862823_2864089_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2864119_2865208_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004176262.1|2865294_2865555_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_001620095.1|2865852_2866713_+	class A broad-spectrum beta-lactamase SHV-1	NA	A0A077SL40	Escherichia_phage	99.7	4.4e-156
WP_002210513.1|2866733_2867495_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2867755_2868658_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004224682.1|2868669_2869935_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.8	7.8e-234
WP_002210516.1|2869927_2870548_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 7
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	3571172	3580646	5497872	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_023158537.1|3571172_3572894_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3572938_3573640_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3573993_3574212_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3574342_3576622_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3576652_3576970_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3577295_3577517_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_032419142.1|3577593_3579534_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3579530_3580646_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 8
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	4092316	4139961	5497872	terminase,holin,head	Cronobacter_phage(26.92%)	67	NA	NA
WP_032419291.1|4092316_4094794_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.3	2.6e-196
WP_032419292.1|4094780_4095176_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	54.8	3.6e-36
WP_032419293.1|4095172_4095643_-	hypothetical protein	NA	R9TPR6	Aeromonas_phage	40.4	9.6e-28
WP_032419294.1|4095642_4096119_-	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	48.4	8.7e-37
WP_072032582.1|4096232_4096496_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_023339093.1|4096475_4096655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419296.1|4096695_4100109_-	tape measure protein	NA	R9TMK1	Aeromonas_phage	50.0	6.0e-188
WP_050598715.1|4100174_4101203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023342743.1|4101277_4101490_-	hemolysin XhlA family protein	NA	H6WRV2	Salmonella_phage	58.8	1.0e-13
WP_032419298.1|4102052_4102526_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	26.5	5.0e-08
WP_124038561.1|4102494_4102692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419299.1|4102792_4103071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023297298.1|4103131_4103647_-	KilA-N domain-containing protein	NA	A0A1V0E5P7	Salmonella_phage	70.7	5.0e-62
WP_032419300.1|4103864_4104578_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	55.1	3.3e-64
WP_064767745.1|4104645_4105410_-	immunoglobulin domain-containing protein	NA	G0ZNE6	Cronobacter_phage	44.0	1.2e-40
WP_023341847.1|4105468_4105690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546890.1|4105692_4106076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546891.1|4106072_4106441_-	hypothetical protein	NA	F1C5E3	Cronobacter_phage	83.6	2.9e-48
WP_073546892.1|4106492_4107047_-	HNH endonuclease	NA	A0A2I7S010	Vibrio_phage	39.7	4.3e-35
WP_040229587.1|4107144_4107507_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	52.5	4.3e-28
WP_048336937.1|4107506_4107680_-	hypothetical protein	NA	I6R0P9	Salmonella_phage	54.4	4.1e-13
WP_073546893.1|4107679_4108060_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	1.8e-29
WP_064147788.1|4108062_4108365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012967727.1|4108374_4109472_-	hypothetical protein	NA	F1C5E1	Cronobacter_phage	73.6	3.2e-151
WP_047680691.1|4109483_4109915_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.1	1.8e-41
WP_047680688.1|4109918_4111304_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.2	2.7e-155
WP_047680685.1|4111316_4111499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159162401.1|4111563_4112151_-	HNH endonuclease	NA	A0A2I7S0H7	Vibrio_phage	43.9	1.5e-30
WP_073546894.1|4112250_4113255_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	66.0	1.8e-108
WP_032419309.1|4113181_4114651_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	56.1	1.2e-148
WP_032419310.1|4114663_4116136_-|terminase	terminase	terminase	A0A1W6JNY3	Morganella_phage	82.9	6.9e-250
WP_032419311.1|4116135_4116738_-	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	78.7	3.1e-79
WP_032419312.1|4117175_4117526_-	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	42.9	7.6e-14
WP_032419505.1|4117522_4118020_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	83.0	4.8e-78
WP_012542609.1|4117997_4118267_-|holin	holin	holin	K7P6H9	Enterobacteria_phage	78.3	2.8e-32
WP_032419313.1|4118486_4119026_-	HNH endonuclease	NA	A5PJ37	Escherichia_virus	46.1	2.1e-34
WP_032419314.1|4119463_4120153_-	antiterminator	NA	I6PDF8	Cronobacter_phage	56.2	6.7e-62
WP_009483890.1|4120149_4120290_-	YlcG family protein	NA	NA	NA	NA	NA
WP_032419315.1|4120286_4120925_-	recombination protein NinG	NA	H6WRY9	Salmonella_phage	68.4	7.0e-74
WP_032419316.1|4120917_4121586_-	metallophosphoesterase	NA	K7P6H8	Enterobacteria_phage	77.8	8.9e-104
WP_024264476.1|4121582_4121750_-	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	7.8e-09
WP_023283341.1|4121755_4122352_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	53.3	3.6e-56
WP_032419317.1|4122510_4122825_-	hypothetical protein	NA	A0A220NQY7	Salmonella_phage	35.6	3.4e-05
WP_009308003.1|4123929_4124106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419318.1|4124105_4124435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032419320.1|4125122_4125347_-	hypothetical protein	NA	H9C169	Pectobacterium_phage	51.5	8.3e-14
WP_032419321.1|4125343_4125637_-	protein ren	NA	O48423	Enterobacteria_phage	66.7	1.5e-26
WP_073546926.1|4125636_4127052_-	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.3	6.3e-184
WP_073546927.1|4127056_4127908_-	DNA replication protein	NA	F1C5C3	Cronobacter_phage	56.0	5.9e-84
WP_032419324.1|4127948_4128095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001548453.1|4128180_4128402_-	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_001548452.1|4128481_4128673_-	hypothetical protein	NA	A0A2R2Z333	Escherichia_phage	55.4	2.4e-09
WP_032419325.1|4128777_4129488_+	helix-turn-helix domain-containing protein	NA	K7P8B2	Enterobacteria_phage	70.6	3.7e-92
WP_004191592.1|4129860_4130916_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	68.8	1.1e-140
WP_032419508.1|4131104_4131308_-	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	70.1	4.5e-19
WP_004219883.1|4131617_4131743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008807814.1|4131735_4131942_+	phage encoded cell division inhibitor protein	NA	A0A0M4S6W3	Salmonella_phage	94.1	1.4e-31
WP_016529276.1|4132022_4132307_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	8.6e-40
WP_014342891.1|4132716_4133052_+	hypothetical protein	NA	A0A0F7L7F5	uncultured_marine_virus	34.3	1.3e-10
WP_032419327.1|4133048_4133672_+	YqaJ viral recombinase family protein	NA	S0A2A9	Cellulophaga_phage	48.6	6.1e-46
WP_032419328.1|4133668_4134097_+	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	81.0	5.8e-64
WP_032419329.1|4134093_4134750_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.1e-113
WP_032419330.1|4134746_4135883_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	73.1	7.4e-159
WP_032419331.1|4136098_4136371_+	hypothetical protein	NA	Q716F1	Shigella_phage	63.5	3.7e-24
WP_032419332.1|4136367_4137072_+	hypothetical protein	NA	A0A1W6JP46	Morganella_phage	34.3	1.0e-25
WP_072032585.1|4137287_4137623_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004143017.1|4139094_4139961_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
>prophage 9
NZ_CP018447	Klebsiella pneumoniae strain Kp_Goe_33208 chromosome, complete genome	5497872	5115507	5158454	5497872	terminase,capsid,integrase,head,portal,plate,holin,protease,tail,tRNA	Shigella_phage(48.21%)	59	5111016:5111032	5147010:5147026
5111016:5111032	attL	ACCAGCTGCGCGATCAG	NA	NA	NA	NA
WP_002884942.1|5115507_5116923_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.8	5.7e-201
WP_002884941.1|5117092_5118076_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_032418204.1|5118258_5118501_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_087835996.1|5118640_5119678_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001514812.1|5119766_5120864_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.4e-210
WP_001514811.1|5120925_5121174_+	DinI family protein	NA	K7PLW4	Enterobacteria_phage	98.8	3.1e-38
WP_073546902.1|5121274_5121664_-	DNA polymerase V	NA	K7P6F7	Enterobacteria_phage	91.4	2.6e-63
WP_136473586.1|5121858_5123361_+	hypothetical protein	NA	E5AGC8	Erwinia_phage	34.6	3.2e-69
WP_073546904.1|5123397_5123802_-|tail	tail fiber assembly protein	tail	F1BUK2	Cronobacter_phage	42.0	1.1e-11
WP_073546905.1|5123801_5124764_-	hypothetical protein	NA	U5P0I1	Shigella_phage	82.8	8.7e-52
WP_052924723.1|5124767_5125352_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	1.8e-113
WP_073546906.1|5125342_5126401_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	1.6e-200
WP_000424732.1|5126387_5126813_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_073546907.1|5126812_5127361_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.3	1.6e-95
WP_000999511.1|5127360_5128440_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_000219913.1|5128436_5129765_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.3	8.4e-247
WP_001514801.1|5129828_5130206_-	PH domain-containing protein	NA	A5GZ63	Lactococcus_phage	35.6	2.3e-08
WP_073546908.1|5130258_5132094_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	98.5	1.2e-304
WP_000661054.1|5132235_5132505_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|5132504_5132861_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_073546909.1|5132860_5134357_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	8.5e-272
WP_000497751.1|5134340_5134511_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779292.1|5134519_5135080_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|5135076_5135583_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_073546910.1|5135557_5135968_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	97.1	2.5e-72
WP_000927710.1|5135964_5136288_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	100.0	5.1e-57
WP_073546911.1|5136290_5136491_-	hypothetical protein	NA	S5FNU1	Shigella_phage	93.9	4.2e-25
WP_073546912.1|5136540_5137746_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	2.7e-223
WP_001193632.1|5137760_5138411_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_032252663.1|5138388_5139630_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	1.3e-241
WP_000605606.1|5139629_5139812_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_021519685.1|5139823_5141557_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.4	0.0e+00
WP_073546913.1|5141553_5142048_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	5.1e-88
WP_053287456.1|5142173_5142524_-	HNH endonuclease	NA	U5P4L6	Shigella_phage	94.8	8.3e-61
WP_052874970.1|5142707_5143100_-	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	86.9	8.4e-54
WP_016244989.1|5143083_5143560_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	2.4e-87
WP_001120502.1|5143563_5143899_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_000799659.1|5143975_5145028_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_001547994.1|5145634_5146387_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_016236817.1|5146400_5147390_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	6.2e-194
5147010:5147026	attR	CTGATCGCGCAGCTGGT	NA	NA	NA	NA
WP_001061444.1|5147397_5148207_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767148.1|5148226_5148616_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	96.9	5.1e-67
WP_000210152.1|5148612_5148939_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.3e-52
WP_001433188.1|5148935_5149589_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_110109894.1|5149588_5150083_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.1e-85
WP_000104943.1|5150079_5151021_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	4.9e-140
WP_001250269.1|5151010_5151190_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000514174.1|5151365_5151950_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	5.5e-57
WP_001231956.1|5151977_5152175_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|5152270_5152924_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_073546915.1|5153157_5153433_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	96.7	1.2e-46
WP_001323604.1|5154015_5154396_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	1.3e-62
WP_052870285.1|5154461_5155286_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	3.9e-149
WP_000008210.1|5155413_5155950_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	9.7e-101
WP_001565177.1|5155940_5156303_+	phage protein	NA	U5P092	Shigella_phage	97.5	1.5e-65
WP_073546918.1|5156302_5157112_+	hypothetical protein	NA	Q8HAA7	Salmonella_phage	61.4	7.3e-76
WP_073546919.1|5157111_5157684_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.3	4.0e-105
WP_001093909.1|5157720_5157993_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	86.7	5.9e-38
WP_000549966.1|5158019_5158454_-	type II toxin-antitoxin system YafO family toxin	NA	A0A0S2SYH1	Pseudomonas_phage	51.0	5.2e-36
>prophage 1
NZ_CP018448	Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-1, complete sequence	90685	4548	72078	90685	integrase,transposase	Escherichia_phage(33.33%)	71	6274:6333	78982:79803
WP_000227969.1|4548_5625_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
6274:6333	attL	CGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCT	NA	NA	NA	NA
WP_001067855.1|6337_7042_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000842134.1|7531_8641_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	2.8e-33
WP_001039466.1|8735_9920_-	tetracycline efflux MFS transporter Tet(D)	NA	NA	NA	NA	NA
WP_023352616.1|10015_10624_+	tetracycline resistance transcriptional repressor TetR(D)	NA	NA	NA	NA	NA
WP_001067855.1|10670_11375_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001039463.1|12137_12524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000861580.1|12532_12724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|13735_14491_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_011977766.1|15908_16244_-	C2H2-type zinc finger protein	NA	NA	NA	NA	NA
WP_001568067.1|16416_16698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000176305.1|16751_17363_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_011977825.1|17359_17521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|17547_18540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000075580.1|18588_18744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|18884_19589_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001137892.1|19644_20229_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|20228_21467_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|21463_22369_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|22490_23195_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000993386.1|23267_23504_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|23539_24208_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|26118_26979_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000722315.1|27678_28503_-	oxacillin-hydrolyzing class D beta-lactamase OXA-9	NA	NA	NA	NA	NA
WP_001206315.1|28562_29351_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|29443_30703_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|30964_31756_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|31813_32422_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|32517_33360_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|33526_34540_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|34742_35093_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|35268_35829_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000027057.1|38234_39095_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|39277_39835_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_004152334.1|42302_43013_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001044770.1|43086_43503_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_001261282.1|43499_43730_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_072202616.1|43686_44148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|44291_44642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000129823.1|44692_45436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|45432_46209_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000764642.1|46266_46524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032409716.1|46652_46757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|47291_48158_+	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_000339857.1|48514_48784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000368714.1|49198_50404_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000064120.1|50403_51378_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.4	2.6e-88
WP_004118291.1|51459_52731_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.3	4.9e-151
WP_000776034.1|52730_53162_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_004178082.1|53567_55055_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001776122.1|55524_56490_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.7	1.6e-58
WP_001776120.1|56969_57401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001776119.1|57433_57961_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	39.5	5.7e-21
WP_001166628.1|58220_58676_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004200999.1|58747_59113_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|59128_59404_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|59431_59857_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|59895_61581_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|61598_61964_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|61960_62197_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001067855.1|62307_63012_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071549088.1|63036_63549_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|63553_63760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|64171_65575_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|65608_66823_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|67083_67848_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|67990_68257_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|68477_68951_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_000845048.1|69106_70120_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|70854_71559_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032441643.1|71598_72078_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.1	3.0e-77
78982:79803	attR	AGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCGCCAGTCGAGCGTCAGCGCGCGTGTGAAAGCGCTGGAGGATAACCTTGGTGTCCTGCTATTTGAGCGCCATGCGCGGGGCGTTCGGCTAACAGACGCAGGCAGGCACTTCATGGAGCGTGTCACGGCGGGTGTCGATCAACTCGATCACGCAGTGAAGACCGCGGAGTGACGGGCACTGGCTGGCAATGTCTAGCAACGGCAGGCATTTCGGCTGAGGGTAAAAGAACTTTCCGCTAAGCGATAGACTGTATGTAAACACAGTATTGCAAGGACGCGGAACATGCCTCATGTGGCGGCCAGGACGGCCAGCCGGGATCGGGATACTGGTCGTTACCAGAGCCACCGACCCGAGCAAACCCTTCTCTATCAGATCGTTGACGAGTATTACCCGGCATTCGCTGCGCTTATGGCAGAGCAGGGAAAGGAATTGCCGGGCTATGTGCAACGGGAATTTGAAGAATTTCTCCAATGCGGGCGGCTGGAGCATGGCTTTCTACGGGTTCGCTGCGAGTCTTGCCACGCCGAGCACCTGGTCGCTTTCAGCTGTAAGCGTCGCGGTTTCTGCCCGAGCTGTGGGGCGCGGCGGATGGCCGAAAGTGCCGCCTTGCTGGTTGATGAAGTACTGCCTGAACAACCCATGCGTCAGTGGGTGTTGAGCTTCCCGTTTCAGCTGCGTTTCCTGTTTGCCAGCCGGCCCGAGATCATGGGGTGGGTGCTGGGCATCGTTTACCGCGTCATTGCCACGCACCTGGTCAAGAAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP018449	Klebsiella pneumoniae strain Kp_Goe_33208 plasmid pKp_Goe_208-2, complete sequence	67101	4625	38012	67101	integrase,transposase	Morganella_phage(11.76%)	44	14022:14040	39145:39163
WP_011790968.1|4625_5876_+|transposase	IS4-like element IS10A family transposase	transposase	Q9E8P4	Bluetongue_virus	71.4	4.2e-171
WP_004187429.1|6207_6465_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_020277900.1|6433_6799_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187425.1|6891_7326_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_019725070.1|7313_8579_+	translesion error-prone DNA polymerase V subunit UmuC	NA	A0A1W6JNT0	Morganella_phage	50.4	2.6e-112
WP_004187413.1|8701_8911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|8913_9132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206893.1|9176_9860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021526647.1|9856_10129_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_047731887.1|10146_11421_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_015586034.1|11948_12305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|12282_12861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206898.1|12862_13270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|13422_13968_-	hypothetical protein	NA	NA	NA	NA	NA
14022:14040	attL	TGTTCAAATATGAACATTT	NA	NA	NA	NA
WP_015586036.1|14108_14570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187394.1|14566_14815_+	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004206901.1|14807_15395_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187390.1|15391_15877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020316874.1|15918_16122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187383.1|16140_16881_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_011091047.1|17121_18096_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	52.0	6.1e-85
WP_004206904.1|18098_18542_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_004187378.1|18551_19115_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	31.3	5.2e-20
WP_004206905.1|19493_19739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206906.1|19731_20211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206907.1|20239_20650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052170007.1|20798_21209_+	Mov34/MPN/PAD-1 family protein	NA	NA	NA	NA	NA
WP_004187367.1|21253_21520_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004187364.1|22196_22376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206911.1|22448_23309_+	DUF4942 domain-containing protein	NA	I6RTT5	Marinomonas_phage	29.9	2.8e-17
WP_001617865.1|23866_24742_-	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_001067855.1|24975_25680_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077270329.1|25715_26258_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.7	1.2e-29
WP_001082319.1|26323_27127_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_015586041.1|27354_28134_+	APH(3')-VI family aminoglycoside O-phosphotransferase	NA	E4ZFP6	Streptococcus_phage	35.1	1.1e-31
WP_015586042.1|28788_29490_-|transposase	IS1-like element ISPa14 family transposase	transposase	A0A218MNG1	uncultured_virus	55.0	9.9e-37
WP_001082319.1|29605_30409_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001067855.1|30826_31531_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_085950818.1|32438_33559_-|transposase	IS3-like element ISSen4 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_073546935.1|33644_33917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014839983.1|34235_34850_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.4	8.1e-35
WP_012477564.1|35284_35875_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|36011_36584_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_073546936.1|36620_38012_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
39145:39163	attR	AAATGTTCATATTTGAACA	NA	NA	NA	NA
