The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018458	Klebsiella pneumoniae strain Kp_Goe_39795 chromosome, complete genome	5330835	443114	522248	5330835	tail,head,capsid,protease,tRNA,terminase,integrase,portal	uncultured_Caudovirales_phage(69.57%)	80	440018:440034	473094:473110
440018:440034	attL	CATCACCACAGCCGGGA	NA	NA	NA	NA
WP_004150007.1|443114_444062_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_004174081.1|444076_444586_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_002919139.1|444714_445839_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|445810_446284_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|446310_446853_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|446857_447430_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_004181437.1|447433_448252_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|448248_448506_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|448481_449036_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|455007_455229_-	membrane protein	NA	NA	NA	NA	NA
WP_004144975.1|455521_458632_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|458644_459784_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|460162_460813_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
WP_073578730.1|461092_462316_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	97.1	2.5e-237
WP_073578731.1|462312_463158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032435325.1|463270_463480_+	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	97.1	6.3e-32
WP_023304529.1|464096_464309_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	5.3e-10
WP_048288912.1|464301_464487_+	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	95.1	1.1e-22
WP_048288911.1|464479_464707_+	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	87.8	1.0e-27
WP_014072026.1|464703_465072_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
WP_023304525.1|465068_466433_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	5.8e-259
WP_032673054.1|466647_466908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073578732.1|466940_467453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073578733.1|467730_468894_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	93.8	2.8e-201
WP_073578734.1|468945_469506_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	93.5	1.4e-97
WP_073578735.1|469507_470743_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	91.7	8.5e-225
WP_004857971.1|470739_471078_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	92.0	3.6e-53
WP_004857973.1|471074_471368_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	91.8	3.4e-47
WP_004857975.1|471367_471811_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	8.6e-79
WP_004857976.1|471803_471956_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	92.0	6.4e-18
WP_004857981.1|472085_472442_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	3.0e-50
WP_073578736.1|472425_474087_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	93.7	2.1e-311
473094:473110	attR	CATCACCACAGCCGGGA	NA	NA	NA	NA
WP_073578737.1|474100_477508_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.6	5.6e-186
WP_073578738.1|477563_477755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462905.1|477877_478174_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004144972.1|478198_479164_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002918745.1|479521_480403_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004181435.1|480414_481866_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918740.1|481855_482098_-	YhdT family protein	NA	NA	NA	NA	NA
WP_002918738.1|482208_483558_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918736.1|483568_484036_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_020325264.1|484058_484511_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_020325267.1|484734_485343_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_004174108.1|485342_486344_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_020325272.1|486572_486764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918686.1|486843_488784_+	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918653.1|489089_490133_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_004149974.1|490203_491196_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918648.1|491195_491684_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002918646.1|491691_492273_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918644.1|492275_493745_+	ribonuclease G	NA	NA	NA	NA	NA
WP_020325269.1|493782_497580_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_020325261.1|497668_499114_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_002918641.1|499149_500079_-	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918640.1|500210_500414_+	AaeX family protein	NA	NA	NA	NA	NA
WP_002918639.1|500421_501354_+	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918632.1|501359_503327_+	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918629.1|503406_503682_+	barstar family protein	NA	NA	NA	NA	NA
WP_022631430.1|503732_503999_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_004889568.1|504097_504361_-	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918625.1|504736_505207_-	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918570.1|505621_506560_+	malate dehydrogenase	NA	NA	NA	NA	NA
WP_004181430.1|506690_507320_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004181429.1|507306_507972_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020325273.1|508183_509452_+	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.7	8.0e-61
WP_004181427.1|509484_510384_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_004181426.1|510383_511001_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_004181425.1|511142_511394_+	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_073578739.1|511409_513182_+	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_004181423.1|513197_514499_+	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_004181422.1|514558_515269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918568.1|515294_516353_-	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_004174125.1|516440_517808_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918565.1|517981_518380_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004144945.1|518570_519698_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918559.1|519963_520392_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_000829818.1|520407_520800_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_135801240.1|520857_521142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002918467.1|521111_521750_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_002918465.1|521753_522248_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
>prophage 2
NZ_CP018458	Klebsiella pneumoniae strain Kp_Goe_39795 chromosome, complete genome	5330835	1317968	1363048	5330835	transposase,tail,head,capsid,tRNA,terminase,integrase,plate,portal,lysis	Salmonella_phage(88.1%)	58	1315642:1315688	1351674:1351720
1315642:1315688	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_022631381.1|1317968_1318982_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.5	8.5e-191
WP_031281027.1|1318984_1319614_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.1	3.9e-61
WP_000102106.1|1319736_1319979_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	98.8	2.3e-38
WP_020806226.1|1320011_1320521_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_019704179.1|1320528_1320729_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	84.6	1.3e-26
WP_020806228.1|1320692_1321034_+	DUF5347 domain-containing protein	NA	A0A1S6L019	Salmonella_phage	86.7	8.4e-50
WP_020323984.1|1321101_1321335_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	1.3e-30
WP_020324003.1|1321334_1321562_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	89.3	1.2e-33
WP_020324002.1|1321558_1322416_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	71.2	3.4e-116
WP_020324017.1|1322412_1324827_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	88.4	0.0e+00
WP_020324007.1|1324980_1325169_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	9.4e-27
WP_020323998.1|1325179_1325413_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	88.3	2.4e-32
WP_020323985.1|1325699_1325918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324001.1|1325917_1326760_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.5	1.0e-59
WP_004176137.1|1327368_1328400_-|transposase	IS630-like element ISEc33 family transposase	transposase	NA	NA	NA	NA
WP_020323991.1|1329598_1330633_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	2.7e-176
WP_019704191.1|1330632_1332396_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	93.0	0.0e+00
WP_020323980.1|1332536_1333370_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	76.5	1.5e-103
WP_020324020.1|1333386_1334451_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	94.6	1.5e-185
WP_004185715.1|1334454_1335105_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	86.1	3.6e-102
WP_020323987.1|1335201_1335666_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	86.4	1.0e-74
WP_004144701.1|1335665_1335869_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	88.1	1.7e-29
WP_004144702.1|1335872_1336088_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	1.0e-29
WP_020323999.1|1336068_1336578_+	lysozyme	NA	E5G6N1	Salmonella_phage	84.0	1.2e-81
WP_020323982.1|1336582_1336966_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	44.5	1.2e-17
WP_020323995.1|1336962_1337391_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	79.4	7.3e-51
WP_073578772.1|1337365_1337524_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	71.2	7.6e-14
WP_002896172.1|1337486_1337918_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_020323986.1|1337910_1338357_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	73.0	2.5e-54
WP_020323981.1|1338425_1338998_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.8	1.6e-77
WP_020323996.1|1338994_1339357_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	83.9	2.9e-48
WP_020324006.1|1339343_1340252_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	67.9	4.9e-105
WP_031281025.1|1340241_1340838_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	61.3	4.3e-57
WP_020323992.1|1340843_1342952_+	hypothetical protein	NA	A0A1J0MGQ6	Serratia_phage	39.6	7.4e-112
WP_020324004.1|1342952_1343171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020324016.1|1343198_1344362_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	54.3	2.6e-50
WP_020323990.1|1344509_1345682_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.1	9.5e-210
WP_002896201.1|1345691_1346207_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_020324018.1|1346259_1346559_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	2.8e-33
WP_002896220.1|1346573_1346693_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_073578773.1|1346919_1349313_+|tail	phage tail tape measure protein	tail	A0A2H4JGB2	uncultured_Caudovirales_phage	39.2	3.1e-106
WP_020323988.1|1349309_1349795_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	77.0	9.1e-58
WP_020323978.1|1349791_1350889_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	84.7	1.6e-174
WP_022631378.1|1350955_1351174_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.1e-26
WP_022631377.1|1351201_1351579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1352182_1352665_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1351674:1351720	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_031281023.1|1352775_1353252_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_004145682.1|1353241_1353532_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1353598_1353940_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004180954.1|1354087_1355749_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1355835_1356714_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1356838_1357429_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1357548_1358835_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1358854_1359646_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1359809_1361174_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1361433_1361682_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004180952.1|1361700_1362249_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1362280_1363048_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP018458	Klebsiella pneumoniae strain Kp_Goe_39795 chromosome, complete genome	5330835	1927031	1961653	5330835	tail,head,holin,protease,capsid,terminase,integrase,portal	Enterobacteria_phage(21.43%)	50	1926858:1926917	1966347:1966410
1926858:1926917	attL	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGC	NA	NA	NA	NA
WP_004184758.1|1927031_1928024_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	87.2	4.9e-175
WP_032408630.1|1928025_1928253_-	DUF4224 domain-containing protein	NA	Q8HAA9	Salmonella_phage	78.4	2.4e-29
WP_032408631.1|1929159_1929387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408632.1|1929386_1929710_-	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_032408633.1|1929816_1930077_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	73.2	2.4e-28
WP_048293822.1|1930073_1930586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032408634.1|1930582_1931368_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	51.0	2.6e-62
WP_032408635.1|1931367_1931667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016530207.1|1932213_1932873_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	62.7	7.3e-74
WP_016530206.1|1932965_1933163_+	Cro/Cl family transcriptional regulator	NA	H9C161	Pectobacterium_phage	66.1	2.7e-16
WP_000230161.1|1933188_1933650_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_071557781.1|1933887_1934100_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_032408637.1|1934056_1934971_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	57.3	2.4e-30
WP_032408638.1|1934967_1935777_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	68.5	6.5e-109
WP_000779146.1|1935786_1936164_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_032408639.1|1936176_1937157_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.6	4.6e-133
WP_004899672.1|1937170_1937749_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	7.6e-51
WP_032408641.1|1937900_1938140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|1938305_1938692_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_072000523.1|1938678_1938960_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	46.2	7.7e-17
WP_032408642.1|1938959_1939589_+	glycoside hydrolase family 19 protein	NA	F1C591	Cronobacter_phage	75.4	4.2e-87
WP_032408643.1|1939591_1939867_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	70.8	1.3e-24
WP_032408644.1|1939817_1940015_+	hypothetical protein	NA	A0A286SGR9	Klebsiella_phage	90.2	7.0e-25
WP_032408645.1|1940085_1940574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408646.1|1940660_1941044_+	hypothetical protein	NA	Q6UAR9	Klebsiella_phage	94.5	5.2e-64
WP_032408647.1|1941110_1941347_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	94.9	1.6e-31
WP_004899651.1|1941427_1941631_+	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_004899648.1|1941713_1941947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004899645.1|1941934_1942285_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	81.0	3.2e-52
WP_032408649.1|1942441_1942939_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	72.1	1.1e-61
WP_032408650.1|1942938_1944696_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	91.1	0.0e+00
WP_032408651.1|1944706_1944892_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	61.7	6.2e-15
WP_032408652.1|1944891_1946121_+|portal	phage portal protein	portal	U5P411	Shigella_phage	82.4	8.2e-204
WP_032408653.1|1946107_1946761_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	87.9	7.1e-106
WP_004884302.1|1946775_1947984_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	84.8	2.2e-193
WP_023302596.1|1948022_1948226_+	hypothetical protein	NA	M1FN89	Enterobacteria_phage	42.4	2.3e-07
WP_032408654.1|1948222_1948543_+|head,tail	phage gp6-like head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	39.8	1.7e-15
WP_032408655.1|1948551_1948890_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	74.1	1.4e-41
WP_032408656.1|1948886_1949336_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	81.9	9.7e-62
WP_032408657.1|1949332_1949680_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	62.8	8.0e-32
WP_032408658.1|1949736_1950441_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.5	1.6e-79
WP_021313622.1|1950471_1950876_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_032408659.1|1950878_1951184_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	64.6	8.1e-28
WP_073578752.1|1951257_1951491_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.4e-08
WP_032408660.1|1951551_1954941_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.7	1.6e-302
WP_004177132.1|1954961_1955435_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	62.1	1.4e-55
WP_004864228.1|1955421_1955898_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	65.8	4.8e-51
WP_032408661.1|1955910_1956291_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	84.1	5.3e-61
WP_032408662.1|1956287_1959365_+	kinase	NA	A0A286S259	Klebsiella_phage	62.0	0.0e+00
WP_032408663.1|1959442_1961653_+	hypothetical protein	NA	B5TAB2	Burkholderia_phage	45.5	3.7e-98
1966347:1966410	attR	CGGTCTCGAAAACCGGAGTAGGGGCAACTCTACCGGGGGTTCAAATCCCCCTCTCTCCGCCACT	NA	NA	NA	NA
>prophage 4
NZ_CP018458	Klebsiella pneumoniae strain Kp_Goe_39795 chromosome, complete genome	5330835	2844906	2855793	5330835		Escherichia_phage(87.5%)	9	NA	NA
WP_004179756.1|2844906_2848014_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2848068_2849334_+	MFS transporter	NA	NA	NA	NA	NA
WP_004179755.1|2849364_2850453_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	3.0e-210
WP_004176262.1|2850539_2850800_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_004179754.1|2851097_2851958_+	class A beta-lactamase SHV-28	NA	A0A077SL40	Escherichia_phage	99.3	1.7e-155
WP_002210513.1|2851978_2852740_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2853000_2853903_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004179748.1|2853914_2855180_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.3	1.1e-232
WP_002210516.1|2855172_2855793_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP018458	Klebsiella pneumoniae strain Kp_Goe_39795 chromosome, complete genome	5330835	3521135	3530598	5330835	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_020323882.1|3521135_3522857_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	2.0e-14
WP_002898014.1|3522901_3523603_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3523956_3524175_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3524294_3526574_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3526604_3526922_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3527247_3527469_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3527545_3529486_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3529482_3530598_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP018460	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence	232181	592	61582	232181	integrase,transposase	Escherichia_phage(28.0%)	55	23379:23393	34107:34121
WP_078310596.1|592_790_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q716C2	Shigella_phage	57.4	1.2e-11
WP_013851373.1|1153_1795_-	tetracycline resistance transcriptional repressor TetR	NA	NA	NA	NA	NA
WP_031942321.1|1922_3122_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_013851371.1|3636_4140_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_001067855.1|4176_4881_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071886840.1|4939_5407_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|5411_5618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072094655.1|6029_7433_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|7466_8681_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001067855.1|9469_10174_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|10317_10872_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|11002_11833_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|12464_13169_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000557452.1|13275_14136_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_002063889.1|14148_14691_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001067855.1|15884_16589_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|18910_19243_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|19289_20165_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|20420_21683_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|22246_22804_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|22986_23847_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
23379:23393	attL	TGCTGCCAACTTACT	NA	NA	NA	NA
WP_000480968.1|24567_25404_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|25403_26207_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_001043260.1|26267_27083_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|27412_27589_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_000427619.1|27770_28775_-|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|30505_31210_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845039.1|31280_32294_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_046622360.1|32439_33231_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_031942326.1|34349_35024_+	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	2.5e-130
34107:34121	attR	AGTAAGTTGGCAGCA	NA	NA	NA	NA
WP_000723070.1|37203_37638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572377.1|37895_39011_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019951.1|39133_39406_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000193209.1|39871_40690_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|40686_41892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|42171_43491_-	DUF1173 family protein	NA	NA	NA	NA	NA
WP_000220758.1|43513_43681_-	hypothetical protein	NA	A0A2D2W2Z9	Escherichia_phage	50.9	7.3e-07
WP_000833382.1|43741_45169_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_031942328.1|45383_45899_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975181.1|45901_46798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005009.1|46845_47160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000637193.1|47233_47491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001371914.1|48477_48675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000864986.1|48815_49091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000927306.1|49582_51061_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.4	7.3e-199
WP_001066652.1|51079_51907_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	37.2	4.9e-43
WP_000065802.1|51966_52392_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.6e-50
WP_000922628.1|52404_53694_-	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	71.4	9.9e-168
WP_000941305.1|53739_54060_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	53.7	1.7e-20
WP_000130816.1|54146_54851_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.9	8.8e-86
WP_000125668.1|54883_56287_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_016239970.1|57405_57846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000482601.1|57998_59360_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_000589340.1|59373_60177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|60235_61582_-|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018460	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence	232181	79005	140717	232181	integrase,holin,transposase	Bacillus_phage(17.39%)	51	102599:102615	133660:133676
WP_000080200.1|79005_80619_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_073578784.1|80645_81020_-	copper-binding protein	NA	NA	NA	NA	NA
WP_004152084.1|81236_82637_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|82633_83314_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004118344.1|83368_84298_-	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_000025662.1|84302_84683_-	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_001378118.1|84722_85613_-	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000925242.1|85618_87436_-	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001023257.1|87669_88119_+	copper resistance protein	NA	NA	NA	NA	NA
WP_004118669.1|88407_89145_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|89178_89376_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|89416_91864_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|91990_92431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|92517_95664_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_004152079.1|95674_96967_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246153.1|97080_97434_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|97462_98848_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001572351.1|99037_99718_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|99710_101186_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|101436_101868_+	silver-binding protein SilE	NA	NA	NA	NA	NA
102599:102615	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_085955172.1|103296_104503_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_073578786.1|105543_107541_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_004152070.1|107603_108881_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_080895248.1|109863_111300_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004197688.1|111919_112177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011977741.1|112849_113818_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_071527918.1|113837_114149_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152065.1|114175_115123_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|116266_117007_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|117723_118734_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|119485_120652_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|120651_121623_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|124574_125846_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|125845_126271_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004178082.1|126673_128161_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|128394_128625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|129145_129571_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|129807_130062_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118473.1|130096_130414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|131195_131423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198570.1|131514_131745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178068.1|131796_133152_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004152645.1|133199_133763_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
133660:133676	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
WP_004152644.1|134538_135081_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|135129_135378_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|135447_137484_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
WP_004152641.1|137550_137982_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004152640.1|137978_138707_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152639.1|138703_139030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152638.1|139085_139460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004220208.1|139637_140717_-|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018460	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-1, complete sequence	232181	183623	226794	232181	bacteriocin,transposase,protease	Salmonella_phage(28.57%)	37	NA	NA
WP_004178051.1|183623_185945_+|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
WP_004152296.1|185946_186225_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_009485932.1|186565_187045_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004199332.1|187365_187644_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_004171457.1|187860_187938_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004152292.1|187930_188788_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000093087.1|190234_192430_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_004152291.1|192426_193743_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_004152290.1|193746_196056_-	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003846917.1|197761_199015_-	lactose permease	NA	NA	NA	NA	NA
WP_004152287.1|199066_202141_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|202262_203345_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|203805_204816_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_000427614.1|205219_206224_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_001247892.1|206668_206959_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|206955_207357_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|207346_207703_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003100858.1|207957_208284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100856.1|208280_208781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021243030.1|208777_209149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003100847.1|209142_209700_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
WP_000427623.1|209778_210783_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000211823.1|212721_213708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|214628_215021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000462754.1|215679_216336_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_000340139.1|216538_217036_+	membrane protein	NA	NA	NA	NA	NA
WP_000083579.1|217040_218429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012477377.1|218829_219123_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088044.1|219127_220453_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|220513_220720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985909.1|220820_221231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001641519.1|221243_222059_+	HNH endonuclease	NA	G0X580	Salmonella_phage	37.2	2.5e-15
WP_000278471.1|222311_222737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224686.1|223285_223594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|223609_224467_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_001287391.1|225073_225478_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000019450.1|225813_226794_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	1.8e-185
>prophage 1
NZ_CP018462	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-3, complete sequence	32942	0	5142	32942		Escherichia_phage(50.0%)	6	NA	NA
WP_071557810.1|274_415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|2222_2504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|2626_2977_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000959884.1|2979_3942_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	53.9	4.1e-94
WP_032146011.1|4088_4382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|4458_5142_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
>prophage 2
NZ_CP018462	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-3, complete sequence	32942	10866	12806	32942		Thalassomonas_phage(50.0%)	2	NA	NA
WP_001298559.1|10866_11430_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000290834.1|12278_12806_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
>prophage 3
NZ_CP018462	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-3, complete sequence	32942	17887	18349	32942		Moraxella_phage(100.0%)	1	NA	NA
WP_001233838.1|17887_18349_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
>prophage 4
NZ_CP018462	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-3, complete sequence	32942	23300	26898	32942	transposase	Salmonella_phage(50.0%)	2	NA	NA
WP_001553819.1|23300_26198_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|26292_26898_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
>prophage 1
NZ_CP018459	Klebsiella pneumoniae strain Kp_Goe_39795 plasmid pKp_Goe_795-4, complete sequence	16971	2619	16687	16971	tail,integrase,capsid,terminase	uncultured_Caudovirales_phage(91.67%)	16	2982:2995	16165:16178
WP_073578733.1|2619_3783_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	93.8	2.8e-201
2982:2995	attL	ATTTGGCTTTCAGC	NA	NA	NA	NA
WP_073578732.1|4060_4573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032673054.1|4605_4866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023304525.1|5080_6445_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	97.1	5.8e-259
WP_014072026.1|6441_6810_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	98.4	1.8e-61
WP_048288911.1|6806_7034_-	hypothetical protein	NA	A0A2H4JBA1	uncultured_Caudovirales_phage	87.8	1.0e-27
WP_048288912.1|7026_7212_-	hypothetical protein	NA	A0A2H4JFH8	uncultured_Caudovirales_phage	95.1	1.1e-22
WP_023304529.1|7204_7417_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	50.9	5.3e-10
WP_032435325.1|8033_8243_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	97.1	6.3e-32
WP_073578731.1|8355_9201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073578730.1|9197_10421_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	97.1	2.5e-237
WP_073578738.1|10735_10927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073578737.1|10982_14390_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	43.6	5.6e-186
WP_073578736.1|14403_16065_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	93.7	2.1e-311
WP_004857981.1|16048_16405_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	3.0e-50
16165:16178	attR	ATTTGGCTTTCAGC	NA	NA	NA	NA
WP_004857976.1|16534_16687_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	92.0	6.4e-18
