The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	591567	597392	5454003		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152202.1|591567_592134_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
WP_004152203.1|592151_592397_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152204.1|592393_593131_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_000556592.1|593691_593958_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_072093163.1|593960_594503_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_004152205.1|594499_594727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152206.1|594723_595044_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152207.1|595058_597392_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
>prophage 2
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	1065638	1077292	5454003	integrase	Enterobacteria_phage(70.0%)	15	1053772:1053786	1076829:1076843
1053772:1053786	attL	AGCGCGGAGAGATTG	NA	NA	NA	NA
WP_002889890.1|1065638_1067972_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
WP_002889897.1|1067983_1068304_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889911.1|1068300_1068528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072028197.1|1068524_1069076_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889915.1|1069078_1069345_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_004903606.1|1069449_1069587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889917.1|1069886_1070624_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889919.1|1070620_1070866_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889930.1|1070883_1071450_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_020802988.1|1071522_1071672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152979.1|1072018_1072444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152029.1|1072443_1073394_-	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_002889938.1|1073381_1074572_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_002889940.1|1074924_1076178_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_004144574.1|1076188_1077292_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
1076829:1076843	attR	AGCGCGGAGAGATTG	NA	NA	NA	NA
>prophage 3
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	1286847	1332122	5454003	lysis,tRNA,head,integrase	Escherichia_phage(26.42%)	66	1289730:1289776	1338864:1338910
WP_004143010.1|1286847_1288233_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.4	3.5e-46
WP_004143016.1|1288278_1288491_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_004143017.1|1288492_1289359_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.8	1.3e-30
1289730:1289776	attL	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
WP_004151318.1|1289789_1290953_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	87.3	3.3e-202
WP_004151317.1|1290829_1291165_-	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_004151316.1|1291166_1291382_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	52.9	4.0e-13
WP_004151314.1|1291383_1291602_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	47.2	1.2e-09
WP_004151312.1|1291598_1292366_-	hypothetical protein	NA	D5LH17	Escherichia_phage	53.4	1.7e-66
WP_004151310.1|1292362_1293019_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	87.5	2.7e-113
WP_004151308.1|1293015_1293174_-	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	60.8	3.0e-10
WP_004151306.1|1293170_1293851_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	93.4	7.9e-124
WP_004151305.1|1293847_1294693_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	6.9e-69
WP_004151304.1|1294708_1294993_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	62.8	8.0e-30
WP_004151303.1|1295081_1295276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151302.1|1295268_1295379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151301.1|1295375_1295591_-	hypothetical protein	NA	B5WZV1	Pseudomonas_phage	48.6	1.6e-09
WP_004151300.1|1295941_1296631_-	helix-turn-helix transcriptional regulator	NA	G8C7U1	Escherichia_phage	52.2	4.3e-61
WP_004151299.1|1296758_1296992_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	50.7	4.3e-13
WP_001548453.1|1297032_1297254_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004151298.1|1297339_1297486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004230546.1|1297526_1298378_+	hypothetical protein	NA	F1C5C3	Cronobacter_phage	56.3	5.3e-85
WP_004230547.1|1298382_1299798_+	AAA family ATPase	NA	Q9MCT4	Escherichia_phage	67.1	1.8e-183
WP_004151295.1|1299797_1300091_+	protein ren	NA	O48423	Enterobacteria_phage	65.6	3.3e-26
WP_004151294.1|1300087_1300594_+	hypothetical protein	NA	A0A0A6Z565	Enterobacter_phage	59.6	3.0e-27
WP_004151293.1|1300700_1301543_+	translation repressor RelE	NA	A0A2H4FRZ0	Salmonella_phage	60.8	1.8e-29
WP_004151292.1|1301542_1301719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151291.1|1301715_1302363_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	32.6	4.5e-12
WP_004151288.1|1302863_1303319_+	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	69.5	8.0e-56
WP_004151287.1|1303318_1303489_+	NinE family protein	NA	G8C7V4	Escherichia_phage	73.2	1.3e-14
WP_004151286.1|1303481_1304117_+	protein ninG	NA	M9NYX8	Enterobacteria_phage	77.9	2.7e-81
WP_004151285.1|1304113_1304251_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004151284.1|1304243_1304774_+	HNH endonuclease	NA	A0A193GYW9	Enterobacter_phage	43.1	5.2e-30
WP_004151283.1|1304770_1305460_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	54.5	1.4e-56
WP_004151282.1|1306369_1306618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151281.1|1306620_1307151_+	lysozyme	NA	G9L6J6	Escherichia_phage	78.5	6.0e-79
WP_004151280.1|1307147_1307612_+|lysis	lysis protein	lysis	Q76H63	Enterobacteria_phage	73.2	2.4e-55
WP_004151279.1|1307717_1308047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151277.1|1308417_1309020_+	hypothetical protein	NA	G8C7P2	Escherichia_phage	80.9	5.4e-76
WP_004151276.1|1309019_1310492_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	82.5	1.3e-248
WP_004151275.1|1310504_1311926_+	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.1	9.6e-148
WP_004151274.1|1311900_1312905_+|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	69.7	9.0e-116
WP_004151273.1|1312946_1313423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151272.1|1313495_1314881_+	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	60.0	2.3e-154
WP_004151271.1|1314884_1315313_+	hypothetical protein	NA	F1C5E0	Cronobacter_phage	60.8	1.6e-42
WP_004151270.1|1315324_1316419_+	hypothetical protein	NA	F1C5E1	Cronobacter_phage	62.8	1.7e-123
WP_004151269.1|1316429_1316669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151268.1|1316671_1317052_+	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	5.3e-29
WP_004151267.1|1317051_1317225_+	hypothetical protein	NA	I6R0P9	Salmonella_phage	56.1	1.4e-13
WP_004151266.1|1317224_1317587_+	hypothetical protein	NA	A0A173GCE0	Salmonella_phage	45.0	1.8e-18
WP_004151265.1|1317589_1318015_+	hypothetical protein	NA	R9TPP7	Aeromonas_phage	47.9	5.1e-28
WP_004151264.1|1318011_1318404_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	52.7	5.1e-35
WP_004151263.1|1318472_1319225_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	42.1	5.8e-43
WP_004151262.1|1319277_1319955_+	hypothetical protein	NA	F1C5E8	Cronobacter_phage	57.9	4.8e-73
WP_004151261.1|1320130_1320886_+	DNA-binding protein	NA	K7PGT4	Enterobacteria_phage	51.0	2.4e-60
WP_004151260.1|1320888_1321143_+	hypothetical protein	NA	K7PM89	Enterobacteria_phage	73.0	6.7e-20
WP_004151259.1|1321436_1321907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151258.1|1321923_1322283_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	47.5	3.8e-16
WP_004151257.1|1322382_1322553_+	Arc family DNA-binding protein	NA	I6R9A8	Salmonella_phage	87.0	6.1e-17
WP_004151256.1|1322542_1323256_+	hypothetical protein	NA	H6WRU8	Salmonella_phage	50.2	3.9e-49
WP_004151255.1|1323321_1324107_+	phage repressor protein	NA	A0A2L1IV39	Escherichia_phage	59.7	1.9e-84
WP_004151254.1|1324234_1324738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151253.1|1324830_1328277_+	tape measure protein	NA	Q5G8W8	Enterobacteria_phage	48.6	1.4e-163
WP_004151252.1|1328319_1328796_+	hypothetical protein	NA	A0A2P1MXB5	Escherichia_phage	49.7	3.0e-37
WP_004199076.1|1328795_1329266_+	hypothetical protein	NA	R9TPR6	Aeromonas_phage	41.0	2.5e-28
WP_004151250.1|1329262_1329658_+	hypothetical protein	NA	F1C5F2	Cronobacter_phage	54.0	8.0e-36
WP_004151249.1|1329644_1332122_+	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	45.6	2.7e-198
1338864:1338910	attR	CTTCTAAGCCGTAGGTCACAGGTTCGAATCCTGTAGGGCGTGCCATT	NA	NA	NA	NA
>prophage 4
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	1681569	1720815	5454003	lysis,terminase,portal,head,tail,integrase,capsid,plate	Salmonella_phage(82.93%)	49	1681477:1681495	1720887:1720905
1681477:1681495	attL	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_014342959.1|1681569_1682550_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
WP_022644582.1|1683037_1684525_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004150866.1|1684623_1685568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|1685579_1686458_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_000188448.1|1686603_1686825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1686857_1687367_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956179.1|1687374_1687575_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000963473.1|1687538_1687880_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_004150864.1|1687947_1688181_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000752622.1|1688180_1688408_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150863.1|1688404_1689262_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_004150862.1|1689258_1691673_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004178082.1|1692148_1693636_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_001154434.1|1693736_1693925_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1693935_1694169_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000700647.1|1694283_1694961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004199124.1|1695236_1696979_+	AIPR family protein	NA	NA	NA	NA	NA
WP_002895959.1|1697040_1698066_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004150858.1|1698065_1699832_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895967.1|1699974_1700808_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_002895972.1|1700824_1701883_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_000059191.1|1701886_1702537_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002896151.1|1702632_1703097_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_002896155.1|1703096_1703300_+|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896158.1|1703303_1703519_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896161.1|1703499_1704009_+	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896163.1|1704013_1704397_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896168.1|1704393_1704822_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896170.1|1704808_1704955_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896172.1|1704917_1705349_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896175.1|1705341_1705788_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_004199112.1|1705784_1706294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004226282.1|1706292_1706457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896177.1|1706571_1707144_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_002896179.1|1707140_1707503_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896182.1|1707489_1708398_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_004150856.1|1708390_1708990_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_004152882.1|1708991_1711943_+	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_002896186.1|1711946_1712678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004232615.1|1712716_1712878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896191.1|1712907_1713984_+|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896193.1|1714122_1715295_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896201.1|1715304_1715820_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896204.1|1715872_1716172_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896220.1|1716186_1716306_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_014342962.1|1716532_1718926_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896224.1|1718922_1719408_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_002896225.1|1719404_1720505_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_000972391.1|1720596_1720815_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
1720887:1720905	attR	CAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 5
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	1755231	1764695	5454003	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_002896440.1|1755231_1756347_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_004150848.1|1756343_1758284_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|1758360_1758582_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1758907_1759225_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|1759255_1761535_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|1761655_1761874_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004141853.1|1762227_1762947_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004150847.1|1762973_1764695_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 6
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	2152723	2210539	5454003	terminase,tail,transposase,integrase,holin	Enterobacteria_phage(22.22%)	71	2144701:2144716	2167540:2167555
2144701:2144716	attL	CATTTTTTTGCTCGTT	NA	NA	NA	NA
WP_004140269.1|2152723_2153533_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_004140266.1|2153534_2154527_-	peptide ABC transporter ATP-binding protein SapD	NA	G9BWD6	Planktothrix_phage	27.2	3.0e-07
WP_004151901.1|2154526_2155417_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_004151900.1|2155563_2156781_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.9	8.6e-121
WP_004190725.1|2156677_2156992_-	hypothetical protein	NA	K7PM28	Enterobacteria_phage	50.8	1.6e-10
WP_004151899.1|2156988_2157651_-	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	84.6	2.7e-105
WP_004151898.1|2157647_2158076_-	hypothetical protein	NA	M9NYX4	Enterobacteria_phage	80.3	7.5e-64
WP_004201102.1|2158072_2158753_-	YqaJ viral recombinase family protein	NA	A0A0M3ULE0	Salmonella_phage	91.2	8.2e-121
WP_088224434.1|2158754_2159042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201103.1|2159038_2159884_-	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	59.2	1.8e-69
WP_004201105.1|2159899_2160184_-	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	79.8	1.1e-39
WP_004135674.1|2160272_2160467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219883.1|2160459_2160585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004201108.1|2160895_2161099_+	hypothetical protein	NA	A0A192Y6Q5	Salmonella_phage	71.6	3.9e-18
WP_004201109.1|2161180_2162257_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	37.9	9.1e-58
WP_004201113.1|2162544_2163243_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	84.1	3.7e-108
WP_004201115.1|2163354_2163582_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	77.1	1.4e-24
WP_001548453.1|2163622_2163844_+	hypothetical protein	NA	G8EYH8	Enterobacteria_phage	41.7	6.9e-05
WP_004201117.1|2163929_2164790_+	replication protein	NA	K7PGT1	Enterobacteria_phage	53.3	1.0e-59
WP_004201118.1|2164786_2165635_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	60.1	5.1e-88
WP_004218528.1|2165631_2165934_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004196831.1|2165989_2166235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218530.1|2166442_2167471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243011.1|2167580_2167859_+	hypothetical protein	NA	NA	NA	NA	NA
2167540:2167555	attR	AACGAGCAAAAAAATG	NA	NA	NA	NA
WP_004218531.1|2167991_2168459_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	45.8	3.4e-33
WP_004243010.1|2168439_2168607_+	NinE family protein	NA	K7P7K0	Enterobacteria_phage	62.5	4.6e-09
WP_004218532.1|2168603_2169272_+	serine/threonine protein phosphatase	NA	K7P6H8	Enterobacteria_phage	78.7	1.4e-104
WP_004218533.1|2169264_2169903_+	hypothetical protein	NA	H6WRY9	Salmonella_phage	69.8	3.2e-74
WP_004218534.1|2169899_2170040_+	YlcG family protein	NA	NA	NA	NA	NA
WP_004232548.1|2170039_2170729_+	antiterminator-like protein	NA	I6PDF8	Cronobacter_phage	53.1	2.1e-55
WP_024940884.1|2171378_2171678_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	100.0	4.5e-47
WP_004218565.1|2171674_2172214_+	glycoside hydrolase family 108 protein	NA	A0A286N2Q6	Klebsiella_phage	98.9	3.3e-101
WP_004190674.1|2172210_2172555_+	hypothetical protein	NA	A0A286N2Q7	Klebsiella_phage	80.7	2.0e-38
WP_004190672.1|2172551_2172827_+	hypothetical protein	NA	A0A286N2Q8	Klebsiella_phage	72.5	2.2e-08
WP_004218558.1|2173785_2174031_+	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	96.3	4.6e-34
WP_004218556.1|2174893_2175898_+|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	45.5	1.5e-38
WP_004190663.1|2175875_2177183_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	58.9	3.6e-149
WP_004218551.1|2177182_2178583_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	53.5	1.1e-127
WP_019405022.1|2178566_2179679_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	5.6e-111
WP_004227000.1|2179919_2180096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217351.1|2180209_2180995_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	63.9	1.0e-66
WP_004190653.1|2181005_2181959_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	74.4	5.0e-132
WP_142689607.1|2181967_2182240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217348.1|2182280_2182676_+	hypothetical protein	NA	A0A1B1P9F2	Acinetobacter_phage	38.5	4.3e-13
WP_004217346.1|2182677_2182932_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	52.4	1.0e-20
WP_004190646.1|2182941_2183175_+	hypothetical protein	NA	A0A2H4J0Y9	uncultured_Caudovirales_phage	47.1	5.8e-10
WP_004217344.1|2183161_2183545_+	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	45.2	7.1e-21
WP_004217343.1|2183546_2184098_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	1.3e-28
WP_004190640.1|2184094_2184487_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_004217341.1|2184510_2185683_+	Ig domain-containing protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	1.2e-23
WP_004226994.1|2185736_2186219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016831940.1|2186356_2186563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004217333.1|2186639_2186996_+	hypothetical protein	NA	A0A1V0E5P9	Salmonella_phage	75.0	1.1e-44
WP_099119318.1|2187220_2187412_+	hypothetical protein	NA	S4TR42	Salmonella_phage	78.3	7.8e-05
WP_004217331.1|2187673_2190571_+|tail	tail protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	32.7	1.6e-104
WP_004152648.1|2190654_2190990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152649.1|2191304_2191769_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.8	6.7e-58
WP_004152650.1|2191949_2192432_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	94.4	1.7e-80
WP_004152651.1|2192441_2192822_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	99.2	1.8e-72
WP_004152652.1|2192818_2195887_+	hypothetical protein	NA	A0A286S259	Klebsiella_phage	97.5	0.0e+00
WP_022644627.1|2195963_2198918_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	68.3	4.2e-44
WP_004152700.1|2198921_2199653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152702.1|2199877_2200477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152703.1|2200718_2202662_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	69.8	1.1e-37
WP_001067855.1|2202910_2203615_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152776.1|2204207_2204630_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.3	3.6e-26
WP_004178082.1|2205524_2207012_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_002901812.1|2207091_2207511_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.5	1.4e-35
WP_002901813.1|2207512_2208778_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	82.7	9.6e-208
WP_071531199.1|2208853_2209681_-	FRG domain-containing protein	NA	A0A1S6KZX9	Salmonella_phage	30.2	8.4e-19
WP_002901815.1|2209867_2210539_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	59.6	4.5e-79
>prophage 7
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	2243472	2286520	5454003	terminase,transposase,integrase	Klebsiella_phage(33.33%)	63	2241553:2241567	2250493:2250507
2241553:2241567	attL	AGTTGATCCTCTGGC	NA	NA	NA	NA
WP_004152144.1|2243472_2244234_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
WP_004152145.1|2244450_2245983_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_016197745.1|2246181_2246730_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_004152147.1|2246926_2248108_+|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_004152148.1|2248088_2248331_-	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004198245.1|2248290_2248437_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_014343018.1|2248509_2248743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218013.1|2248985_2249099_-	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_004152151.1|2249194_2249419_-	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004154298.1|2249408_2250119_-	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152153.1|2250124_2250643_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
2250493:2250507	attR	GCCAGAGGATCAACT	NA	NA	NA	NA
WP_004152154.1|2250747_2251575_-	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152155.1|2251571_2251766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152156.1|2251762_2252188_-	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004146412.1|2252184_2252307_-	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152157.1|2252374_2252629_-	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
WP_004218017.1|2252621_2252783_-	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152159.1|2253156_2253345_-	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004152160.1|2253337_2253652_-	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152161.1|2253822_2254491_-	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152162.1|2254588_2254810_+	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004198228.1|2255386_2257045_+	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004198233.1|2257046_2258009_+	zinc-binding domain of primase-helicase family protein	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198239.1|2258005_2258482_+	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004152167.1|2258478_2259261_+	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004152168.1|2259327_2259483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|2259520_2259649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004146526.1|2259666_2259915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152169.1|2259917_2260448_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004153952.1|2260444_2260834_+	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152170.1|2261068_2261389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218030.1|2261754_2262243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152172.1|2262193_2263594_+|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004152173.1|2263831_2265283_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152174.1|2265338_2265887_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004199270.1|2265938_2267141_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_000528476.1|2267144_2267639_+	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_001132269.1|2267650_2268592_+	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000725700.1|2268631_2268913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|2268881_2269301_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000834982.1|2269297_2269804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001116156.1|2269803_2270190_+	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_004152176.1|2270284_2270725_+	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_004152177.1|2270728_2271874_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152178.1|2271884_2272175_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	85.5	2.6e-23
WP_085955245.1|2272115_2273308_-|transposase	IS3-like element ISKpn18 family transposase	transposase	U5P429	Shigella_phage	43.5	3.5e-50
WP_004152564.1|2273634_2274060_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004152565.1|2274095_2274248_+	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152566.1|2274237_2276241_+	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004225238.1|2276426_2276840_+	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004217362.1|2276915_2277143_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004152569.1|2277145_2278168_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004152570.1|2278167_2278509_+	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004173705.1|2278561_2278747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004225248.1|2278999_2279350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152572.1|2279403_2280057_+	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004152573.1|2280058_2280412_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152574.1|2280411_2281608_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152575.1|2281604_2282378_+	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004231600.1|2282852_2283017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|2283137_2283269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152577.1|2283243_2283441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343022.1|2283496_2286520_+	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
>prophage 8
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	2511941	2521355	5454003		Escherichia_phage(87.5%)	9	NA	NA
WP_002210516.1|2511941_2512562_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004151609.1|2512554_2513820_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_004151610.1|2513831_2514734_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_002210513.1|2514994_2515756_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|2515776_2516637_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002904006.1|2516934_2517195_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_001620097.1|2517281_2518370_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004151612.1|2518400_2519666_-	MFS transporter	NA	NA	NA	NA	NA
WP_160463746.1|2519720_2521355_-	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
>prophage 9
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	3144357	3187456	5454003	tRNA,transposase,plate	Microcystis_virus(25.0%)	42	NA	NA
WP_002910404.1|3144357_3145614_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_002910405.1|3145884_3146496_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_004217879.1|3146495_3147344_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_002910407.1|3147527_3148475_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.5	2.3e-44
WP_004152259.1|3148599_3150279_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	7.9e-24
WP_002910436.1|3150279_3151326_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910437.1|3151548_3151824_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_002910438.1|3152096_3152681_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002910443.1|3152798_3153890_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_002910446.1|3153972_3154182_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_002910453.1|3154383_3155298_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152260.1|3155429_3156845_-	membrane protein	NA	NA	NA	NA	NA
WP_004152261.1|3156864_3157308_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_019404979.1|3157310_3157853_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004152910.1|3157827_3158844_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_002910495.1|3158873_3160637_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004152262.1|3160770_3164181_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_004198077.1|3164164_3165322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|3165325_3165592_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_072093174.1|3165889_3166075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093175.1|3166335_3166470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|3166695_3167676_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152632.1|3168012_3168903_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_002910539.1|3169078_3169972_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_038435084.1|3169993_3170122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|3170147_3171041_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_004217423.1|3171062_3171179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|3171224_3172118_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004199323.1|3172139_3172451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093244.1|3172468_3173500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|3173959_3174466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|3174462_3174792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199326.1|3174788_3174971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644641.1|3175112_3176081_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_002910586.1|3177686_3178196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|3178185_3178338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|3178432_3178939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910593.1|3178935_3179445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152319.1|3179445_3180801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152317.1|3183764_3185462_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004152316.1|3185465_3186119_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_002910645.1|3186115_3187456_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 10
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	3599931	3607556	5454003		Escherichia_phage(28.57%)	7	NA	NA
WP_004152482.1|3599931_3600933_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
WP_004152483.1|3601126_3602293_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152484.1|3602473_3603028_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152485.1|3603042_3603933_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152486.1|3603964_3604834_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152487.1|3604860_3605925_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152488.1|3606149_3607556_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
>prophage 11
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	3644123	3651030	5454003	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_004151135.1|3644123_3645602_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
WP_002912634.1|3645598_3646321_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_002912635.1|3646639_3648001_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_004151134.1|3648243_3649140_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912638.1|3649382_3650156_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004175147.1|3650166_3651030_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
>prophage 12
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	3950806	4030575	5454003	protease,terminase,tRNA,tail,transposase,holin,integrase	Salmonella_phage(32.2%)	86	3956448:3956465	4029564:4029581
WP_004152006.1|3950806_3952810_-|tRNA	tRNA(Met) cytidine acetyltransferase	tRNA	NA	NA	NA	NA
WP_002913800.1|3952819_3953695_-	neutral zinc metallopeptidase	NA	NA	NA	NA	NA
WP_002913801.1|3953814_3954528_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A127KMU1	Cyanophage	35.7	1.1e-38
WP_002913802.1|3954743_3955778_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_002913803.1|3955794_3956673_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
3956448:3956465	attL	CAGCGATAACCGGAATAC	NA	NA	NA	NA
WP_002913804.1|3956826_3957393_+	glycine cleavage system transcriptional repressor	NA	NA	NA	NA	NA
WP_002913805.1|3957396_3957867_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_002913806.1|3957928_3958990_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_004221267.1|3959044_3959161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913807.1|3959212_3960676_+|protease	beta-barrel assembly-enhancing protease	protease	NA	NA	NA	NA
WP_002913810.1|3960685_3961045_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_002913812.1|3961172_3962084_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
WP_020947395.1|3962080_3962782_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913824.1|3962880_3964167_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_002913827.1|3964262_3964889_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913829.1|3965106_3966540_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913833.1|3966549_3967443_-	ROK family protein	NA	NA	NA	NA	NA
WP_002913836.1|3967706_3968744_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_004152007.1|3968740_3969382_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913838.1|3969562_3971623_+	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_002913839.1|3971626_3973159_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_001067855.1|3975146_3975851_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|3976201_3976756_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|3976989_3977547_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|3977708_3980714_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_004174861.1|3981789_3981963_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_004221278.1|3982059_3982971_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002913847.1|3983044_3984277_+	MFS transporter	NA	NA	NA	NA	NA
WP_004162150.1|3984570_3985749_+	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_004152009.1|3985732_3987601_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004152707.1|3987820_3988303_-	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152706.1|3988299_3988929_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004146393.1|3988918_3989224_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004146394.1|3989210_3989615_-	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004229092.1|3989738_3989891_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004207261.1|3989899_3992266_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004152432.1|3992422_3992719_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004152433.1|3993033_3993723_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
WP_071531206.1|3993808_3994192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152434.1|3994334_3997100_-	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_004152435.1|3997099_3999010_-	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152436.1|3999009_4001841_-	hypothetical protein	NA	Q858G0	Salmonella_phage	75.7	0.0e+00
WP_004152437.1|4001851_4002391_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_004152438.1|4002390_4002855_-	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152439.1|4002854_4005353_-	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152440.1|4005352_4005958_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152441.1|4005957_4006281_-	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152442.1|4006331_4006673_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152443.1|4006683_4007121_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_032413483.1|4007174_4008161_-	phage protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004152445.1|4008175_4008856_-	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_004152446.1|4008858_4009155_-	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152447.1|4009151_4010834_-|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004141368.1|4010848_4011055_-	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152449.1|4011856_4012168_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004154331.1|4012234_4013710_-	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152523.1|4013706_4014291_-|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004152524.1|4014368_4014626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152525.1|4014700_4015039_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152526.1|4015038_4015278_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152527.1|4015270_4015939_-	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004141386.1|4015935_4016148_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152528.1|4016148_4016319_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004152529.1|4016318_4017062_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152530.1|4017058_4017484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152531.1|4017480_4017672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152532.1|4017655_4018066_-	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152534.1|4018258_4018606_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152535.1|4018725_4019511_-	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004207253.1|4019507_4020275_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152537.1|4020274_4020484_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004152538.1|4020630_4020864_-	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152539.1|4021017_4021599_+	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004164037.1|4021819_4021969_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004164029.1|4021965_4022265_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004152541.1|4022261_4023161_+	endonuclease	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004152542.1|4023170_4024193_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152543.1|4024244_4024493_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004153052.1|4024602_4024896_+	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152545.1|4024888_4025047_+	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004152546.1|4025043_4025637_+	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152547.1|4025633_4025816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152548.1|4025812_4026004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152549.1|4026020_4027271_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004151979.1|4027463_4029041_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004151980.1|4029108_4030575_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
4029564:4029581	attR	CAGCGATAACCGGAATAC	NA	NA	NA	NA
>prophage 13
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	4101925	4184644	5454003	lysis,terminase,portal,head,tRNA,tail,coat,transposase,integrase,capsid,plate	Salmonella_phage(69.23%)	90	4146628:4146674	4186305:4186351
WP_002914079.1|4101925_4102663_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_002914082.1|4102794_4104126_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.9	6.2e-48
WP_002914084.1|4104171_4104555_-	autonomous glycyl radical cofactor GrcA	NA	A0A193GZ98	Escherichia_phage	79.3	4.0e-32
WP_002914088.1|4104868_4105558_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	53.0	1.3e-57
WP_002914089.1|4105615_4106701_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_002914091.1|4106904_4107330_+	thioredoxin TrxC	NA	A0A1J0GW78	Streptomyces_phage	40.2	6.0e-13
WP_002914092.1|4107399_4108098_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_004151994.1|4108132_4110793_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_002914094.1|4110913_4112269_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_002914095.1|4112310_4112634_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_002914097.1|4112637_4113936_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.5	3.1e-44
WP_004150973.1|4119900_4122474_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	6.9e-128
WP_002914109.1|4122603_4123335_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_002914110.1|4123331_4124312_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_004145664.1|4124443_4125181_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_002914111.1|4125451_4125787_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_100250063.1|4125893_4125941_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150975.1|4126041_4127202_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_002914112.1|4127198_4128071_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_002914113.1|4128133_4129255_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_002914114.1|4129264_4130335_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.5	1.8e-90
WP_004174804.1|4130677_4131187_+	YfiR family protein	NA	NA	NA	NA	NA
WP_002914116.1|4131179_4132403_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_002914117.1|4132416_4132899_+	OmpA family protein	NA	NA	NA	NA	NA
WP_002914118.1|4132907_4134278_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002914119.1|4134334_4134793_-	DUF2946 domain-containing protein	NA	NA	NA	NA	NA
WP_004220183.1|4134782_4134920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914145.1|4134912_4135260_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002914147.1|4135299_4136067_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_004150977.1|4136098_4136647_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914149.1|4136665_4136914_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002914152.1|4137173_4138538_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914153.1|4138701_4139493_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_004149392.1|4139512_4140799_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914155.1|4140918_4141509_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_002914158.1|4141633_4142512_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914159.1|4142598_4144260_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_004145681.1|4144285_4144426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002914160.1|4144407_4144749_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914161.1|4144815_4145106_-	RnfH family protein	NA	NA	NA	NA	NA
WP_004188817.1|4145095_4145572_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914164.1|4145682_4146165_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
4146628:4146674	attL	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
WP_004150980.1|4146768_4147146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150981.1|4147173_4147392_-	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150982.1|4147458_4148553_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150983.1|4148549_4149035_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_072093161.1|4149031_4151428_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_002896220.1|4151654_4151774_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_004150985.1|4151788_4152088_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_004150986.1|4152140_4152656_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150987.1|4152665_4153838_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150988.1|4153986_4155060_-|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004200602.1|4155111_4156230_-	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150990.1|4156239_4158189_-|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004152935.1|4158190_4158862_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150992.1|4158854_4159763_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004150993.1|4159749_4160112_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150994.1|4160108_4160681_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150995.1|4160775_4161642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150996.1|4161664_4162111_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150997.1|4162103_4162526_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_072093160.1|4162488_4162647_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150998.1|4162621_4163050_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_004150999.1|4163046_4163430_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004151000.1|4163434_4163944_-	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004134639.1|4163924_4164140_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151001.1|4164143_4164347_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004151002.1|4164346_4164811_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004134644.1|4164906_4165560_-|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151003.1|4165563_4166616_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004151004.1|4166632_4167466_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_019405037.1|4167606_4169370_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151006.1|4169369_4170413_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_024940854.1|4170469_4170739_-	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_000019473.1|4171496_4172477_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004151008.1|4173461_4174541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151009.1|4174527_4175211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151010.1|4175306_4175540_-	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151011.1|4175551_4175740_-	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004178082.1|4175847_4177335_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004151012.1|4177812_4180197_-	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151013.1|4180193_4181045_-	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151014.1|4181041_4181269_-	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151016.1|4181268_4181502_-	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004144796.1|4181569_4181908_-	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151017.1|4181871_4182072_-	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004151018.1|4182079_4182589_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_001397669.1|4182621_4182864_-	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151019.1|4182986_4183616_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_004151020.1|4183618_4184644_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
4186305:4186351	attR	ATGTAGGAATTTCGGACGCGGGTTCAACTCCCGCCAGCTCCACCAAA	NA	NA	NA	NA
>prophage 14
NZ_CP018428	Klebsiella pneumoniae strain MNCRE78 chromosome, complete genome	5454003	4905175	4954018	5454003	protease,terminase,portal,head,tRNA,tail,capsid	uncultured_Caudovirales_phage(68.75%)	56	NA	NA
WP_002918465.1|4905175_4905670_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|4905673_4906312_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|4906281_4906566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|4906623_4907016_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|4907031_4907460_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|4907725_4908853_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|4909043_4909442_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_002918566.1|4909615_4910983_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|4911070_4912129_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_002918570.1|4912265_4913204_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|4913618_4914089_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|4914464_4914728_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|4914826_4915093_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|4915143_4915419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918632.1|4915498_4917466_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|4917471_4918404_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|4918411_4918615_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|4918746_4919676_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_002918642.1|4919711_4921157_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_004150952.1|4921245_4925043_-	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_002918644.1|4925080_4926550_-	ribonuclease G	NA	NA	NA	NA	NA
WP_002918646.1|4926552_4927134_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|4927141_4927630_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|4927629_4928622_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|4928692_4929736_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_002918686.1|4930041_4931982_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_002918687.1|4932061_4932253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|4932481_4933483_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_002918689.1|4933482_4934091_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_002918732.1|4934314_4934767_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|4934789_4935257_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002918738.1|4935267_4936617_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|4936727_4936970_+	YhdT family protein	NA	NA	NA	NA	NA
WP_002918742.1|4936959_4938411_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_002918745.1|4938422_4939304_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|4939661_4940627_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|4940651_4940948_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_004150954.1|4941101_4941293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150955.1|4941295_4942957_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
WP_000113647.1|4942940_4943297_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150957.1|4943427_4943580_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_004150959.1|4943572_4944016_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_001547824.1|4944015_4944315_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150961.1|4944311_4944647_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_004150962.1|4944643_4945885_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_001547826.1|4945886_4946447_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_001549743.1|4946498_4947665_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_004150963.1|4947928_4948441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150964.1|4948489_4948825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|4949167_4951303_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_001549749.1|4951302_4951668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|4951664_4952033_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_004218267.1|4952131_4952260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001549752.1|4952336_4952525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157263200.1|4952517_4952736_-	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_004150969.1|4953238_4954018_-	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
>prophage 1
NZ_CP018429	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_2, complete sequence	45288	0	5703	45288	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_002903955.1|574_1477_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004199413.1|2685_5703_-|transposase	Tn3-like element IS3000 family transposase	transposase	A0A125RQ78	Bacillus_phage	24.7	5.5e-52
>prophage 2
NZ_CP018429	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_2, complete sequence	45288	10867	15038	45288		Streptococcus_phage(33.33%)	3	NA	NA
WP_004199098.1|10867_13195_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	28.1	8.6e-37
WP_000517490.1|13198_14461_-	ATP-binding protein	NA	A0A1V0SKF8	Klosneuvirus	31.4	1.3e-07
WP_001215543.1|14543_15038_-	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.3	8.0e-17
>prophage 3
NZ_CP018429	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_2, complete sequence	45288	33668	34184	45288		Tupanvirus(100.0%)	1	NA	NA
WP_001025390.1|33668_34184_-	DnaJ domain-containing protein	NA	A0A2K9L588	Tupanvirus	39.8	3.3e-05
>prophage 4
NZ_CP018429	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_2, complete sequence	45288	38784	44819	45288		Burkholderia_phage(25.0%)	4	NA	NA
WP_000516402.1|38784_39447_-	peptidyl-arginine deiminase	NA	E5FFJ3	Burkholderia_phage	25.2	2.6e-07
WP_001549893.1|39827_40490_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	9.7e-10
WP_001549892.1|42484_42724_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.1	4.4e-21
WP_002904004.1|43958_44819_+	class A extended-spectrum beta-lactamase SHV-12	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
>prophage 1
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	0	42327	208225	integrase,transposase,protease	Escherichia_phage(37.5%)	38	5234:5248	22575:22589
WP_000333416.1|1299_1572_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|3188_3848_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|4048_4426_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|4492_7459_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
5234:5248	attL	TTCGTGGTACAGCAG	NA	NA	NA	NA
WP_000147567.1|7461_8022_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|8147_8498_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|8700_9714_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|9858_10356_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_071523897.1|10512_10758_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|10763_11555_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|11718_12066_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|12059_12899_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|13026_13230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|13385_14591_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|14601_14907_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|15133_15898_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|16390_16975_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|16974_18213_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|18209_19115_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|19236_19941_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|20091_20907_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_044117068.1|21096_21765_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_001067855.1|23068_23773_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
22575:22589	attR	TTCGTGGTACAGCAG	NA	NA	NA	NA
WP_004153729.1|24628_25456_+	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004152695.1|25452_26316_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004152694.1|26324_27152_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152693.1|27160_28171_+	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152692.1|28164_29034_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000019473.1|30242_31223_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004118209.1|32424_32688_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_004118208.1|32702_32966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152118.1|33209_33491_+	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004152117.1|33525_34095_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152116.1|34209_37005_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152115.1|37004_37202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009483782.1|37439_38189_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_004152113.1|38175_39138_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_020314316.1|40980_42327_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	46450	50757	208225		uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_004152101.1|46450_46801_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152100.1|46850_47213_+	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152099.1|47230_48982_+	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152098.1|49029_50319_+	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152097.1|50331_50757_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
>prophage 3
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	54214	54928	208225		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_004152093.1|54214_54928_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
>prophage 4
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	59443	61521	208225		Bacillus_phage(100.0%)	2	NA	NA
WP_004152084.1|59443_60844_-	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_001188930.1|60840_61521_-	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
>prophage 5
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	66614	73871	208225		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_004118669.1|66614_67352_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_000843497.1|67385_67583_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004098955.1|67623_70071_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000758228.1|70197_70638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004098958.1|70724_73871_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
>prophage 6
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	77244	85748	208225	transposase	Bacillus_phage(50.0%)	5	NA	NA
WP_001572351.1|77244_77925_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_003032875.1|77917_79393_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_004178091.1|79643_80075_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_085955172.1|81503_82710_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178088.1|83750_85748_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
>prophage 7
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	92383	108270	208225	integrase	Macacine_betaherpesvirus(33.33%)	11	80806:80822	111868:111884
80806:80822	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004152065.1|92383_93331_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_001515717.1|94474_95215_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152063.1|95931_96942_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_000523813.1|97693_98860_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152062.1|98859_99831_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_004152715.1|102782_104054_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004178083.1|104053_104479_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004178082.1|104881_106369_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152753.1|106602_106833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118478.1|107353_107779_+	antirestriction protein	NA	NA	NA	NA	NA
WP_004152754.1|108015_108270_+	hypothetical protein	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
111868:111884	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 8
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	111407	115692	208225		Thalassomonas_phage(33.33%)	4	NA	NA
WP_004152645.1|111407_111971_+	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
WP_004152644.1|112746_113289_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152643.1|113337_113586_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004178066.1|113655_115692_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
>prophage 9
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	121112	124715	208225		Klebsiella_phage(25.0%)	9	NA	NA
WP_004152717.1|121112_121469_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152718.1|121529_121742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152719.1|121752_121977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152720.1|122057_122378_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152721.1|122367_122646_+	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152722.1|122646_123060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_031944107.1|123441_123783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072158613.1|123779_123866_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_004178064.1|123893_124715_+	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
>prophage 10
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	158868	159594	208225		Xanthomonas_phage(100.0%)	1	NA	NA
WP_004152303.1|158868_159594_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A1D6ZIU7	Xanthomonas_phage	29.4	5.5e-06
>prophage 11
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	164773	165253	208225		Wolbachia_phage(100.0%)	1	NA	NA
WP_009485932.1|164773_165253_+	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
>prophage 12
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	177274	185135	208225		Herpes_simplex_virus(25.0%)	6	NA	NA
WP_004152287.1|177274_180349_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_004152286.1|180470_181553_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152284.1|182013_183024_+	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_071527925.1|183402_183645_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|183975_184269_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|184367_185135_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
>prophage 13
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	198610	201299	208225		Catovirus(50.0%)	2	NA	NA
WP_004118225.1|198610_199558_+	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004118832.1|199565_201299_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
>prophage 14
NZ_CP018430	Klebsiella pneumoniae strain MNCRE78 plasmid pMNCRE78_4, complete sequence	208225	205121	208144	208225	transposase	Stx2-converting_phage(66.67%)	4	NA	NA
WP_004152557.1|205121_205469_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.0e-59
WP_020956879.1|205465_205852_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|206399_207035_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|207031_208144_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
