The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	143205	201804	4886210	head,portal,tRNA,terminase,capsid,tail,integrase,protease,lysis	Enterobacteria_phage(57.14%)	71	142736:142782	191598:191644
142736:142782	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201857.1|143205_144159_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|144408_145158_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000239874.1|146017_146686_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|147051_147165_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|147233_147467_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|147783_148374_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885602.1|148471_149047_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073535601.1|149046_152445_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001230398.1|152509_153109_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	9.7e-110
WP_073535602.1|153175_156574_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.9	0.0e+00
WP_000090902.1|156633_157266_-|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	87.1	1.3e-91
WP_000140738.1|157202_157946_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	3.4e-144
WP_001152619.1|157950_158649_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000847379.1|158648_158978_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840228.1|158974_161536_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_000459457.1|161528_161963_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|161944_162367_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|162382_163123_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683158.1|163130_163526_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	2.2e-70
WP_073535603.1|163522_164101_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000753019.1|164112_164466_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000158899.1|164477_164873_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000063260.1|164914_165940_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_001299443.1|165995_166328_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_073535604.1|166337_167657_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.0e-231
WP_073535605.1|167637_169239_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.9e-310
WP_000198149.1|169235_169442_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027270.1|169438_171364_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453587.1|171338_171884_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|172272_172467_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000738423.1|172829_173123_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_077628513.1|173213_173396_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	2.5e-16
WP_001135271.1|173612_174110_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839592.1|174109_174325_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000737283.1|174913_176011_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204783.1|176200_176584_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	8.8e-56
WP_001099716.1|176805_177168_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774488.1|177164_177455_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_073535606.1|177447_177618_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	66.0	5.9e-12
WP_001054342.1|177617_178073_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|178069_178171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|178287_179085_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|179094_179646_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_021537018.1|180110_181637_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	1.0e-30
WP_001299444.1|181694_181844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|181891_182224_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|182291_182594_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788815.1|182590_183292_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	98.7	2.4e-128
WP_000147893.1|183288_184308_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_001182903.1|184304_184844_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|184912_185143_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|185247_185937_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|186532_186739_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|186814_187111_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|187116_187902_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186833.1|187898_188579_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
WP_000682294.1|188575_188737_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	7.7e-22
WP_000129285.1|188729_189287_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_000188870.1|189363_189579_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763390.1|189677_189896_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	4.9e-35
WP_000488407.1|189943_190222_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|190420_191584_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
WP_001402083.1|192552_193068_-	fimbria assembly protein	NA	NA	NA	NA	NA
191598:191644	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_000691050.1|193078_194086_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_032283037.1|194098_196708_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988379.1|196738_197431_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001315309.1|197650_198193_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|198673_199540_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|199541_199754_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|199861_200383_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|200418_201804_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 2
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	468576	517191	4886210	transposase,plate	Clostridioides_phage(16.67%)	46	NA	NA
WP_000006256.1|468576_469074_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001402037.1|469249_469999_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
WP_001225679.1|470299_471040_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_032283006.1|471010_471778_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|471986_472565_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973082.1|472804_475249_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|475291_475765_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_023155853.1|475918_476689_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001366128.1|476996_477728_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|477792_478260_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|478256_478979_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052714.1|479012_479768_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|479839_481198_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_053889909.1|481245_482016_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|482093_482894_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001402033.1|483134_484049_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001724736.1|484226_485363_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157914090.1|485532_485673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542651.1|485909_486374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542650.1|486540_487155_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_001542649.1|487200_487398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535618.1|487406_491828_-	PAAR/RHS domain-containing protein	NA	NA	NA	NA	NA
WP_001402128.1|491858_492290_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_032283003.1|492317_494537_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_100224276.1|494561_494909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077250254.1|494929_495496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024170797.1|495712_496489_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_001402124.1|496488_500355_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000522897.1|500354_500600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|500650_501325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|501330_502647_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118770.1|502643_503987_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|503990_504524_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|504591_505077_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871596.1|505190_505562_-	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_000533466.1|505558_506044_-	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_000245849.1|506096_507611_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|507635_508181_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|508242_508533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402121.1|508535_509099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|509111_511745_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_001402119.1|512077_512992_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_001402118.1|512978_513809_+	impE family protein	NA	NA	NA	NA	NA
WP_001402117.1|513805_514300_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001402116.1|514315_516199_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001402115.1|516195_517191_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	1190252	1237588	4886210	plate,tail,holin,tRNA	Burkholderia_phage(31.58%)	47	NA	NA
WP_073535631.1|1190252_1191290_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001295691.1|1192985_1193501_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030593.1|1193542_1193752_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001295692.1|1193867_1195193_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|1195265_1195874_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|1195983_1196352_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|1196522_1198946_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455228.1|1199100_1199973_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001297295.1|1199985_1200483_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000783444.1|1202514_1203435_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973658.1|1203677_1205018_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|1205089_1206205_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|1206569_1207760_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001297290.1|1207913_1209458_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252069.1|1209472_1210363_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001097279.1|1210734_1212210_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000202902.1|1212253_1212664_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000487766.1|1212789_1212933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295279.1|1212933_1213212_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000745708.1|1213258_1215355_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000595534.1|1215354_1216092_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001296632.1|1216088_1216727_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|1216840_1217083_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_000790008.1|1217437_1219087_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290322.1|1219611_1220961_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_001402759.1|1221022_1221364_-	mor transcription activator family protein	NA	Q6QIE8	Burkholderia_phage	48.1	2.2e-21
WP_001402757.1|1221900_1222188_+|holin	putative holin	holin	Q6QIC8	Burkholderia_phage	48.6	1.8e-16
WP_001402756.1|1222190_1222796_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.7	2.5e-57
WP_000777272.1|1222808_1223123_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_001402755.1|1223269_1223725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|1223721_1223919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001402754.1|1223908_1225333_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.6	6.4e-192
WP_000907502.1|1225332_1225857_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_001402753.1|1225907_1226225_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086722008.1|1226184_1226313_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001402752.1|1226414_1228790_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	25.4	9.1e-58
WP_001402751.1|1228789_1229743_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	1.9e-35
WP_001402750.1|1229742_1229952_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	58.8	3.7e-16
WP_023155398.1|1229939_1230980_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.4	3.0e-74
WP_001402748.1|1230989_1231691_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_001093498.1|1231789_1232149_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000951745.1|1232139_1233255_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_001755399.1|1233247_1233880_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	53.0	3.1e-21
WP_001402746.1|1233882_1235709_+|tail	tail fiber protein	tail	A0A0M3ULH6	Salmonella_phage	43.5	2.1e-54
WP_001402745.1|1235715_1236330_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_001402744.1|1236326_1236782_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	3.0e-26
WP_001402743.1|1236796_1237588_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	9.1e-47
>prophage 4
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	2689988	2703171	4886210		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|2689988_2690750_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|2690743_2691370_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2691509_2692649_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|2692711_2693704_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104429.1|2693797_2695162_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136925.1|2695250_2696027_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|2696031_2696670_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2696666_2697929_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|2697925_2698834_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2699029_2699797_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141333.1|2699847_2700504_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001272898.1|2700609_2703171_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 5
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	3049844	3093779	4886210	coat,portal,integrase,terminase,holin,lysis	Enterobacteria_phage(55.17%)	64	3054477:3054492	3093955:3093970
WP_000194515.1|3049844_3051278_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
WP_001274887.1|3051493_3052408_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197023.1|3052479_3053727_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001163428.1|3054256_3054457_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
3054477:3054492	attL	GGAATCGAACCTGCAA	NA	NA	NA	NA
WP_073535680.1|3054514_3054682_-	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	94.5	4.1e-26
WP_122991674.1|3054717_3055017_-	hypothetical protein	NA	Q9G076	Enterobacteria_phage	99.0	7.1e-53
WP_073535681.1|3055088_3055373_-	ASCH domain-containing protein	NA	A0A1I9LJL9	Stx_converting_phage	93.6	1.2e-46
WP_073535682.1|3055365_3055935_-	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	54.0	7.7e-40
WP_073535683.1|3055936_3056128_-	hypothetical protein	NA	A0A0F6R8N3	Escherichia_coli_O157_typing_phage	53.6	5.8e-08
WP_073535684.1|3056252_3056945_-	ead/Ea22-like family protein	NA	G9L663	Escherichia_phage	59.9	1.2e-55
WP_001214454.1|3056941_3057109_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_000773123.1|3057105_3057387_-	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	100.0	1.5e-44
WP_001111303.1|3057406_3057700_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000951323.1|3057723_3058107_-	hypothetical protein	NA	K7P6P8	Enterobacteria_phage	99.2	8.5e-67
WP_000031370.1|3058106_3058712_-	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	100.0	4.1e-108
WP_000050554.1|3058722_3058893_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243353.1|3058968_3059121_-	host cell division inhibitory peptide Kil	NA	K7P837	Enterobacteria_phage	100.0	4.7e-21
WP_000972063.1|3059105_3059240_-	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_000065374.1|3059315_3059684_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_021560261.1|3059825_3060014_-	hypothetical protein	NA	A0A0B7MKW0	Enterobacteria_phage	61.1	7.7e-13
WP_073535685.1|3060348_3060648_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	92.9	3.4e-31
WP_000856967.1|3061167_3061818_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_000276886.1|3061898_3062084_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000251073.1|3062192_3062486_+	lambda phage CII family protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_000166956.1|3062518_3062680_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	98.1	1.7e-21
WP_073535686.1|3062666_3063557_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	98.6	1.4e-157
WP_149027159.1|3063546_3064983_+	AAA family ATPase	NA	Q8VNP7	Enterobacteria_phage	99.8	1.4e-274
WP_073535688.1|3065058_3065265_+	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	98.5	2.4e-31
WP_073535689.1|3065282_3065594_+	hypothetical protein	NA	K7PHN9	Enterobacterial_phage	66.4	8.5e-33
WP_073535690.1|3065565_3065976_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	97.8	8.0e-71
WP_032215303.1|3066169_3067006_+	hypothetical protein	NA	A0A2I7RWZ3	Vibrio_phage	54.0	7.3e-87
WP_061353368.1|3067016_3067286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061353367.1|3067200_3067383_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	88.3	5.9e-26
WP_016063041.1|3067385_3067787_+	hypothetical protein	NA	K7PJK0	Enterobacteria_phage	100.0	2.4e-72
WP_001543885.1|3067746_3067956_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	3.5e-30
WP_073535691.1|3067948_3068560_+	recombination protein NinG	NA	A0A2D1GLP2	Escherichia_phage	99.0	1.8e-98
WP_000144614.1|3068556_3068763_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_053920027.1|3068740_3069412_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	97.8	3.3e-130
WP_000512810.1|3069402_3069921_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_000783734.1|3070517_3070841_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229392.1|3070824_3071301_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_032177428.1|3071297_3071735_+|lysis	lysis protein	lysis	Q716B4	Shigella_phage	96.6	1.6e-69
WP_001028465.1|3071939_3072461_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000807788.1|3072623_3072866_+	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000729922.1|3072901_3073390_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_065203351.1|3073367_3074867_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	99.8	1.1e-306
WP_021516153.1|3074867_3077033_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
WP_073535692.1|3077046_3077958_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	7.0e-160
WP_029403254.1|3077958_3078474_-	HNH endonuclease	NA	A0A291AXK2	Shigella_phage	39.5	4.1e-24
WP_073535693.1|3078547_3079843_+|coat	coat protein	coat	G5DA99	Enterobacteria_phage	98.4	1.7e-239
WP_001543876.1|3079887_3080124_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	84.1	1.3e-25
WP_021514122.1|3080101_3080602_+	hypothetical protein	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
WP_073535694.1|3080602_3082021_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.6	3.2e-276
WP_073535695.1|3082020_3082869_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.2	3.1e-101
WP_000627628.1|3082868_3083324_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	99.3	3.9e-87
WP_073535696.1|3083326_3084019_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.1e-111
WP_073535697.1|3084028_3085399_+	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	73.1	9.0e-151
WP_024623288.1|3085398_3087228_+	hypothetical protein	NA	A0A2H4FNB8	Salmonella_phage	98.4	4.1e-292
WP_000954424.1|3087808_3088252_+	SocA family protein	NA	I6R0L8	Salmonella_phage	70.1	1.2e-59
WP_049044991.1|3088692_3088947_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000410001.1|3089061_3089214_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000620145.1|3089210_3089384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073535797.1|3089446_3090325_+	phage repressor protein/antirepressor Ant	NA	Q0H8C7	Salmonella_phage	89.7	3.3e-90
WP_073535698.1|3092621_3093779_-|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	98.4	1.1e-221
3093955:3093970	attR	GGAATCGAACCTGCAA	NA	NA	NA	NA
>prophage 6
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	3333821	3343263	4886210		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001748561.1|3333821_3334748_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|3334752_3335484_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3335464_3335572_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3335631_3336363_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3336584_3338270_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3338266_3338986_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3339032_3339503_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|3339543_3340005_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001349936.1|3340129_3342130_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001292769.1|3342126_3343263_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 7
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	3355828	3422405	4886210	head,portal,tRNA,plate,terminase,capsid,tail,integrase,holin,lysis	Escherichia_phage(40.43%)	74	3383077:3383104	3418080:3418107
WP_024166615.1|3355828_3357862_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	1.5e-53
WP_001005448.1|3357993_3359103_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001324851.1|3359365_3359647_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|3359939_3360482_+	fimbrial protein	NA	NA	NA	NA	NA
WP_024166614.1|3360561_3361236_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_024166613.1|3361251_3363732_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_024166612.1|3363745_3364780_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|3364861_3365200_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_023155403.1|3365418_3366243_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|3366363_3366636_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195634.1|3366858_3367647_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|3367643_3368444_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_024166611.1|3368508_3369327_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	5.0e-24
WP_000434038.1|3369378_3370125_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011957.1|3370098_3371064_-	sugar kinase	NA	NA	NA	NA	NA
WP_032283350.1|3371060_3372065_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	3.2e-12
WP_000858484.1|3372061_3373339_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129567.1|3373595_3374648_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|3374957_3375812_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853863.1|3375840_3377103_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182904.1|3377112_3377565_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|3377595_3377880_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490713.1|3377883_3379239_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844220.1|3379286_3380327_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3380426_3381206_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|3381287_3382187_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|3382601_3382919_+	hypothetical protein	NA	NA	NA	NA	NA
3383077:3383104	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|3383183_3384197_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001306384.1|3384312_3384612_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|3384726_3385002_+	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|3385012_3385183_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217671.1|3385179_3385680_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	99.4	1.7e-91
WP_000557703.1|3385743_3385968_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001512913.1|3385967_3386270_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	95.0	1.2e-44
WP_001113271.1|3386269_3386494_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	8.5e-35
WP_000027674.1|3386490_3386766_+	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_028985816.1|3386755_3389008_+	replication endonuclease	NA	S4TTC1	Salmonella_phage	92.3	0.0e+00
WP_028985815.1|3389099_3390572_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000038188.1|3390938_3391973_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	4.2e-201
WP_000156861.1|3391972_3393745_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_063117146.1|3393918_3394773_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	1.7e-136
WP_001248558.1|3394831_3395905_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_063117145.1|3395908_3396658_+|terminase	terminase endonuclease subunit	terminase	Q94MK1	Enterobacteria_phage	98.4	1.3e-119
WP_000988639.1|3396757_3397267_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_000846409.1|3397266_3397470_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|3397473_3397755_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3397754_3398252_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736628.1|3398266_3398692_+	hypothetical protein	NA	Q858W1	Yersinia_virus	91.5	1.5e-59
WP_000040671.1|3398679_3399105_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	98.6	6.5e-68
WP_072146842.1|3399076_3399250_+|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000917155.1|3399212_3399680_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	99.4	3.0e-82
WP_001001790.1|3399672_3400125_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.7	9.1e-76
WP_024259821.1|3400227_3401301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024259820.1|3401387_3402017_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.1	2.5e-108
WP_000127163.1|3402013_3402361_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121467.1|3402365_3403274_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.0	3.7e-161
WP_073535712.1|3403266_3403797_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	98.3	1.6e-100
WP_000104687.1|3403807_3405898_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	65.6	3.4e-186
WP_001164147.1|3405901_3406429_+|tail	tail fiber assembly protein	tail	Q858V3	Yersinia_virus	95.4	6.8e-91
WP_005032116.1|3406750_3408748_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_000625667.1|3408811_3410089_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000161640.1|3410229_3411039_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_001286716.1|3411375_3412566_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|3412578_3413097_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|3413154_3413430_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|3413462_3413582_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_039059812.1|3413574_3416022_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.4	0.0e+00
WP_000978874.1|3416036_3416516_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000882978.1|3416515_3417679_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|3417759_3417978_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|3418251_3419613_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
3418080:3418107	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|3419759_3420092_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|3420282_3421005_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675144.1|3421001_3422405_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 8
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	3469088	3475381	4886210		Enterobacteria_phage(50.0%)	6	NA	NA
WP_073535716.1|3469088_3470483_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.8e-19
WP_000183060.1|3470657_3471551_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001767434.1|3471922_3473008_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	4.7e-102
WP_073535717.1|3473007_3473907_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	1.8e-27
WP_000857521.1|3473964_3474843_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_073535718.1|3474847_3475381_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	1.4e-51
>prophage 9
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	3528821	3570382	4886210	head,portal,terminase,capsid,protease,tail,integrase,holin	Escherichia_phage(46.34%)	49	3519699:3519715	3533187:3533203
3519699:3519715	attL	CTGCCGCCATTTTTAAA	NA	NA	NA	NA
WP_000533615.1|3528821_3529847_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|3529846_3530050_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_040234786.1|3530108_3532550_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	4.5e-113
WP_001070253.1|3532643_3532832_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000854564.1|3532828_3533017_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171946.1|3533587_3533806_-	hypothetical protein	NA	NA	NA	NA	NA
3533187:3533203	attR	TTTAAAAATGGCGGCAG	NA	NA	NA	NA
WP_040235278.1|3533965_3534121_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001397087.1|3534413_3534752_-	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000693883.1|3535370_3535796_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262356.1|3535867_3536938_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.7	1.4e-63
WP_001151221.1|3536978_3537401_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
WP_000161640.1|3537547_3538357_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_000813254.1|3538981_3539137_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000737636.1|3539280_3539673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|3539969_3540248_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|3540249_3541299_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
WP_001217424.1|3541311_3541671_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_016240600.1|3541667_3542357_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	2.6e-58
WP_000839572.1|3543153_3543369_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193292.1|3543373_3543688_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_001274714.1|3543743_3544277_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|3544493_3544679_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|3544919_3545405_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016240599.1|3545649_3545850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|3545857_3546208_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|3546356_3546839_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140902.1|3546838_3548596_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|3548607_3548790_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|3548789_3550031_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|3550008_3550659_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257489.1|3550673_3551879_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601355.1|3551930_3552119_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|3552130_3552436_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|3552444_3552783_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|3552782_3553229_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|3553225_3553570_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|3553629_3554334_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|3554348_3554720_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978931.1|3554743_3555022_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_016240598.1|3555067_3558295_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_040079256.1|3558272_3558629_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_001152456.1|3558628_3559327_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_064732677.1|3559331_3560075_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.3	4.1e-142
WP_012311734.1|3559972_3560620_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_016240596.1|3560680_3564160_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001233121.1|3564227_3564827_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_073535731.1|3564891_3568290_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_016240594.1|3568289_3568874_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.6e-101
WP_001079074.1|3569851_3570382_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 10
NZ_CP010229	Escherichia coli strain S10 chromosome, complete genome	4886210	4637102	4722757	4886210	head,tRNA,portal,plate,terminase,capsid,tail,integrase,protease,lysis	Salmonella_phage(58.33%)	91	4630063:4630078	4725844:4725859
4630063:4630078	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|4637102_4638395_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_032283111.1|4638485_4639829_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.6	4.8e-80
WP_001295343.1|4639839_4640451_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_073535779.1|4640605_4644673_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4644807_4645302_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4645846_4646812_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043618.1|4646934_4648701_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202188.1|4648701_4650423_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_001241678.1|4650464_4651169_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4651453_4651672_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4652356_4654633_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4654663_4654984_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4655306_4655531_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188193.1|4655603_4657550_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|4657546_4658662_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|4658812_4659769_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|4659765_4661424_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|4661849_4662545_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000491127.1|4663040_4663940_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458817.1|4664083_4665736_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|4665747_4666716_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|4666848_4668567_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|4668603_4669605_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|4669615_4671046_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|4671144_4672158_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_032283110.1|4672154_4672985_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_063610354.1|4672981_4673305_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|4673430_4673946_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4674163_4674892_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|4674909_4675641_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|4675647_4676364_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_024226779.1|4676363_4677032_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|4677323_4678055_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149732.1|4678229_4679357_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|4679397_4679886_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|4679945_4680791_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|4680787_4681741_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996017.1|4681750_4682884_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126097.1|4682978_4684091_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4684441_4684918_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4685005_4685908_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|4685968_4686691_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|4686674_4686962_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|4687121_4687379_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|4687408_4687786_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|4688055_4689741_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|4689976_4690195_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_073535780.1|4690285_4691386_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.2	7.6e-177
WP_000980391.1|4691382_4691868_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_073535781.1|4691864_4694942_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	61.2	0.0e+00
WP_000763311.1|4694934_4695054_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|4695068_4695371_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|4695425_4695941_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046113.1|4695950_4697123_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	6.0e-204
WP_073535782.1|4697265_4697832_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	83.7	1.4e-86
WP_073535801.1|4697862_4698381_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	60.9	1.7e-54
WP_073535783.1|4698380_4698983_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_073535784.1|4698954_4699398_-|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	71.4	9.2e-57
WP_073535785.1|4699399_4700797_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	76.7	4.4e-153
WP_001086833.1|4700793_4701399_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	4.4e-110
WP_073535786.1|4701391_4702300_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	9.2e-144
WP_042091086.1|4702286_4702646_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.1	5.0e-53
WP_000993769.1|4702642_4703221_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	2.5e-94
WP_000829119.1|4703289_4703736_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	86.3	2.3e-63
WP_001039945.1|4703728_4704160_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_042091090.1|4704255_4704684_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.5	1.9e-46
WP_000730946.1|4704680_4705058_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_001069893.1|4705059_4705572_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	5.2e-88
WP_000171568.1|4705552_4705768_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|4705771_4705975_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673513.1|4705974_4706439_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_000059191.1|4706534_4707185_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|4707188_4708247_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_042091096.1|4708263_4709097_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_001098431.1|4709239_4711006_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_077897025.1|4711005_4712031_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.0	5.5e-169
WP_000470468.1|4712072_4714013_-	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	28.8	1.4e-11
WP_001059831.1|4714469_4714805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4714997_4715231_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|4715241_4715430_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_073535789.1|4715582_4717997_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.6	0.0e+00
WP_073535790.1|4717993_4718851_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	92.2	4.6e-153
WP_073535791.1|4718847_4719075_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	3.0e-35
WP_001244230.1|4719074_4719308_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000963472.1|4719375_4719717_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_000956182.1|4719680_4719881_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000460893.1|4719888_4720398_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|4720430_4720652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047321.1|4720777_4721347_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	3.8e-39
WP_001321204.1|4721362_4721554_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_000290930.1|4721740_4722757_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.7	3.2e-105
4725844:4725859	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
