The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	23413	30881	4740150	integrase,transposase	Escherichia_phage(66.67%)	6	21201:21214	28314:28327
21201:21214	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|23413_23896_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|24638_25868_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|25906_26323_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214996.1|26394_28143_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000577254.1|28144_29863_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
28314:28327	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_000878196.1|30014_30881_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
>prophage 2
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	101380	108520	4740150		Escherichia_phage(83.33%)	6	NA	NA
WP_001272924.1|101380_103942_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141330.1|104047_104704_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001272549.1|104754_105552_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|105717_106626_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590388.1|106622_107885_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.7	5.7e-136
WP_001278994.1|107881_108520_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 3
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	2125155	2187344	4740150	tRNA,plate,protease,transposase	Emiliania_huxleyi_virus(12.5%)	52	NA	NA
WP_074014603.1|2125155_2126508_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2126537_2128970_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2129091_2129577_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|2129580_2130606_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2130710_2131166_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2131169_2131958_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_001584177.1|2131957_2133106_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|2133102_2133699_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2133735_2137218_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|2137230_2138190_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001021030.1|2138288_2140430_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2140486_2140876_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176573.1|2140940_2142239_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|2142287_2142548_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2142534_2142735_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|2142900_2143446_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|2143442_2143865_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|2143878_2144589_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000399648.1|2144838_2145819_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001346133.1|2146021_2146846_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260716.1|2146898_2148617_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|2148727_2149435_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2149431_2149836_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2149953_2150769_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2150808_2151462_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2151454_2152486_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|2152673_2153249_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997048.1|2159004_2159808_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648580.1|2159804_2160719_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2160959_2161760_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|2161837_2162608_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644683.1|2162655_2164014_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|2164085_2164841_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|2164874_2165597_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2165593_2166061_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|2166125_2166857_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086143.1|2167392_2168178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|2168314_2168794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|2168803_2169718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|2169761_2170244_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087588.1|2170267_2171620_-	membrane protein	NA	NA	NA	NA	NA
WP_122985860.1|2171630_2175065_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|2175173_2176586_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032197483.1|2176590_2177334_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614366.1|2177330_2180096_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	1.4e-81
WP_074014604.1|2180104_2180866_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246421.1|2180870_2182202_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|2182204_2182729_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113725.1|2182725_2184006_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|2184030_2185113_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|2185076_2186927_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_074014605.1|2186930_2187344_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 4
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	2257121	2337505	4740150	plate,protease,capsid,holin,head,tail,portal,integrase,terminase	Shigella_phage(57.14%)	89	2277210:2277227	2347981:2347998
WP_000749863.1|2257121_2258177_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|2258464_2259568_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|2259579_2260833_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_000051887.1|2261037_2262201_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000433939.1|2262077_2262428_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_000206732.1|2262427_2262733_-	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001242749.1|2262732_2263095_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001730405.1|2263085_2263622_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	99.4	1.3e-100
WP_000917896.1|2264298_2264595_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001020634.1|2264872_2265565_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_001191674.1|2265662_2265923_+	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_000515845.1|2265915_2266467_+	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001250271.1|2266642_2266822_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	6.0e-15
WP_074014610.1|2266811_2267753_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_074014611.1|2267749_2268244_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	96.9	1.4e-85
WP_032180893.1|2268243_2268897_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.1e-126
WP_000210164.1|2268893_2269220_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_032180892.1|2269216_2269606_+	RusA family crossover junction endodeoxyribonuclease	NA	Q8SBE7	Shigella_phage	98.4	1.3e-67
WP_032180890.1|2269625_2270435_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	5.3e-151
WP_021535166.1|2270442_2271432_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	98.5	4.0e-193
WP_001204747.1|2271449_2271812_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	95.0	2.5e-60
WP_001406331.1|2271862_2272609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001120497.1|2272875_2273202_+|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_001157005.1|2273205_2273682_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.8	1.2e-86
WP_001374884.1|2273665_2274046_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	86.4	1.3e-51
WP_000613841.1|2274221_2274791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001089762.1|2274891_2275227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135196.1|2275377_2275728_+	HNH endonuclease	NA	U5P4L6	Shigella_phage	96.6	1.2e-62
WP_000929173.1|2275853_2276348_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_122057049.1|2276581_2278078_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.4	2.2e-299
2277210:2277227	attL	TGCTGGAAAAAGCCAATC	NA	NA	NA	NA
WP_024169538.1|2278089_2278272_+	hypothetical protein	NA	Q8HAD5	Salmonella_phage	95.0	2.5e-24
WP_000466247.1|2278271_2279513_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|2279490_2280141_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_057699005.1|2280155_2281361_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.3	1.2e-223
WP_000601360.1|2281410_2281611_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_021574724.1|2281613_2281937_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	97.2	2.8e-55
WP_000702402.1|2281933_2282344_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	98.5	9.1e-75
WP_074014612.1|2282318_2282825_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	6.5e-91
WP_000779292.1|2282821_2283382_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497753.1|2283390_2283561_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_001764254.1|2283544_2285041_+	hypothetical protein	NA	M1FN90	Enterobacteria_phage	100.0	1.7e-275
WP_000090993.1|2285040_2285397_+	hypothetical protein	NA	U5P076	Shigella_phage	99.2	1.2e-62
WP_000661054.1|2285396_2285666_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_074014613.1|2285807_2287643_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	4.5e-307
WP_125933378.1|2287703_2289032_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	1.2e-245
WP_074014615.1|2289028_2290108_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	3.4e-206
WP_001259079.1|2290107_2290656_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	100.0	2.3e-97
WP_000424737.1|2290655_2291081_+	hypothetical protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_074014616.1|2291067_2292126_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.3	5.2e-199
WP_021552270.1|2292116_2292701_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	3.2e-113
WP_074014617.1|2292704_2293628_+	hypothetical protein	NA	U5P0I1	Shigella_phage	97.1	2.7e-50
WP_074014618.1|2293602_2293806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074014619.1|2293771_2294380_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.0	1.9e-100
WP_074014620.1|2294379_2294928_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	61.4	3.2e-51
WP_001514810.1|2295540_2296236_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_074014622.1|2296713_2297814_-	hsdR	NA	NA	NA	NA	NA
WP_040017496.1|2298212_2298815_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	32.7	2.7e-06
WP_077876039.1|2299791_2300391_+	HNH endonuclease	NA	A0A1S6KZY3	Salmonella_phage	35.9	3.9e-10
WP_001111349.1|2300937_2301348_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121335.1|2301326_2302283_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|2302292_2304491_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000643333.1|2304487_2305444_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070694.1|2305440_2306130_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|2306547_2307162_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|2307409_2307739_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001296887.1|2308051_2308762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001355804.1|2308730_2310374_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131079.1|2310363_2312889_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000716398.1|2312914_2313583_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|2313640_2314228_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001296902.1|2314302_2314845_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147277.1|2315667_2315895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|2315929_2316070_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803999.1|2316069_2316333_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|2316695_2316797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092619.1|2317912_2322166_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_001306920.1|2322286_2323144_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|2323733_2324327_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000474077.1|2324338_2324575_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046295.1|2324683_2326009_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
WP_000339593.1|2326234_2327089_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102119.1|2327616_2328336_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023916.1|2328346_2329774_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370308.1|2329766_2330462_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209088.1|2330707_2331373_-	membrane protein	NA	NA	NA	NA	NA
WP_001159102.1|2331585_2333256_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089063.1|2333269_2334742_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001351501.1|2334755_2335343_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|2335471_2337505_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
2347981:2347998	attR	TGCTGGAAAAAGCCAATC	NA	NA	NA	NA
>prophage 5
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	2856208	2957308	4740150	plate,protease,transposase,capsid,terminase,head,tail,portal,lysis,integrase	Salmonella_phage(57.89%)	106	2883199:2883214	2908384:2908399
WP_000399648.1|2856208_2857189_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000168797.1|2857449_2858715_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114244.1|2858866_2859682_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_074014642.1|2859827_2862260_-	glycyl radical protein	NA	A0A1W5N098	Cronobacter_phage	42.0	2.3e-08
WP_001307076.1|2862265_2863165_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001351540.1|2863295_2863958_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	1.6e-25
WP_000829244.1|2864045_2864795_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_000397334.1|2864794_2866030_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_000513752.1|2866233_2867199_+	beta-aspartyl-peptidase	NA	NA	NA	NA	NA
WP_074014643.1|2867185_2869057_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
WP_074014644.1|2869076_2870615_+	glutathione ABC transporter substrate-binding protein GsiB	NA	NA	NA	NA	NA
WP_000936043.1|2870632_2871553_+	glutathione ABC transporter permease GsiC	NA	NA	NA	NA	NA
WP_001236044.1|2871555_2872467_+	glutathione ABC transporter permease GsiD	NA	NA	NA	NA	NA
WP_001307078.1|2872644_2874993_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001676425.1|2875000_2876329_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000049367.1|2876375_2877701_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_000497137.1|2877913_2878297_+	biofilm formation regulator BssR	NA	NA	NA	NA	NA
WP_000555022.1|2878407_2879523_+	aldose sugar dehydrogenase YliI	NA	NA	NA	NA	NA
WP_001295292.1|2879519_2880146_-	glutathione S-transferase GstB	NA	NA	NA	NA	NA
WP_000195961.1|2880392_2881595_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
WP_000450121.1|2881641_2882400_-	DNA-binding transcriptional repressor DeoR	NA	NA	NA	NA	NA
WP_001440570.1|2882457_2883054_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
2883199:2883214	attL	AAATAAAACTTAAAGA	NA	NA	NA	NA
WP_001180096.1|2883338_2884571_+	multidrug efflux MFS transporter MdfA	NA	NA	NA	NA	NA
WP_000480892.1|2884611_2884896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001345670.1|2884980_2885796_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase	NA	NA	NA	NA	NA
WP_000217869.1|2885795_2887004_-	MFS transporter	NA	NA	NA	NA	NA
WP_001297003.1|2887087_2887624_+	DNA-binding transcriptional regulator RcdA	NA	NA	NA	NA	NA
WP_000290950.1|2887728_2888781_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_000900883.1|2888969_2889161_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001346406.1|2889176_2889746_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000188450.1|2889891_2890095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460897.1|2890159_2890669_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956180.1|2890676_2890877_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	6.0e-32
WP_000963473.1|2890840_2891182_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244163.1|2891249_2891483_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	7.0e-32
WP_000752613.1|2891482_2891710_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001580531.1|2891706_2892564_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	6.6e-160
WP_001580532.1|2892560_2894975_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.6	0.0e+00
WP_001580533.1|2895128_2895317_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	95.2	7.9e-26
WP_001580534.1|2895384_2895684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001251691.1|2895792_2896671_-	hypothetical protein	NA	A0A2H4J8D6	uncultured_Caudovirales_phage	49.4	6.1e-52
WP_001580536.1|2897425_2897695_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	42.4	7.6e-14
WP_001580537.1|2897749_2898796_-|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.5	3.4e-174
WP_001580538.1|2898795_2900562_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216248.1|2900704_2901538_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_000742511.1|2901554_2902613_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059191.1|2902616_2903267_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_001580539.1|2903362_2903827_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	5.5e-76
WP_000868175.1|2903826_2904030_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|2904033_2904249_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069913.1|2904229_2904742_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	2.4e-88
WP_000730946.1|2904743_2905121_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.4e-16
WP_001580540.1|2905117_2905546_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.2	2.4e-46
WP_001039945.1|2905641_2906073_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_001580541.1|2906065_2906524_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.5	2.3e-58
WP_024195486.1|2908701_2909280_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.9	4.7e-93
2908384:2908399	attR	TCTTTAAGTTTTATTT	NA	NA	NA	NA
WP_001580545.1|2909276_2909636_+	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	3.6e-51
WP_000268283.1|2909622_2910531_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	4.6e-143
WP_001086849.1|2910523_2911129_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.2e-109
WP_074014646.1|2911125_2912685_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	69.7	1.2e-194
WP_074014647.1|2912684_2913287_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	5.6e-97
WP_074014648.1|2913258_2913699_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	2.1e-53
WP_074014649.1|2913720_2914110_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	5.5e-13
WP_000905027.1|2914140_2914707_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.1e-86
WP_074014650.1|2914849_2916022_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	7.8e-204
WP_001207656.1|2916031_2916547_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.9	5.6e-90
WP_001281009.1|2916601_2916904_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_000763311.1|2916918_2917038_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_064190688.1|2917030_2920108_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.2	0.0e+00
WP_000980391.1|2920104_2920590_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_074014651.1|2920586_2921687_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	85.5	4.5e-177
WP_000972391.1|2921777_2921996_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|2922231_2923917_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|2924186_2924564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|2924593_2924851_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|2925010_2925298_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|2926064_2926967_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|2927054_2927531_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|2927881_2928994_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996025.1|2929088_2930222_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105430.1|2930231_2931185_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|2931181_2932027_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|2932086_2932575_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|2932615_2933743_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|2933917_2934649_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|2934940_2935609_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|2935608_2936325_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|2936331_2937063_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|2937080_2937809_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270735.1|2938026_2938542_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|2938667_2938991_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255146.1|2938987_2939818_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	29.4	1.3e-06
WP_001338420.1|2939814_2940828_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|2940926_2942357_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|2942367_2943369_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815362.1|2943405_2945124_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000178677.1|2945256_2946225_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|2946236_2947889_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|2948032_2948932_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001440575.1|2949426_2950122_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599820.1|2950547_2952206_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|2952202_2953159_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746460.1|2953309_2954425_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_074014652.1|2954421_2956368_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|2956440_2956665_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|2956987_2957308_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 6
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	4135529	4199656	4740150	plate,capsid,holin,head,tail,tRNA,portal,integrase,lysis,terminase	Escherichia_phage(53.19%)	74	4140587:4140614	4172380:4172407
WP_000675148.1|4135529_4136933_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	2.7e-33
WP_000137877.1|4136929_4137652_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|4137842_4138175_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4138383_4138680_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4138681_4138978_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4139080_4140442_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
4140587:4140614	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|4140714_4140933_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_021563752.1|4141014_4142178_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	7.0e-205
WP_021563753.1|4142177_4142657_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.1	7.3e-84
WP_000069934.1|4142671_4145119_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
WP_000785970.1|4145111_4145231_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|4145263_4145539_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_021563754.1|4145595_4146114_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	99.4	9.4e-93
WP_001286716.1|4146126_4147317_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_021563756.1|4147376_4147970_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	1.5e-102
WP_032151675.1|4148000_4148519_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.7	2.8e-57
WP_021563757.1|4148518_4149121_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.0e-99
WP_074014648.1|4149092_4149533_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	2.1e-53
WP_074014709.1|4149554_4150733_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.3	5.9e-159
WP_001285340.1|4150729_4151341_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121487.1|4151333_4152242_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.0	2.2e-161
WP_000127163.1|4152246_4152594_-|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_021563759.1|4152590_4153226_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.7	3.2e-111
WP_001255136.1|4153303_4154059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021563760.1|4154055_4154514_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	62.4	7.8e-43
WP_001774102.1|4154506_4154974_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_001440152.1|4154936_4155110_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001490254.1|4155081_4155507_-|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	95.7	2.1e-66
WP_074014710.1|4155494_4155920_-	protein lysA	NA	M1SV74	Escherichia_phage	93.6	1.6e-53
WP_001144101.1|4155934_4156432_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|4156431_4156713_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846409.1|4156716_4156920_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988636.1|4156919_4157429_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_016239051.1|4157528_4158272_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.6	1.2e-125
WP_074014711.1|4158275_4159349_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.4	9.7e-201
WP_001085948.1|4159407_4160262_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	89.4	1.7e-139
WP_000156863.1|4160435_4162208_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_021530419.1|4162207_4163242_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	9.3e-201
WP_074014712.1|4165668_4167945_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.5	0.0e+00
WP_000027673.1|4167934_4168210_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113264.1|4168206_4168431_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_074014713.1|4169188_4169509_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	5.8e-45
WP_000557703.1|4169508_4169733_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|4169796_4170297_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|4170474_4170750_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|4170871_4171171_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|4171286_4172300_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000716757.1|4172564_4172882_-	hypothetical protein	NA	NA	NA	NA	NA
4172380:4172407	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|4173296_4174196_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178556.1|4174277_4175057_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844264.1|4175156_4176197_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_074014714.1|4176244_4177600_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823287.1|4177603_4177888_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182903.1|4177918_4178371_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853886.1|4178380_4179643_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|4179671_4180526_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|4180833_4181886_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_074014715.1|4182142_4183420_+	MFS transporter	NA	NA	NA	NA	NA
WP_001585875.1|4183416_4184421_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.4e-12
WP_074014716.1|4184417_4185383_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|4185356_4186103_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|4186154_4186973_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
WP_000822270.1|4187037_4187838_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195588.1|4187834_4188623_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|4188845_4189118_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134575.1|4189238_4190063_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|4190281_4190620_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_038993934.1|4190701_4191736_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945407.1|4191751_4194232_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677398.1|4194247_4194922_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|4195002_4195545_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|4195837_4196119_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|4196381_4197491_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|4197622_4199656_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 7
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	4212221	4221663	4740150		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292773.1|4212221_4213358_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
WP_009008075.1|4213354_4215355_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_074014717.1|4215479_4215941_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	5.4e-76
WP_001295430.1|4215981_4216452_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4216498_4217218_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4217214_4218900_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|4219121_4219853_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|4219912_4220020_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4220000_4220732_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569326.1|4220736_4221663_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 8
NZ_CP010242	Escherichia coli strain S56 chromosome, complete genome	4740150	4421150	4493906	4740150	coat,holin,terminase,head,tRNA,portal,lysis,integrase	Enterobacteria_phage(62.07%)	86	4449678:4449694	4496359:4496375
WP_001283581.1|4421150_4421963_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4421962_4422976_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|4423041_4424178_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|4424276_4425272_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127756.1|4425268_4426447_-	MFS transporter	NA	NA	NA	NA	NA
WP_033808570.1|4426739_4427960_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|4428118_4430125_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|4430245_4430524_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|4430557_4431106_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447359.1|4431105_4431915_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043821.1|4431914_4432739_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4432742_4433828_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001298774.1|4433862_4434795_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730816.1|4434960_4435512_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_074014724.1|4435584_4436436_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_074014725.1|4436437_4436977_-	fimbrial protein	NA	NA	NA	NA	NA
WP_032197040.1|4436973_4437462_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018471.1|4437458_4437968_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000482748.1|4437983_4438736_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_074014726.1|4438755_4441401_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|4441482_4442046_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4442729_4443215_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000424992.1|4443417_4445562_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531936.1|4445561_4446872_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030901.1|4447051_4447336_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|4447707_4449048_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_001583729.1|4449414_4450473_+	hypothetical protein	NA	NA	NA	NA	NA
4449678:4449694	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|4450654_4451410_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4451703_4452636_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_000958668.1|4452947_4454105_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	1.3e-222
WP_001543865.1|4454254_4454617_+	GtrA family protein	NA	U5P0S6	Shigella_phage	90.8	4.1e-55
WP_074014727.1|4454613_4455534_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	93.4	1.2e-162
WP_074014728.1|4455530_4456958_+	hypothetical protein	NA	A8CG94	Salmonella_phage	29.4	1.1e-15
WP_047667588.1|4458919_4459180_+	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.7	1.4e-36
WP_074014730.1|4459269_4461663_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	97.1	0.0e+00
WP_074014731.1|4461663_4462995_-	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.5	1.2e-216
WP_074014732.1|4463004_4463697_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	1.2e-111
WP_074014733.1|4463699_4464155_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	8.8e-87
WP_074014734.1|4464154_4465003_-	hypothetical protein	NA	Q716G6	Shigella_phage	99.6	1.1e-103
WP_001122392.1|4465002_4466421_-	Packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.8	1.9e-276
WP_074014735.1|4466430_4466892_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	98.7	3.0e-82
WP_001389518.1|4466872_4467061_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_074014736.1|4467102_4468356_-|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	99.8	7.5e-237
WP_000372575.1|4468374_4469268_-	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
WP_074014737.1|4469358_4471557_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.5	0.0e+00
WP_074014738.1|4471558_4472974_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.6	4.4e-278
WP_000179914.1|4472970_4473396_-	hypothetical protein	NA	Q716H4	Shigella_phage	90.1	3.2e-67
WP_000807788.1|4473475_4473718_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000343115.1|4474012_4474300_-	hypothetical protein	NA	A0A1P8DTP0	Salmonella_phage	60.0	1.8e-29
WP_001139676.1|4474378_4474531_-	hypothetical protein	NA	A0A088CQ22	Enterobacteria_phage	100.0	1.2e-21
WP_021571391.1|4474518_4474956_-|lysis	lysis protein	lysis	K7PJN9	Enterobacteria_phage	97.9	1.4e-70
WP_000229392.1|4474952_4475429_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|4475412_4475736_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235462.1|4476170_4476794_-	antitermination protein	NA	A0A088CQ66	Enterobacteria_phage	100.0	3.0e-114
WP_000994516.1|4476790_4476979_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_025748958.1|4476975_4477338_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	99.2	3.5e-62
WP_025748957.1|4477334_4477625_-	DUF1364 domain-containing protein	NA	A0A192Y6R9	Salmonella_phage	97.9	1.9e-50
WP_001286917.1|4477617_4477830_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_000950943.1|4477822_4477999_-	protein ninF	NA	A0A220NRM2	Escherichia_phage	98.3	2.5e-26
WP_074014739.1|4477998_4478352_-	DUF2591 domain-containing protein	NA	K7PH48	Enterobacterial_phage	73.0	3.4e-38
WP_001254255.1|4478354_4478531_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000153280.1|4478527_4479055_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736913.1|4479051_4479492_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001549089.1|4479568_4481005_-	AAA family ATPase	NA	K7PGR8	Enterobacteria_phage	100.0	7.9e-275
WP_074014740.1|4480994_4481885_-	DNA replication protein	NA	G5DA89	Enterobacteria_phage	98.3	8.4e-158
WP_015980141.1|4482065_4482362_-	cII protein	NA	Q37927	Escherichia_phage	100.0	1.8e-48
WP_001535911.1|4482483_4482714_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	100.0	7.9e-36
WP_024226607.1|4482793_4483501_+	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	100.0	4.8e-132
WP_001077327.1|4483848_4484073_+	hypothetical protein	NA	K7PJZ1	Enterobacterial_phage	100.0	8.0e-33
WP_025748951.1|4484128_4484425_+	hypothetical protein	NA	K7PH98	Enterobacteria_phage	95.9	4.0e-48
WP_000972063.1|4484766_4484901_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001525234.1|4484885_4485038_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.8e-20
WP_024215528.1|4485122_4485431_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	98.0	1.6e-52
WP_032174196.1|4485427_4486339_+	DNA recombinase	NA	K7PKG9	Enterobacteria_phage	99.7	1.7e-169
WP_023241301.1|4486322_4486805_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	98.1	3.2e-79
WP_000753556.1|4486816_4487131_+	hypothetical protein	NA	K7P7J8	Enterobacteria_phage	99.0	3.5e-50
WP_001214456.1|4487147_4487312_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_074014742.1|4487308_4487791_+	hypothetical protein	NA	K7P7V4	Enterobacteria_phage	99.4	4.3e-84
WP_069906054.1|4487787_4488087_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	2.4e-56
WP_001033100.1|4488088_4488496_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	7.4e-69
WP_032082902.1|4488698_4488980_+	hypothetical protein	NA	A0A0K2FIU9	Enterobacteria_phage	98.9	8.2e-51
WP_000545733.1|4489068_4489236_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001163428.1|4489293_4489494_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001197023.1|4490023_4491271_-	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001274887.1|4491342_4492257_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|4492472_4493906_+	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
4496359:4496375	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 1
NZ_CP010243	Escherichia coli strain S56 plasmid A, complete sequence	131504	1905	77724	131504	transposase,integrase	Escherichia_phage(34.38%)	57	50586:50645	82937:83993
WP_074014773.1|1905_3243_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001447541.1|3273_4158_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214121.1|4374_5589_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.3	8.0e-18
WP_001255015.1|5616_5922_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001493764.1|7491_8142_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000844627.1|8173_8416_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_012477564.1|8533_9124_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_001493762.1|9260_9833_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.4	3.4e-19
WP_001493761.1|9869_11261_+|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
WP_001516695.1|12040_12697_-	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001067852.1|17048_17753_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_072075519.1|17788_18232_+	replication initiation protein	NA	NA	NA	NA	NA
WP_001749988.1|19108_19678_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_000845048.1|20070_21084_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_004201280.1|21239_21713_+	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_001067855.1|21959_22664_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000427619.1|24560_25565_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_000954592.1|25746_25923_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|26252_27068_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|27128_27932_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|27931_28768_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001120891.1|28739_29279_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000027057.1|29488_30349_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001235713.1|30531_31089_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_001067852.1|31482_32187_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	4.0e-139
WP_000633445.1|32249_33338_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	61.7	9.7e-124
WP_000208728.1|33483_34443_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000750473.1|34545_34956_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000331736.1|35055_35781_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	42.2	4.4e-40
WP_074014774.1|36622_40675_+	helicase	NA	Q1MVN7	Enterobacteria_phage	97.7	0.0e+00
WP_023352064.1|40708_41149_+	hypothetical protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
WP_000747846.1|41145_41394_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_000452096.1|42388_43078_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001514450.1|43131_43776_-	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	86.3	1.7e-96
WP_074014775.1|43964_44525_-	Ref family protein	NA	Q71TG3	Escherichia_phage	98.4	6.5e-100
WP_038989442.1|44772_45084_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
WP_074014776.1|45134_46166_-|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	4.2e-193
WP_000542336.1|46173_46395_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	100.0	4.5e-36
WP_021559276.1|47031_48012_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	5.7e-184
WP_000874156.1|49290_49500_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611664.1|49610_50462_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	100.0	1.2e-158
50586:50645	attL	CGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCCTCCC	NA	NA	NA	NA
WP_000654811.1|50618_51587_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_074014777.1|53714_54221_-	3'-phosphatase	NA	A0A1B0VAK0	Salmonella_phage	98.2	2.3e-91
WP_074014778.1|54293_55556_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	97.4	2.0e-229
WP_000578338.1|57082_57817_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094888184.1|58119_59393_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.3	6.8e-169
WP_074014781.1|60233_63707_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_059039599.1|64746_66093_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	30.0	4.0e-26
WP_074014782.1|66836_68987_-	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_074014783.1|69050_71156_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_074014784.1|72493_72766_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_074014785.1|73854_74238_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	32.6	2.0e-07
WP_074014786.1|74234_75182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077898217.1|75184_75796_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_074014788.1|76411_76696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074014789.1|76722_76863_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001066941.1|76983_77724_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
82937:83993	attR	CGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGATCACGCATCCTCCCGACAACACAGACCATTCCGTGGCAAAGCAAAAGTTCAGAATCACCAACTGGTCCACCTACAACAAAGCTCTCATCAACCGTGGCTCCCTCACTTTCTGGCTGGATGATGAGGCGATTCAGGCCTGGTATGAGTCGGCAACGCCTTCATCACGAGGAAGGCCCCAGCGCTATTCTGATCTCGCCATCACCACCGTTCTGGTGATTAAACGCGTATTCCGGCTGACCCTGCGGGCTGCGCAGGGTTTTATTGATTCCATTTTTGCCCTGATGAACGTTCCGTTGCGCTGCCCGGATTACACCAGTGTCAGTAAGCGGGCAAAGTCGGTTAATGTCAGTTTCAAAACGTCCACCCGGGGTGAAATCGCACACCTGGTGATTGATTCCACCGGGCTGAAGGTCTTTGGTGAAGGCGAATGGAAAGTCAGAAAGCACGGCAAAGAGCGCCGTCGTATCTGGCGAAAGTTGCATCTTGCTGTTGACAGCAACACACATGAAGTTGTCTGTGCAGACCTGTCGCTGAATAACGTCACGGACTCAGAAGCCTTCCCGGGCCTTATCCGGCAGACTCACAGAAAAATCAGGGCAGCCGCGGCAGACGGGGCTTACGATACCCGGCTCTGTCACGATGAACTGCGCCGCAAAAAAATCAGCGCGCTTATTCCTCCTCGAAAAGGAGCAGGTTACTGGCCCGGTGAGTACGCAGACCGCAACCGTGCCGTTGCTAATCAGCGGCTGAGCGGAAGCAATGCACGGTGGAAATGGACAACGGAATATAACCGTCGCTCGATAGCGGAAACGGCAATGTACAGAATGAAGCAGTTGTTGGGAGATTCACTGACGCTGCGTGACTACGATGGTCAGGTAGCGGAAGCTATGGCCATGGTGCGTGCGTTGAACAGGATGACAAAGGCTGGGATGCCAGAAAGCGTGCGTATTGCCTGAAAATCCAGCCAGCTACAGGGTCGTTCGCACGAAATCTTATTTATTCAACAAAGCC	NA	NA	NA	NA
>prophage 2
NZ_CP010243	Escherichia coli strain S56 plasmid A, complete sequence	131504	88574	106837	131504	transposase,integrase	Escherichia_phage(58.82%)	19	81554:81568	108150:108164
81554:81568	attL	ATCAGATGGAAATCA	NA	NA	NA	NA
WP_072752463.1|88574_89363_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	94.7	7.8e-115
WP_001642860.1|89534_89825_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	86.5	1.9e-34
WP_000336812.1|89850_89991_+	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_001281115.1|90000_90393_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_001113742.1|90728_91613_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_032247076.1|91905_92715_+	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	98.1	3.2e-156
WP_001285362.1|92883_94080_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|94096_95098_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_074014794.1|95323_97030_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.6	0.0e+00
WP_074014795.1|97089_98679_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	98.1	4.9e-302
WP_074014796.1|98688_99504_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	5.4e-111
WP_074014797.1|99539_100121_+	hypothetical protein	NA	A0A077SL48	Escherichia_phage	96.9	1.8e-100
WP_001615627.1|100132_100642_+	hypothetical protein	NA	A0A077SK14	Escherichia_phage	100.0	1.7e-91
WP_074014798.1|100801_101914_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001352007.1|102107_102263_-	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_074014799.1|102919_104071_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	5.8e-42
WP_074014801.1|105013_106090_+|transposase	IS110-like element ISEc21 family transposase	transposase	NA	NA	NA	NA
WP_153072277.1|106344_106566_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	76.7	4.2e-18
WP_000091098.1|106606_106837_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	96.1	1.8e-35
108150:108164	attR	TGATTTCCATCTGAT	NA	NA	NA	NA
>prophage 1
NZ_CP010244	Escherichia coli strain S56 plasmid B, complete sequence	113250	1473	113212	113250	integrase,tail	Salmonella_phage(92.55%)	115	5415:5440	107575:107600
WP_006812537.1|1473_1677_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	97.0	6.8e-31
WP_074014813.1|1732_2431_-	DUF1311 domain-containing protein	NA	J9Q6K3	Salmonella_phage	89.2	3.5e-111
WP_074014814.1|2469_2685_-	hypothetical protein	NA	J9Q748	Salmonella_phage	83.1	4.2e-31
WP_072650124.1|2731_2971_-	hypothetical protein	NA	J9Q801	Salmonella_phage	93.0	1.2e-23
WP_074014815.1|3715_5401_-	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	96.3	0.0e+00
5415:5440	attL	AACAAATTGTTTTCTTGTTGGTGTTA	NA	NA	NA	NA
WP_063085679.1|5572_5992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074014816.1|6017_6590_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	96.8	3.2e-94
WP_074014817.1|6707_6896_-	hypothetical protein	NA	J9Q800	Salmonella_phage	95.2	9.7e-24
WP_162780225.1|7801_7948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077898220.1|8136_8685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025670509.1|9694_9925_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	97.3	3.3e-34
WP_074014818.1|10127_10721_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	99.0	3.0e-111
WP_077780009.1|10876_11833_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	80.3	1.9e-99
WP_025670512.1|11877_12432_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	95.1	2.8e-95
WP_025670513.1|12441_12861_-	hypothetical protein	NA	J9Q743	Salmonella_phage	95.7	4.6e-66
WP_053292503.1|12924_13569_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	96.3	2.7e-113
WP_162780226.1|13568_14039_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	96.2	1.0e-85
WP_160956520.1|14041_14437_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	97.7	3.6e-68
WP_033546603.1|14456_15560_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	99.7	4.3e-220
WP_074014820.1|15739_16618_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	98.6	3.4e-159
WP_025670519.1|16883_17453_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	80.4	7.9e-85
WP_033546602.1|17783_18530_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	92.3	2.9e-127
WP_161953761.1|18519_19023_-	SMC family ATPase	NA	J9Q741	Salmonella_phage	98.2	9.1e-85
WP_032187693.1|20665_21751_-	exonuclease	NA	J9Q7S9	Salmonella_phage	97.8	2.5e-204
WP_032187692.1|22147_22792_-	hypothetical protein	NA	J9Q739	Salmonella_phage	98.1	1.8e-122
WP_001711119.1|23534_24590_+	replication protein RepA	NA	J9Q7H0	Salmonella_phage	93.8	3.3e-177
WP_074014823.1|25199_25412_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	92.9	1.1e-31
WP_023135694.1|25411_25747_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	84.5	4.5e-48
WP_023135695.1|25743_25923_-	hypothetical protein	NA	J9Q6J1	Salmonella_phage	81.4	1.6e-15
WP_074014824.1|25961_26237_-	hypothetical protein	NA	J9Q738	Salmonella_phage	90.1	4.2e-44
WP_074014825.1|27117_30135_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_074014826.1|30149_31313_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_077898225.1|31322_32642_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_074014827.1|32666_35099_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	7.9e-25
WP_001711109.1|35526_35727_-	membrane protein	NA	J9Q6J0	Salmonella_phage	54.5	1.8e-07
WP_074014828.1|35817_38157_-	recombinase RecA	NA	J9Q736	Salmonella_phage	87.8	4.6e-30
WP_000920226.1|38159_38426_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	100.0	1.6e-40
WP_074014829.1|38425_39370_-	exonuclease	NA	J9Q7S6	Salmonella_phage	98.7	5.7e-181
WP_023135729.1|39430_40447_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	98.7	5.8e-163
WP_053292493.1|40566_40998_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	98.6	5.8e-72
WP_063122719.1|41107_41668_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	84.4	1.9e-78
WP_074014830.1|41696_45203_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	92.8	0.0e+00
WP_023135733.1|45383_46619_-	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	98.8	1.3e-236
WP_074014831.1|46714_48943_-	porphyrin biosynthesis protein	NA	J9Q7G6	Salmonella_phage	84.1	0.0e+00
WP_032187681.1|49055_49268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074014832.1|49524_49914_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003980691.1|49908_51012_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.9	1.9e-26
WP_032187680.1|51311_51827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074014833.1|52899_53205_-	C-type natriuretic protein	NA	J9Q7S1	Salmonella_phage	89.1	8.0e-44
WP_074014834.1|53353_53566_-	hypothetical protein	NA	J9Q6I3	Salmonella_phage	91.4	4.6e-30
WP_074014835.1|53725_55048_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	97.7	7.1e-254
WP_024172745.1|55082_55340_-	hypothetical protein	NA	J9Q7R9	Salmonella_phage	87.1	1.7e-31
WP_074014836.1|55640_56453_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	84.8	1.4e-122
WP_074014839.1|58240_58789_+	fimbrial protein YehD	NA	NA	NA	NA	NA
WP_032187672.1|58844_59525_+	fimbrial assembly chaperone	NA	NA	NA	NA	NA
WP_074014840.1|59542_62029_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_032187670.1|62039_63050_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001603498.1|63234_63456_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_032187669.1|63455_63833_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	1.6e-57
WP_023135654.1|63966_65151_-	hypothetical protein	NA	J9Q720	Salmonella_phage	94.9	9.6e-210
WP_074014841.1|65238_66579_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.9	1.5e-246
WP_032187666.1|66639_67365_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	1.3e-137
WP_001711193.1|67647_68415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161953766.1|68467_68821_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_023135658.1|68826_69492_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	98.2	2.0e-116
WP_001711191.1|69811_70081_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_074014842.1|70088_70610_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023135660.1|70778_71030_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	65.1	1.0e-20
WP_024172707.1|71032_71725_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	90.0	2.7e-119
WP_074014843.1|71738_72062_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	72.9	3.6e-34
WP_074014844.1|72195_72777_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	3.4e-99
WP_162780227.1|72776_75842_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	57.4	2.1e-75
WP_077898223.1|75977_80561_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	84.6	0.0e+00
WP_074014848.1|80572_81166_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	93.4	2.2e-101
WP_074014849.1|81153_81951_-|tail	phage tail protein	tail	J9Q7R4	Salmonella_phage	96.2	4.9e-157
WP_074014850.1|81940_82642_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	99.1	4.2e-136
WP_000442113.1|82724_83060_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_074014851.1|83102_87674_-	tape measure protein	NA	J9Q712	Salmonella_phage	84.8	0.0e+00
WP_000952684.1|87681_87906_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	100.0	4.2e-34
WP_000163862.1|88031_88349_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	98.1	6.0e-50
WP_032187301.1|88408_89155_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	97.6	2.6e-128
WP_032187303.1|89229_89613_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	96.9	2.5e-66
WP_032187304.1|89614_90088_-	hypothetical protein	NA	J9Q711	Salmonella_phage	96.8	1.4e-79
WP_032187305.1|90078_90423_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	1.5e-54
WP_032187306.1|90520_91354_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	96.0	1.1e-148
WP_032187307.1|91353_91788_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	93.8	3.2e-70
WP_032187308.1|91831_92260_-	Ig-like domain-containing protein	NA	J9Q6D6	Salmonella_phage	57.2	2.3e-52
WP_032187309.1|92334_93210_-	hypothetical protein	NA	J9Q710	Salmonella_phage	98.6	4.2e-162
WP_074014852.1|93236_94133_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	95.0	1.7e-145
WP_074014853.1|94155_95730_-	hypothetical protein	NA	J9Q7R1	Salmonella_phage	97.3	4.0e-296
WP_023135663.1|95763_97020_-	hypothetical protein	NA	J9Q7Y2	Salmonella_phage	99.5	9.1e-251
WP_074014854.1|97022_97664_-	DNA-binding protein	NA	J9Q6D4	Salmonella_phage	98.6	1.2e-108
WP_006812518.1|97860_98127_-	hypothetical protein	NA	J9Q757	Salmonella_phage	98.9	5.0e-42
WP_074014855.1|98136_99027_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	99.0	1.5e-167
WP_074014856.1|99032_99287_-	hypothetical protein	NA	J9Q7U0	Salmonella_phage	97.6	1.2e-40
WP_074014857.1|99279_99918_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	99.5	1.4e-111
WP_074014858.1|99914_100583_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	99.1	4.3e-114
WP_074014859.1|100582_101281_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	97.0	9.0e-123
WP_074014860.1|101345_102905_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	98.5	1.7e-291
WP_074014861.1|102907_103186_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	92.3	7.8e-38
WP_124831784.1|103248_103788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074014862.1|104086_104677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033870681.1|104676_105201_+	transcriptional regulator	NA	J9Q6L0	Salmonella_phage	69.4	3.0e-54
WP_074014863.1|105515_106166_+	hypothetical protein	NA	J9Q754	Salmonella_phage	96.3	1.1e-111
WP_074014864.1|106216_106447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009192.1|107070_107553_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_077898224.1|107903_108314_-	hypothetical protein	NA	NA	NA	NA	NA
107575:107600	attR	AACAAATTGTTTTCTTGTTGGTGTTA	NA	NA	NA	NA
WP_063122768.1|108395_108791_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	64.6	6.8e-43
WP_001711135.1|108912_109224_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.0e-30
WP_032187826.1|109384_109714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162521988.1|109853_110069_-	hypothetical protein	NA	J9Q804	Salmonella_phage	91.5	5.0e-32
WP_072663008.1|111660_112221_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023135687.1|112306_112624_-	hypothetical protein	NA	J9Q750	Salmonella_phage	81.9	4.3e-48
WP_023135688.1|112623_112860_-	DUF1380 domain-containing protein	NA	J9Q7H8	Salmonella_phage	94.9	1.8e-38
WP_023135689.1|112945_113212_-	hypothetical protein	NA	J9Q7T5	Salmonella_phage	71.6	6.8e-31
