The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	113	17877	5310035	integrase,protease,transposase	Enterobacteria_phage(51.72%)	33	12897:12911	27335:27349
WP_001097230.1|113_803_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.5	2.4e-59
WP_032160865.1|817_940_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|1278_2238_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028842.1|2449_3115_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	96.8	8.8e-128
WP_001108038.1|3111_3723_-	recombination protein NinG	NA	Q716C3	Shigella_phage	99.5	6.0e-99
WP_000566868.1|3715_3886_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254222.1|3882_4065_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_000153263.1|4061_4589_-	phage N-6-adenine-methyltransferase	NA	Q8H9Z7	Enterobacteria_phage	99.4	8.0e-100
WP_000736898.1|4585_5026_-	recombination protein NinB	NA	Q8H9Z8	Enterobacteria_phage	100.0	4.1e-81
WP_000145931.1|5099_5390_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788866.1|5386_6088_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	1.4e-128
WP_000185509.1|6084_6984_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	2.5e-170
WP_000251073.1|7016_7310_-	lambda phage CII family protein	NA	K7P6Y2	Enterobacteria_phage	100.0	2.8e-46
WP_162830753.1|7434_8647_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	4.5e-170
WP_001194218.1|8742_8958_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028394.1|9061_9694_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.0	4.6e-118
WP_000618038.1|9690_10095_+	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	7.3e-69
WP_000332935.1|10314_10770_+	antitermination protein N	NA	J3JZZ6	Escherichia_phage	92.2	6.3e-61
WP_001299183.1|10778_11648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000065374.1|11836_12205_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_024244115.1|12277_12442_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	1.5e-25
WP_000372923.1|12410_12554_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995449.1|12628_12925_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
12897:12911	attL	ATCAGGTTGATATTG	NA	NA	NA	NA
WP_000100844.1|12930_13716_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186784.1|13712_14393_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_000149544.1|14389_14572_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|14544_14736_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188870.1|14812_15028_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763378.1|15126_15348_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_000120063.1|15558_16161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|16403_16571_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|16610_16829_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|16806_17877_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
27335:27349	attR	ATCAGGTTGATATTG	NA	NA	NA	NA
>prophage 2
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	234280	299057	5310035	tRNA,transposase,tail,head,lysis,terminase,protease,capsid,integrase,portal	Enterobacteria_phage(57.69%)	68	242761:242807	288851:288897
WP_000394594.1|234280_235417_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383901.1|235685_237923_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662366.1|237909_240882_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224569.1|240882_241773_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|241955_242717_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
242761:242807	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201825.1|243229_244183_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226378.1|244369_245854_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239874.1|246399_247068_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|247433_247547_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|247615_247849_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087133.1|248167_248758_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.9	2.1e-24
WP_000885588.1|248855_249431_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	6.9e-105
WP_001230343.1|252409_253009_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_073520344.1|253075_256474_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_001309913.1|256534_257182_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_000140729.1|257079_257823_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	7.0e-150
WP_001152638.1|257828_258527_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	6.6e-134
WP_000847321.1|258526_258856_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	8.9e-57
WP_073520345.1|258852_261414_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.6	0.0e+00
WP_000459457.1|261406_261841_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|261822_262245_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001298904.1|262260_263001_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000683105.1|263008_263404_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975070.1|263400_263979_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|263990_264344_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000158905.1|264355_264754_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000063280.1|264795_265821_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_001297109.1|265876_266209_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000123314.1|266218_267538_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001297098.1|267518_269120_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_073519252.1|269116_269323_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	3.8e-29
WP_001027292.1|269319_271245_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000453580.1|271219_271765_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001298906.1|272153_272348_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_001031427.1|272512_272719_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298896.1|273004_273415_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738500.1|273705_273999_+	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001228697.1|274089_274272_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_001135281.1|274488_274986_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_000670959.1|274985_275201_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_000737283.1|275789_276887_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_001204780.1|277076_277460_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001061438.1|278004_278814_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	100.0	8.2e-152
WP_000767117.1|278833_279223_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	100.0	7.1e-69
WP_000210187.1|279219_279546_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	100.0	1.6e-53
WP_000066917.1|279542_280196_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_001305611.1|280195_280690_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000104954.1|280686_281628_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_001250269.1|281617_281797_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|281972_282524_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|282516_282777_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|282874_283567_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000559922.1|283886_284402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135682.1|284872_285235_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|285300_286125_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008165.1|286252_286789_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_001242707.1|286779_287142_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000206810.1|287141_287447_+	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	2.2e-49
WP_001298992.1|287673_288837_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000805428.1|289171_289804_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
288851:288897	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001250422.1|289806_290322_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691050.1|290332_291340_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000988366.1|293991_294684_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|294903_295446_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729160.1|295926_296793_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|296794_297007_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|297114_297636_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|297671_299057_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 3
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	1078910	1136495	5310035	integrase,tRNA,protease,transposase	Vibrio_phage(15.38%)	55	1104291:1104305	1135797:1135811
WP_000811566.1|1078910_1079186_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299244.1|1079302_1080928_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943987.1|1081011_1082175_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_000101648.1|1082177_1082816_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1082825_1083224_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1083241_1083901_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1083951_1084650_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1084668_1085070_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1085196_1085928_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076326.1|1086107_1088549_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	4.9e-67
WP_001177639.1|1088587_1089013_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1089217_1090516_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1090619_1090817_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1090898_1091903_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312490.1|1091905_1093165_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|1093250_1094531_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|1094606_1094915_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|1095000_1095951_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001122507.1|1095943_1097791_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990321.1|1097800_1099138_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|1099156_1099618_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_073519262.1|1099589_1101137_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001294219.1|1101135_1102275_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|1102257_1102311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|1103053_1103599_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041970.1|1103693_1104746_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
1104291:1104305	attL	CCGCTGGAAGAGGCG	NA	NA	NA	NA
WP_000934935.1|1104842_1105811_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236850.1|1105832_1109156_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001300174.1|1109306_1110809_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004771.1|1111027_1112005_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
WP_001192991.1|1112329_1114138_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|1114130_1114865_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|1114875_1115271_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_001299198.1|1115281_1115641_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001299193.1|1115703_1116837_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238378.1|1116925_1117459_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|1117455_1117773_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|1117954_1118101_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|1118211_1118337_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|1118388_1118955_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940530.1|1118996_1120025_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008071.1|1120414_1121284_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000399648.1|1121532_1122513_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000558209.1|1122765_1123119_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|1123256_1124903_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|1124946_1125240_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015837.1|1125515_1126772_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|1126787_1127264_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|1127600_1129037_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|1129154_1130456_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|1130571_1130910_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068978.1|1130885_1132583_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|1132619_1133195_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001218841.1|1133574_1134840_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	2.7e-77
WP_000998055.1|1134956_1136495_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	1.9e-298
1135797:1135811	attR	CGCCTCTTCCAGCGG	NA	NA	NA	NA
>prophage 4
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	2352059	2420311	5310035	integrase,protease,transposase	Klebsiella_phage(25.0%)	60	2340312:2340328	2394974:2394990
2340312:2340328	attL	ATGCCTTCCGGGATTTC	NA	NA	NA	NA
WP_000290292.1|2352059_2353376_+|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	28.6	3.9e-34
WP_000268404.1|2353505_2354102_+	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_000256686.1|2354184_2355789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000265817.1|2356567_2356795_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001371780.1|2356857_2357604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300090.1|2357885_2358386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000628304.1|2358774_2359389_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_176720138.1|2359482_2359983_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_162829813.1|2360186_2361415_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	4.1e-171
WP_162830753.1|2361560_2362773_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	4.5e-170
WP_089616010.1|2363570_2364778_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	60.8	1.8e-94
WP_000283011.1|2364970_2365153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519274.1|2365483_2366356_+	GTPase family protein	NA	NA	NA	NA	NA
WP_024234457.1|2366726_2369576_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_000206663.1|2370812_2371298_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.7	1.2e-12
WP_001186706.1|2371313_2371790_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|2371852_2372074_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001285579.1|2372153_2372522_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_001094452.1|2372611_2372986_+	toxin	NA	NA	NA	NA	NA
WP_000976868.1|2372982_2373474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000772035.1|2373485_2373683_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290259.1|2373779_2374622_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000942795.1|2374902_2375439_-	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_000094974.1|2375440_2376619_-	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000633238.1|2376615_2377593_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_001255040.1|2377595_2378195_-	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000820127.1|2378191_2378563_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001115139.1|2378559_2379123_-	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_001087296.1|2379126_2379582_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001173448.1|2379598_2380822_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_000249356.1|2380821_2382315_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_000498824.1|2382314_2384375_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000135071.1|2384404_2385364_-	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001298744.1|2385381_2385792_-	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000895880.1|2385857_2386667_-	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001034515.1|2386796_2391362_-|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_000259287.1|2391846_2393529_-	glycolate permease GlcA	NA	NA	NA	NA	NA
WP_000084055.1|2393883_2396055_-	malate synthase G	NA	NA	NA	NA	NA
2394974:2394990	attR	ATGCCTTCCGGGATTTC	NA	NA	NA	NA
WP_000853256.1|2396076_2396481_-	protein GlcG	NA	NA	NA	NA	NA
WP_001194680.1|2396485_2397709_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_000943059.1|2397719_2398772_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_000026117.1|2398771_2400271_-	glycolate oxidase subunit GlcD	NA	NA	NA	NA	NA
WP_001297764.1|2400521_2401286_+	transcriptional regulator GlcC	NA	NA	NA	NA	NA
WP_001298750.1|2401292_2402435_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000262942.1|2402796_2404527_+	fatty acyl-AMP ligase	NA	NA	NA	NA	NA
WP_001077137.1|2404523_2405438_+	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000248097.1|2405469_2405718_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_000524964.1|2405717_2406890_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.1	7.9e-39
WP_001298753.1|2406924_2408004_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000779675.1|2408000_2409071_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001298770.1|2409101_2409662_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000984977.1|2409673_2410498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896880.1|2410497_2411847_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_000339532.1|2411892_2412651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076237.1|2412682_2413396_-	thymidylate kinase	NA	NA	NA	NA	NA
WP_001190782.1|2413569_2414262_+	thymidylate kinase	NA	NA	NA	NA	NA
WP_000933299.1|2414310_2415810_-	inorganic phosphate transporter PitB	NA	NA	NA	NA	NA
WP_001297309.1|2416101_2417961_-	bifunctional glutathionylspermidine amidase/synthase	NA	NA	NA	NA	NA
WP_001298746.1|2418165_2419032_+	glutathione-dependent disulfide-bond oxidoreductase	NA	NA	NA	NA	NA
WP_000399648.1|2419330_2420311_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	2805746	2812886	5310035		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2805746_2806385_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590407.1|2806381_2807644_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	1.4e-134
WP_000847985.1|2807640_2808549_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|2808744_2809512_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_073519285.1|2809562_2810219_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	2.8e-49
WP_073519286.1|2810324_2812886_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 6
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	2890829	2972844	5310035	transposase,tail,lysis,protease,integrase,portal	Enterobacteria_phage(38.33%)	88	2884039:2884098	2972851:2972999
2884039:2884098	attL	CTGATCTTACCCAGCAATAGTGGACACGCGGCTAAGTGAGTAAACTCTCAGTCAGAGGTG	NA	NA	NA	NA
WP_073519287.1|2890829_2891999_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	67.0	6.7e-147
WP_073519288.1|2891959_2892166_-	excisionase	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_001242718.1|2892437_2892800_-	phage protein	NA	K7PH61	Enterobacteria_phage	99.2	3.6e-67
WP_032219792.1|2892790_2893327_-	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	98.3	2.4e-99
WP_000081280.1|2893454_2894279_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_000135680.1|2894344_2894707_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000859462.1|2895393_2896068_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|2896158_2896359_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|2896402_2896954_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087326.1|2896950_2897787_+	ash family protein	NA	Q8SBF3	Shigella_phage	99.6	3.2e-151
WP_000933949.1|2897779_2898016_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	93.6	2.8e-36
WP_000061487.1|2898012_2898831_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	87.8	6.2e-123
WP_001305611.1|2898827_2899322_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_000066917.1|2899321_2899975_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_053918604.1|2899971_2900298_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	2.9e-52
WP_000767118.1|2900294_2900684_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	98.4	3.0e-67
WP_001061380.1|2900703_2901513_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	98.9	2.8e-152
WP_001360050.1|2901520_2902510_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001047112.1|2902523_2903276_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_000217632.1|2903556_2903982_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000917724.1|2904205_2904409_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|2904559_2905612_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|2905679_2905895_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|2905894_2906392_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|2906388_2906856_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_077898315.1|2906843_2906996_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	6.2e-21
WP_001205130.1|2907137_2907314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|2907671_2908166_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001072975.1|2910265_2910478_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001459763.1|2910477_2911953_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_077898316.1|2911930_2913958_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001283153.1|2914361_2914637_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_073519300.1|2914648_2915239_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	2.7e-80
WP_001079398.1|2915235_2915637_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|2915648_2916392_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|2916452_2916839_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|2916847_2917177_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_073520350.1|2917148_2920214_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447247.1|2920213_2920543_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_073520351.1|2920552_2921248_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	3.6e-132
WP_001302649.1|2921267_2921588_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2921694_2921868_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001434463.1|2921938_2922862_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	97.7	3.9e-174
WP_000967259.1|2922916_2923654_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.3	7.2e-139
WP_028127181.1|2923551_2924193_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
WP_153274582.1|2924265_2924604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520352.1|2924670_2928069_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.9	0.0e+00
WP_001230388.1|2928135_2928735_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_000279086.1|2928799_2930113_+|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001023455.1|2930114_2930384_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000767050.1|2930604_2931147_+	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_106420821.1|2931091_2931286_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	84.6	4.1e-09
WP_001131653.1|2931276_2931858_+	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	64.2	5.1e-63
WP_001002867.1|2932058_2932757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001121567.1|2932769_2933423_-	EspJ family T3SS effector ADP-ribosyltransferase	NA	NA	NA	NA	NA
WP_001264955.1|2933900_2934929_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|2934901_2935594_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|2935723_2936896_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062104.1|2936895_2939442_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_000209866.1|2939438_2940038_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|2940130_2940436_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|2940435_2941356_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
WP_001044280.1|2943166_2944408_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_001143120.1|2944445_2944673_-	YccJ family protein	NA	NA	NA	NA	NA
WP_001151437.1|2944693_2945290_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001273658.1|2945662_2945836_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001299028.1|2945918_2947247_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	6.3e-234
WP_001028095.1|2947267_2947762_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001001186.1|2947772_2948363_-	malonic semialdehyde reductase	NA	NA	NA	NA	NA
WP_001299038.1|2948372_2949173_-	pyrimidine utilization protein D	NA	NA	NA	NA	NA
WP_001126780.1|2949180_2949567_-	pyrimidine utilization protein C	NA	NA	NA	NA	NA
WP_001387701.1|2949578_2950271_-	peroxyureidoacrylate/ureidoacrylate amidohydrolase RutB	NA	NA	NA	NA	NA
WP_001297176.1|2950270_2951362_-	pyrimidine utilization protein A	NA	NA	NA	NA	NA
WP_000191700.1|2951649_2952288_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_001299042.1|2952327_2956290_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000979513.1|2956344_2956554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001018486.1|2956712_2958221_+	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_001323669.1|2958425_2958728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497942.1|2958763_2959594_+	FTR1 family protein	NA	NA	NA	NA	NA
WP_000154414.1|2959651_2960779_+	iron uptake system protein EfeO	NA	NA	NA	NA	NA
WP_001199172.1|2960784_2962056_+	deferrochelatase/peroxidase EfeB	NA	NA	NA	NA	NA
WP_000533522.1|2962674_2963463_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_001061095.1|2963512_2963926_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_000610451.1|2963927_2965253_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_000945561.1|2965245_2967264_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_000287458.1|2967272_2969696_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_000409849.1|2970282_2971641_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
WP_085947771.1|2971681_2972844_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
2972851:2972999	attR	CACCTCTGACTGAGAGTTTACTCACTTAGCCGCGTGTCCACTATTGCTGGGTAAGATCAGGCGGTTAAAGGCATCAACCGCGAACAACTGCAGACGATGATTACGGAATCAGGCATTGCGCTGGATATTAGCTGTGATAACACGCCGCG	NA	NA	NA	NA
>prophage 7
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	3060803	3126734	5310035	tRNA,transposase,tail,head,terminase,capsid,integrase,holin	Escherichia_phage(28.3%)	74	3055897:3055911	3062378:3062392
3055897:3055911	attL	GATCGCGATGTACGC	NA	NA	NA	NA
WP_000074983.1|3060803_3061922_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|3061890_3062160_-	excisionase	NA	NA	NA	NA	NA
WP_000048520.1|3062221_3064693_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
3062378:3062392	attR	GCGTACATCGCGATC	NA	NA	NA	NA
WP_001090200.1|3064785_3064977_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|3064973_3065162_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001340038.1|3065562_3065727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171974.1|3065730_3065949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379575.1|3066108_3066264_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_014966210.1|3066533_3066824_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000100896.1|3066823_3067015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000823909.1|3067032_3067533_-	helix-turn-helix transcriptional regulator	NA	A0A0U2QW76	Escherichia_phage	54.5	1.4e-16
WP_001048458.1|3067640_3067916_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000693918.1|3067899_3068325_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262344.1|3068396_3069413_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	76.1	1.2e-88
WP_072130322.1|3069324_3069867_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450649.1|3069900_3070671_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.1	1.6e-80
WP_001151239.1|3070686_3071109_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	1.1e-64
WP_077631714.1|3071151_3072168_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_000935423.1|3072413_3072626_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	97.1	5.6e-36
WP_000209148.1|3072658_3072877_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|3072878_3073142_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000208016.1|3073152_3074022_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	79.2	8.5e-123
WP_001278454.1|3074137_3074242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|3074431_3074644_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001341382.1|3074811_3075090_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265092.1|3075091_3076147_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140011.1|3076147_3076513_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	6.7e-37
WP_000640023.1|3076521_3077064_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	69.3	1.4e-67
WP_000917767.1|3077376_3077574_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000611213.1|3077724_3078774_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	88.5	4.0e-183
WP_000466957.1|3079245_3079677_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_053897820.1|3082378_3082594_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_000138558.1|3082849_3083122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003112.1|3083281_3083815_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	95.5	2.1e-100
WP_001208682.1|3084461_3084668_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|3084732_3084957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|3085313_3085454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001341372.1|3085583_3085769_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	88.5	6.4e-20
WP_000279816.1|3085810_3086176_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	95.0	7.8e-62
WP_000958380.1|3086466_3087030_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001399867.1|3087026_3088688_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_069722407.1|3088751_3090689_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.8	0.0e+00
WP_001063094.1|3090733_3090955_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	1.3e-35
WP_000125984.1|3093157_3093484_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007892.1|3093494_3093845_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	99.1	3.5e-59
WP_000573391.1|3093841_3094288_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|3094284_3094629_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275471.1|3094695_3095412_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	3.9e-129
WP_001030060.1|3095417_3095792_+|tail	phage tail assembly chaperone	tail	A0A0N7KZA2	Stx2-converting_phage	99.2	3.0e-64
WP_001513217.1|3095887_3096097_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212983.1|3096144_3099387_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	90.6	0.0e+00
WP_000807940.1|3099379_3099721_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	97.3	4.7e-61
WP_001335877.1|3099720_3100419_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	96.6	1.7e-129
WP_001429308.1|3100429_3101173_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.5e-147
WP_122993493.1|3101118_3101751_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.3	7.1e-103
WP_073520354.1|3105424_3108901_+	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.5	0.0e+00
WP_001360257.1|3108969_3109593_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_073519394.1|3109657_3110980_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	96.8	4.4e-70
WP_001023435.1|3110981_3111251_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	2.4e-44
WP_001131642.1|3111364_3111940_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001118085.1|3112230_3112812_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.8	2.7e-48
WP_012816780.1|3112879_3113515_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.0	3.7e-75
WP_001299273.1|3113642_3114701_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144080.1|3114775_3115426_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132165.1|3115608_3116199_+	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_000799399.1|3116472_3117336_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3117319_3118456_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359439.1|3118705_3119935_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|3120080_3121202_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735406.1|3121277_3122738_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|3122737_3123409_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|3123576_3124947_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001297479.1|3124950_3125592_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001297484.1|3125627_3126734_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 8
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	3332650	3386819	5310035	tRNA,transposase,tail,terminase,integrase,plate,holin	Escherichia_phage(79.37%)	71	3332284:3332299	3366995:3367010
3332284:3332299	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_000628065.1|3332650_3333883_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|3334137_3335121_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|3335598_3336972_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157394.1|3337100_3338036_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	6.5e-145
WP_000040844.1|3338087_3339323_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	6.0e-239
WP_000079604.1|3339324_3339540_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_073519364.1|3339639_3339828_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	1.2e-26
WP_021500490.1|3339820_3340015_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_063100796.1|3340078_3341167_-	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	99.4	1.1e-204
WP_073519365.1|3341181_3344343_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	68.4	0.0e+00
WP_073519366.1|3344443_3344719_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	2.8e-40
WP_000245533.1|3344793_3344970_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.4	6.3e-25
WP_073519367.1|3344963_3345185_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	5.3e-37
WP_001559054.1|3345580_3345814_+	hypothetical protein	NA	A0A0U2S658	Escherichia_phage	96.1	2.9e-33
WP_073519369.1|3345775_3346081_-	hypothetical protein	NA	A0A0U2S618	Escherichia_phage	95.0	1.4e-43
WP_000753628.1|3346330_3346792_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_061892277.1|3346899_3347175_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	8.9e-42
WP_057514222.1|3347158_3347581_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	3.4e-69
WP_000417086.1|3347593_3347890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000010975.1|3347890_3348142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026245.1|3348431_3349346_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	92.7	1.3e-102
WP_187658851.1|3349338_3349800_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	9.2e-84
WP_073519371.1|3349834_3350620_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	47.8	2.5e-49
WP_054626788.1|3350926_3351223_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.8	2.4e-45
WP_073519372.1|3351415_3351730_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	86.7	5.9e-50
WP_061351715.1|3351726_3352056_+	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	35.8	8.4e-23
WP_077898318.1|3352057_3352414_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	91.5	1.3e-53
WP_163428211.1|3352504_3352678_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	70.2	3.7e-14
WP_061351723.1|3352808_3353042_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	83.1	2.8e-28
WP_073519374.1|3353439_3353652_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	92.9	1.5e-25
WP_000687430.1|3353874_3354048_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	1.6e-17
WP_000940332.1|3354107_3354707_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.5	2.4e-108
WP_073519375.1|3354706_3354997_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	90.6	5.1e-48
WP_000640136.1|3354993_3355536_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_000898679.1|3356486_3356684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351476.1|3356682_3357075_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.9	1.0e-54
WP_000950570.1|3357064_3357340_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	98.9	8.6e-45
WP_000014553.1|3357342_3357720_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	97.6	2.3e-64
WP_149026241.1|3357734_3357917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071702711.1|3358041_3358254_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_032218059.1|3358229_3358409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519376.1|3358526_3359315_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	42.7	1.0e-50
WP_069901011.1|3359307_3360240_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	55.1	1.1e-83
WP_001307172.1|3360175_3360427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519377.1|3360430_3361522_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
WP_000021158.1|3361511_3362840_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	98.4	9.3e-262
WP_001559065.1|3362858_3364295_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	96.2	2.7e-267
WP_001018390.1|3364239_3365073_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	98.5	2.4e-154
WP_162830753.1|3366129_3367343_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	4.5e-170
3366995:3367010	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
WP_057107048.1|3367681_3368299_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	99.5	2.9e-117
WP_001272370.1|3368313_3369342_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	100.0	5.1e-191
WP_000780861.1|3369398_3369869_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	100.0	2.5e-84
WP_000175376.1|3369868_3370309_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762301.1|3370305_3370746_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	97.9	7.0e-81
WP_001139505.1|3370732_3371677_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_000506595.1|3371676_3373014_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.2	2.6e-243
WP_000938146.1|3373037_3373469_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	99.3	5.6e-75
WP_000684992.1|3373465_3374083_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	75.5	3.6e-83
WP_000918396.1|3374147_3376223_+	hypothetical protein	NA	A0A0U2QV45	Escherichia_phage	42.7	2.8e-127
WP_000056327.1|3376226_3376895_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	97.3	4.0e-120
WP_000209262.1|3376891_3377158_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_001271167.1|3377157_3378165_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	90.7	4.0e-180
WP_000063620.1|3378164_3378878_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	94.5	4.1e-123
WP_001261327.1|3379160_3379508_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	2.2e-61
WP_000426902.1|3379657_3380818_+	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	30.3	2.2e-33
WP_072277864.1|3380858_3382085_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	98.5	4.9e-225
WP_001199731.1|3382068_3382695_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_077898319.1|3382691_3384245_+|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	78.6	3.7e-225
WP_077898320.1|3384247_3384793_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	73.6	3.5e-74
WP_073519379.1|3384816_3386250_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	56.1	2.7e-81
WP_077898321.1|3386249_3386819_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	69.9	2.2e-71
>prophage 9
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	3594006	3635603	5310035	transposase,tail,lysis,protease,portal	Enterobacteria_phage(44.74%)	55	NA	NA
WP_000885621.1|3594006_3594582_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.0e-100
WP_001230388.1|3597560_3598160_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.5e-110
WP_073520352.1|3598226_3601625_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.9	0.0e+00
WP_153274582.1|3601691_3602030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028127181.1|3602102_3602744_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
WP_000967259.1|3602641_3603379_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.3	7.2e-139
WP_001434463.1|3603433_3604357_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	97.7	3.9e-174
WP_001154345.1|3604427_3604601_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|3604707_3605028_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_073520351.1|3605047_3605743_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	3.6e-132
WP_000447247.1|3605752_3606082_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_021574610.1|3606081_3609147_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|3609118_3609448_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001341514.1|3609456_3609843_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_000211132.1|3609903_3610647_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001079398.1|3610657_3611059_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677093.1|3611055_3611634_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	2.1e-101
WP_001283154.1|3611645_3611921_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
WP_077898316.1|3612324_3614352_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001459763.1|3614329_3615805_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_001072975.1|3615804_3616017_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000373425.1|3618116_3618611_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001031433.1|3619173_3619380_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	89.7	1.5e-25
WP_000035576.1|3619680_3620112_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	90.6	6.6e-60
WP_001019139.1|3620263_3620437_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|3620608_3620764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|3620843_3620909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|3620911_3621100_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3621110_3621323_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|3621684_3622182_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|3622178_3622712_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|3622708_3623020_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|3623024_3623240_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|3623993_3624209_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|3624508_3624721_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|3624775_3624865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|3625132_3625885_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|3625898_3626948_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|3626949_3627228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|3627294_3627546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3627762_3627918_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|3627989_3628277_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|3628276_3628516_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071527819.1|3628540_3628846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001317460.1|3629048_3629381_+	FlxA-like family protein	NA	NA	NA	NA	NA
WP_000589015.1|3629817_3631158_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_001151196.1|3631191_3631611_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.4	1.6e-55
WP_000054504.1|3631651_3632617_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.2	2.2e-55
WP_000705349.1|3632597_3633119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|3633102_3633330_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|3633407_3633815_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|3634007_3634163_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344954.1|3634164_3634740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|3635226_3635415_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|3635411_3635603_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
>prophage 10
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	3657299	3674480	5310035	tail,head,terminase,protease,capsid,integrase,portal	uncultured_Caudovirales_phage(83.33%)	26	3659464:3659485	3674506:3674527
WP_001260840.1|3657299_3658121_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|3658159_3658489_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276154.1|3658475_3658841_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
3659464:3659485	attL	TGACTACACCAGTGACTACACC	NA	NA	NA	NA
WP_000133423.1|3660127_3660409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001560954.1|3660422_3662084_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	8.9e-278
WP_000113645.1|3662067_3662424_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000174068.1|3662546_3662729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145905.1|3662712_3663153_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000134109.1|3663152_3663449_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	6.9e-32
WP_001020662.1|3663445_3663784_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	1.7e-31
WP_000267605.1|3663780_3664992_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_000504056.1|3664993_3665566_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.0	3.6e-61
WP_001137337.1|3665605_3666763_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	1.3e-137
WP_000233313.1|3667050_3667323_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126693.1|3667335_3667746_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000557476.1|3667742_3668021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000761836.1|3668309_3670064_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_000770179.1|3670060_3670360_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204964.1|3670365_3670599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204078.1|3670591_3670825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|3670817_3671183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000336139.1|3671175_3671400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000076671.1|3671389_3671620_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_032145563.1|3671616_3672639_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|3672696_3672885_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085276.1|3673250_3674480_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.4	1.6e-130
3674506:3674527	attR	TGACTACACCAGTGACTACACC	NA	NA	NA	NA
>prophage 11
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	3793234	3839209	5310035	tRNA,tail,head,terminase,capsid,integrase,plate,holin	Enterobacteria_phage(83.33%)	55	3795641:3795661	3831854:3831874
WP_000029479.1|3793234_3793984_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.3	1.6e-08
WP_001154187.1|3793983_3794535_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956529.1|3794597_3795578_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
3795641:3795661	attL	AAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000416304.1|3795767_3796163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001247208.1|3796173_3797109_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000094527.1|3797197_3797509_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_000163908.1|3797600_3797879_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000917800.1|3797893_3798232_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	1.3e-47
WP_000159459.1|3798242_3798521_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	78.3	1.5e-33
WP_000514277.1|3798532_3798775_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_040082359.1|3798771_3798885_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_000985159.1|3798971_3799175_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_024230414.1|3799171_3799417_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	87.7	5.5e-35
WP_024230413.1|3799558_3799924_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	95.9	4.3e-60
WP_149026242.1|3799930_3802753_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.1	0.0e+00
WP_029488422.1|3802829_3803789_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	5.4e-179
WP_000211256.1|3803793_3804105_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_001561007.1|3804168_3804504_+	hypothetical protein	NA	A0A0A7NV51	Enterobacteria_phage	95.4	2.6e-51
WP_024169082.1|3804670_3805081_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001561011.1|3805077_3805422_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000613759.1|3807005_3808757_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_001262673.1|3808911_3809748_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055118.1|3809770_3810823_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_029488420.1|3810868_3811669_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.3	4.9e-125
WP_000063074.1|3811771_3812266_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_000104350.1|3812469_3812793_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|3812789_3813182_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_029488419.1|3813178_3813586_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	2.6e-66
WP_000920594.1|3813723_3814191_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_032338905.1|3814183_3814819_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	5.3e-114
WP_077696943.1|3814830_3815397_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	3.6e-98
WP_001067548.1|3815414_3815744_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_029488416.1|3815747_3816644_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.7	2.1e-156
WP_000071720.1|3816636_3817167_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_073520358.1|3817169_3819497_+|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	60.1	3.8e-178
WP_000972118.1|3819499_3820033_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	67.2	1.8e-62
WP_029488413.1|3820101_3820590_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	98.1	6.8e-85
WP_073519295.1|3820602_3823410_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	98.2	0.0e+00
WP_032153269.1|3823396_3823552_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	94.1	2.2e-21
WP_000651566.1|3823560_3823935_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	1.3e-35
WP_000290462.1|3823990_3824503_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005384.1|3824502_3825687_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	4.7e-225
WP_073519293.1|3825844_3826954_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.0	2.0e-193
WP_029488695.1|3827122_3829156_-	DUF87 domain-containing protein	NA	NA	NA	NA	NA
WP_000027066.1|3829158_3830571_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_001445133.1|3830995_3831256_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|3831446_3831587_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|3831891_3832191_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
3831854:3831874	attR	AAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672369.1|3832195_3834583_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|3834597_3835581_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|3835864_3835909_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|3836031_3836388_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|3836440_3836638_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|3836734_3837277_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|3837280_3839209_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 12
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	3989462	4057053	5310035	tRNA,tail,head,terminase,capsid,integrase,plate,holin	Enterobacteria_phage(69.57%)	78	4020372:4020431	4057996:4058119
WP_001025336.1|3989462_3991196_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	6.8e-87
WP_001297434.1|3991372_3991861_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|3991980_3992373_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066998.1|3992372_3994451_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278954.1|3994443_3995592_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|3995793_3996438_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3996448_3996838_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|3996852_3997902_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204339.1|3997904_3998765_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483214.1|3998783_4000385_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.6	2.0e-16
WP_001299160.1|4000430_4002092_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.2	9.9e-11
WP_000147302.1|4002236_4002740_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001300654.1|4002760_4004725_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|4004729_4005656_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|4005652_4006540_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4006666_4007245_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4007247_4007598_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|4008377_4008806_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|4008812_4010237_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001295645.1|4010211_4011012_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|4011178_4012165_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|4012179_4013694_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_001300280.1|4013763_4014753_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|4015550_4016054_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|4016132_4016384_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4016498_4016585_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237869.1|4016847_4017171_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|4017341_4017839_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|4017876_4018116_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797573.1|4018306_4019518_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|4019579_4020245_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
4020372:4020431	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001300279.1|4020601_4021603_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
WP_000865386.1|4021608_4021956_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290349.1|4021985_4022636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786769.1|4022651_4023056_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	1.6e-23
WP_001673482.1|4023145_4023283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|4023354_4023558_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|4023579_4023930_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159462.1|4023940_4024219_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	81.5	3.6e-35
WP_000514274.1|4024230_4024473_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	6.8e-38
WP_000021655.1|4024469_4024583_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991915.1|4024675_4025092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985144.1|4025115_4025319_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	80.6	5.5e-25
WP_000153711.1|4025315_4025582_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	3.4e-30
WP_000108349.1|4025578_4025878_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	87.9	5.3e-40
WP_122985482.1|4025889_4026507_+	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_000564228.1|4026503_4026893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001608.1|4026889_4029673_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	87.8	0.0e+00
WP_000502620.1|4029853_4030975_+	AAA family ATPase	NA	R4TQL5	Phaeocystis_globosa_virus	29.5	3.7e-17
WP_001140702.1|4030998_4033224_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000613759.1|4034763_4036515_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.5	0.0e+00
WP_001262673.1|4036669_4037506_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_001055089.1|4037529_4038582_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_000632330.1|4038627_4039428_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	88.0	2.4e-124
WP_000063082.1|4039530_4040025_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	2.7e-89
WP_000104350.1|4040228_4040552_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072340.1|4040548_4040941_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	2.2e-70
WP_000780570.1|4040937_4041345_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	98.5	3.4e-66
WP_000920586.1|4041482_4041950_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	4.5e-86
WP_000356339.1|4041942_4042578_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	100.0	1.1e-114
WP_077898325.1|4042589_4043156_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	5.2e-97
WP_001070742.1|4043173_4043503_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	2.4e-54
WP_001111930.1|4043506_4044403_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.0e-155
WP_000071708.1|4044395_4044926_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	3.3e-93
WP_000108547.1|4044928_4047079_+|tail	tail fiber protein	tail	Q7Y4D4	Escherichia_virus	83.4	4.6e-303
WP_001164115.1|4047082_4047610_+|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	98.3	2.5e-93
WP_000972183.1|4047638_4048172_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	3.2e-96
WP_023351586.1|4048174_4048723_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	92.1	4.3e-88
WP_000905059.1|4048950_4049550_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.4	1.9e-97
WP_000979954.1|4049576_4050065_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_000853425.1|4050077_4052885_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.1	0.0e+00
WP_000333494.1|4052871_4053027_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665308.1|4053035_4053401_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|4053455_4053968_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005425.1|4053967_4055152_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.0	4.4e-223
WP_000132830.1|4055309_4056419_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488108.1|4056461_4056722_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|4056912_4057053_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
4057996:4058119	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 13
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	4110080	4144392	5310035	tail,head,terminase,capsid,holin	Enterobacteria_phage(38.24%)	38	NA	NA
WP_095111390.1|4110080_4110212_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_052932831.1|4110558_4111539_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001023455.1|4111715_4111985_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_073520359.1|4111986_4113300_-|tail	phage tail protein	tail	Q6H9S9	Enterobacteria_phage	97.5	6.1e-72
WP_001360257.1|4113364_4113988_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_073520360.1|4114056_4117533_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.4	0.0e+00
WP_000649829.1|4117666_4118194_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_149026243.1|4118380_4118875_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	96.9	1.1e-74
WP_001299882.1|4119707_4120406_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|4120405_4120735_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_000082490.1|4120731_4123311_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533425.1|4123291_4123705_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479084.1|4123731_4124163_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.7e-42
WP_001143013.1|4124176_4124929_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|4124936_4125332_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|4125328_4125904_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_001204544.1|4125918_4126272_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|4126264_4126639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522630.1|4126690_4127719_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.3	1.3e-114
WP_000256818.1|4127776_4128124_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_073520361.1|4128160_4129666_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000259002.1|4131244_4131451_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001371730.1|4131434_4133363_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.0e-261
WP_000235436.1|4133334_4133844_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|4134246_4134471_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|4134552_4134867_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|4135394_4135580_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|4135801_4135915_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|4136135_4136669_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|4136828_4137101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053897820.1|4137356_4137572_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_073519349.1|4137853_4139704_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_001064889.1|4141244_4141934_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_001217464.1|4141930_4142290_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_001265301.1|4142302_4143352_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.6e-107
WP_001360223.1|4143353_4143632_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.3e-11
WP_000975572.1|4143698_4143962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967409.1|4144179_4144392_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.2e-25
>prophage 14
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	4236919	4351667	5310035	tRNA,transposase,tail,lysis,head,terminase,capsid,integrase,plate,holin,portal	Escherichia_phage(36.84%)	111	4292913:4292940	4324390:4324417
WP_032167455.1|4236919_4238056_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_021547565.1|4238505_4239399_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001468919.1|4239573_4240968_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	3.7e-19
WP_001468920.1|4240978_4242199_-	colanic acid biosynthesis glycosyltransferase WcaL	NA	NA	NA	NA	NA
WP_000770864.1|4242195_4243476_-	colanic acid biosynthesis pyruvyl transferase WcaK	NA	NA	NA	NA	NA
WP_001468922.1|4244040_4245519_-	colanic acid undecaprenyl disphosphate flippase WzxC	NA	NA	NA	NA	NA
WP_000183110.1|4245520_4246915_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_073519343.1|4246969_4248340_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	4.9e-32
WP_000079285.1|4248532_4249969_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_001468926.1|4249971_4251195_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_001468927.1|4251191_4251671_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043595.1|4251673_4252639_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.9e-87
WP_000048190.1|4252641_4253763_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_001153547.1|4253788_4254337_-	colanic acid biosynthesis acetyltransferase WcaF	NA	NA	NA	NA	NA
WP_000927066.1|4254352_4255099_-	colanic acid biosynthesis glycosyltransferase WcaE	NA	NA	NA	NA	NA
WP_000107816.1|4255109_4256327_-	putative colanic acid polymerase WcaD	NA	NA	NA	NA	NA
WP_001023901.1|4256301_4257519_-	colanic acid biosynthesis glycosyltransferase WcaC	NA	NA	NA	NA	NA
WP_000888740.1|4257515_4258004_-	colanic acid biosynthesis acetyltransferase WcaB	NA	NA	NA	NA	NA
WP_000654491.1|4258006_4258846_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	4.4e-07
WP_000137133.1|4258938_4261101_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	1.9e-17
WP_000482901.1|4261103_4261547_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|4261552_4262692_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_073519342.1|4263350_4264934_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252324.1|4265207_4267061_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234777.1|4267082_4267664_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.8e-31
WP_001295424.1|4267755_4268397_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_073519341.1|4268714_4272032_+	diguanylate cyclase	NA	NA	NA	NA	NA
WP_000288410.1|4272070_4272928_-	DNA-3-methyladenine glycosylase 2	NA	NA	NA	NA	NA
WP_000469759.1|4273061_4274414_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.6e-06
WP_001298837.1|4274425_4276366_-	protein kinase YegI	NA	NA	NA	NA	NA
WP_000119074.1|4276362_4277124_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_000003178.1|4277120_4277780_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010723109.1|4278000_4278060_-	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_001386899.1|4278332_4278389_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001386901.1|4278660_4278717_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000678959.1|4278995_4280243_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197867.1|4280242_4283365_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_000667572.1|4283365_4286443_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_000130896.1|4286443_4287859_+	MFS transporter	NA	NA	NA	NA	NA
WP_000675150.1|4287855_4289259_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|4289255_4289978_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_001298852.1|4290168_4290501_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|4290709_4291006_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|4291007_4291304_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|4291406_4292768_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
4292913:4292940	attL	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000468308.1|4293038_4293257_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882975.1|4293338_4294502_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	3.7e-206
WP_000978908.1|4294501_4294981_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_073519340.1|4294995_4297443_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|4297435_4297555_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|4297587_4297863_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|4297919_4298438_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286726.1|4298450_4299641_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_024199507.1|4299970_4300516_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	97.2	2.3e-94
WP_024244870.1|4300785_4301313_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	88.6	2.5e-85
WP_073520363.1|4301314_4303414_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	56.3	1.7e-161
WP_001285314.1|4303424_4303955_-|tail	phage tail protein I	tail	A0A0F7LDF3	Escherichia_phage	100.0	1.0e-102
WP_001121482.1|4303947_4304856_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_000127163.1|4304860_4305208_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093749.1|4305204_4305840_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.1e-111
WP_024244868.1|4305923_4306709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001787.1|4306780_4307233_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_000917139.1|4307225_4307693_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	97.4	1.6e-80
WP_053893576.1|4307782_4308226_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	4.1e-65
WP_024244866.1|4308213_4308639_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.0	5.2e-57
WP_001144101.1|4308653_4309151_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|4309150_4309432_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_024244865.1|4309435_4309639_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	98.5	1.2e-30
WP_000988639.1|4309638_4310148_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_023281156.1|4310247_4310991_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	6.6e-124
WP_053893575.1|4310994_4312068_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	3.7e-200
WP_001085953.1|4312126_4312981_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_024234797.1|4313154_4314927_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_000038148.1|4314926_4315961_+|portal	phage portal protein	portal	Q7Y4E8	Escherichia_virus	99.7	3.2e-201
WP_063118428.1|4318461_4320738_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.2	0.0e+00
WP_000027664.1|4320727_4321003_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001113270.1|4320999_4321224_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277957.1|4321223_4321526_-	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|4321525_4321750_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|4321813_4322314_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001005162.1|4322310_4322481_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000043869.1|4322491_4322767_-	regulatory phage cox family protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001306384.1|4322881_4323181_+	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_001543021.1|4323296_4324310_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	5.4e-193
WP_000716757.1|4324574_4324892_-	hypothetical protein	NA	NA	NA	NA	NA
4324390:4324417	attR	AATCTCCCTTACACGGGCTTATTTTTTA	NA	NA	NA	NA
WP_000807362.1|4325306_4326206_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000178552.1|4326287_4327067_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|4327166_4328207_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490714.1|4328254_4329610_-	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000823288.1|4329613_4329898_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|4329928_4330381_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853892.1|4330390_4331653_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000289787.1|4331693_4332536_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|4332845_4333898_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858482.1|4334154_4335432_+	MFS transporter	NA	NA	NA	NA	NA
WP_000846217.1|4335428_4336433_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011951.1|4336429_4337395_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434035.1|4337368_4338115_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001298848.1|4338166_4338985_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	4.5e-25
WP_000822274.1|4339049_4339850_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195605.1|4339846_4340635_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|4340857_4341130_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134575.1|4341250_4342075_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000153067.1|4342293_4342632_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_001026151.1|4342713_4343748_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945416.1|4343761_4346242_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677395.1|4346257_4346932_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|4347012_4347555_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|4347848_4348130_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005457.1|4348392_4349502_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001295427.1|4349633_4351667_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 15
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	4364178	4373620	5310035		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|4364178_4365315_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001298843.1|4365311_4367312_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|4367436_4367898_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|4367938_4368409_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4368455_4369175_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|4369171_4370857_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240410.1|4371078_4371810_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	4.8e-111
WP_001216961.1|4371869_4371977_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|4371957_4372689_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|4372693_4373620_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 16
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	4573195	4651743	5310035	tRNA,transposase,tail,head,terminase,protease,capsid,integrase,plate,holin,portal	Shigella_phage(48.21%)	89	4603011:4603027	4654208:4654224
WP_001283581.1|4573195_4574008_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289165.1|4574007_4575021_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|4575086_4576223_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|4576321_4577317_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127749.1|4577313_4578492_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|4578775_4579996_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_073519336.1|4580154_4582161_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000399648.1|4582331_4583312_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000559764.1|4583559_4583838_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|4583871_4584420_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|4584419_4585229_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043812.1|4585228_4586053_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|4586056_4587142_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001298774.1|4587176_4588109_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|4588274_4588826_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001356216.1|4588947_4589820_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|4589806_4590331_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|4590327_4590798_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|4590794_4591343_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|4591317_4592070_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112828.1|4592089_4594732_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|4594813_4595377_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|4596060_4596546_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425058.1|4596748_4598893_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531948.1|4598892_4600203_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|4600382_4600667_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|4601038_4602379_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000937837.1|4602747_4603806_+	hypothetical protein	NA	NA	NA	NA	NA
4603011:4603027	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|4603987_4604743_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|4605036_4605969_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_021526115.1|4606280_4607438_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.7	1.3e-222
WP_073519334.1|4608141_4608885_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355479.1|4609710_4610484_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	3.2e-36
WP_047668518.1|4610956_4612048_+	acyltransferase	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.4	2.2e-14
WP_073519333.1|4612276_4612864_-|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	51.8	1.6e-56
WP_072291070.1|4612863_4613946_-|tail	phage tail protein	tail	U5P0I1	Shigella_phage	61.1	1.0e-48
WP_000383556.1|4613949_4614534_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	5.4e-113
WP_000785301.1|4614524_4615583_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	4.3e-201
WP_000424728.1|4615569_4615995_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	1.5e-80
WP_001259087.1|4615994_4616543_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	6.6e-97
WP_073519332.1|4616542_4617622_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.3e-205
WP_073519331.1|4617618_4618992_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	97.5	4.2e-241
WP_000738065.1|4619048_4619537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021557515.1|4619601_4621503_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.5	0.0e+00
WP_000571713.1|4621587_4621911_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090998.1|4621907_4622264_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_050921975.1|4622263_4623760_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.0	3.5e-273
WP_000497751.1|4623743_4623914_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_073519330.1|4623922_4624483_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	6.8e-105
WP_023154798.1|4624479_4625004_-	hypothetical protein	NA	U5P416	Shigella_phage	99.4	3.3e-93
WP_032177310.1|4624975_4625386_-|head	phage head closure protein	head	U5P0R0	Shigella_phage	96.3	3.6e-71
WP_000927711.1|4625382_4625706_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601367.1|4625708_4625909_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	4.9e-26
WP_073519329.1|4625958_4627164_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	5.3e-224
WP_001193631.1|4627178_4627829_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_073519328.1|4627806_4629048_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.0	1.7e-241
WP_000605606.1|4629047_4629230_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_072011717.1|4629241_4630738_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929182.1|4630971_4631466_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	5.6e-87
WP_032201150.1|4631592_4631943_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	80.0	6.6e-50
WP_050437385.1|4632045_4632609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032201148.1|4632683_4632914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519327.1|4633054_4633324_-	hypothetical protein	NA	G8C7W1	Escherichia_phage	72.4	2.0e-22
WP_044069183.1|4633331_4633946_-	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	81.4	3.8e-93
WP_073519326.1|4633945_4634227_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	42.9	5.0e-16
WP_001283169.1|4634213_4634600_-|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	100.0	7.0e-61
WP_044069184.1|4634679_4634937_-	hypothetical protein	NA	A0A1C9IHX4	Salmonella_phage	94.1	6.1e-37
WP_073519325.1|4635087_4635840_-	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.8e-137
WP_187658852.1|4635900_4636842_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.6	1.6e-162
WP_001061397.1|4636849_4637647_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	4.4e-150
WP_000767111.1|4637666_4638056_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	3.5e-68
WP_000210164.1|4638052_4638379_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_073519324.1|4638375_4639029_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.3e-127
WP_073519323.1|4639028_4639523_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	3.6e-86
WP_073519322.1|4639519_4640461_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	99.0	6.2e-151
WP_001250269.1|4640450_4640630_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515875.1|4640805_4641357_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	1.3e-100
WP_000187185.1|4641379_4641628_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000853319.1|4641763_4642450_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	42.0	2.7e-39
WP_000389078.1|4642432_4643323_-	BRCT domain-containing protein	NA	U3PB51	Vibrio_phage	31.6	4.5e-34
WP_000917896.1|4643526_4643823_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|4644423_4644786_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081297.1|4644851_4645676_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	4.6e-150
WP_000008236.1|4645803_4646340_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_073519321.1|4646330_4646693_+	hypothetical protein	NA	U5P092	Shigella_phage	98.3	1.8e-66
WP_000206732.1|4646692_4646998_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_001163428.1|4647129_4647330_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001274887.1|4649179_4650094_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_000194515.1|4650309_4651743_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
4654208:4654224	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 17
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	4889462	5051511	5310035	tRNA,transposase,tail,lysis,head,terminase,protease,capsid,integrase,holin,portal	Enterobacteria_phage(45.83%)	185	4976247:4976264	5042721:5042738
WP_001298974.1|4889462_4890200_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|4890331_4891666_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|4893154_4894036_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|4894138_4894726_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|4894781_4895165_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|4895469_4896159_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|4896206_4897244_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|4897450_4897870_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298975.1|4897938_4898637_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082969.1|4898668_4901329_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|4901442_4902798_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|4902843_4903167_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|4903163_4904462_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|4910317_4912891_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|4913020_4913752_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|4913748_4914729_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|4914863_4915601_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|4915871_4916213_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|4916316_4916364_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200118.1|4916462_4917623_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|4917665_4918787_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|4918797_4919868_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|4920077_4920443_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|4920592_4921111_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|4921100_4922327_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|4922342_4922825_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|4922901_4923249_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|4923290_4924058_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|4924088_4924637_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|4924655_4924904_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|4925040_4926402_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|4926568_4927360_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|4927380_4928667_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001287917.1|4928789_4929395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300112.1|4929429_4930020_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|4930142_4931021_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|4931106_4932768_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|4932916_4933258_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|4933319_4933610_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|4933599_4934076_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|4934207_4934690_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001519527.1|4935437_4936199_-	hypothetical protein	NA	Q6J1W3	Lactobacillus_phage	35.0	8.5e-10
WP_000258782.1|4936532_4936883_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560788.1|4936886_4937420_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001519526.1|4937406_4937556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001519525.1|4937545_4937689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000355484.1|4938110_4938884_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_032332773.1|4938953_4939538_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	1.1e-102
WP_073519393.1|4939537_4942936_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_001233071.1|4943000_4943600_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_073520365.1|4943670_4947168_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.3	0.0e+00
WP_153274582.1|4947234_4947573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028127181.1|4947645_4948287_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	3.8e-96
WP_000967259.1|4948184_4948922_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	91.3	7.2e-139
WP_001434463.1|4948976_4949900_-	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	97.7	3.9e-174
WP_001154345.1|4949970_4950144_-	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001302649.1|4950250_4950571_+	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_073520351.1|4950590_4951286_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.3	3.6e-132
WP_000447247.1|4951295_4951625_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_073520350.1|4951624_4954690_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_001161009.1|4954661_4954991_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|4954999_4955386_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211109.1|4955446_4956190_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|4956201_4956603_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_073519300.1|4956599_4957190_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	2.7e-80
WP_001283153.1|4957201_4957477_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_077898316.1|4957880_4959908_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_001459763.1|4959885_4961361_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.0e-281
WP_001072975.1|4961360_4961573_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000373425.1|4963672_4964167_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001205130.1|4964524_4964701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077898315.1|4964842_4964995_-	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	98.0	6.2e-21
WP_001341210.1|4964982_4965450_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001135250.1|4965446_4965944_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|4965943_4966159_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4966226_4967279_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|4967429_4967633_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000217632.1|4967856_4968282_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001047112.1|4968562_4969315_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.8	6.9e-137
WP_001204780.1|4970145_4970529_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737283.1|4970718_4971816_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.3	4.8e-155
WP_000670959.1|4972404_4972620_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	3.4e-33
WP_001135281.1|4972619_4973117_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|4973333_4973516_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|4973606_4973900_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_001298896.1|4974190_4974601_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|4974886_4975093_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001298906.1|4975257_4975452_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	9.7e-27
WP_000453580.1|4975840_4976386_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
4976247:4976264	attL	TGCAGCGGCGTTTTCCGG	NA	NA	NA	NA
WP_001027292.1|4976360_4978286_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_073519252.1|4978282_4978489_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	3.8e-29
WP_001297098.1|4978485_4980087_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123314.1|4980067_4981387_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	9.6e-235
WP_001297109.1|4981396_4981729_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	100.0	2.2e-55
WP_000063280.1|4981784_4982810_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	100.0	7.1e-193
WP_000158905.1|4982851_4983250_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	99.2	1.2e-63
WP_000752979.1|4983261_4983615_+|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_000975070.1|4983626_4984205_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683105.1|4984201_4984597_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001298904.1|4984604_4985345_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.6	1.7e-132
WP_000479153.1|4985360_4985783_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|4985764_4986199_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000533411.1|4988809_4989223_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|4989249_4989681_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143019.1|4989694_4990447_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683065.1|4990454_4990850_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|4990846_4991380_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|4991394_4991748_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201512.1|4991740_4992124_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|4992175_4993204_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|4993261_4993609_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|4993645_4995151_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|4995140_4996733_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|4996729_4996936_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300274.1|4996919_4998848_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_001429103.1|4998819_4999326_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_001443307.1|4999753_4999948_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_000881326.1|5000135_5000753_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092324.1|5000902_5001340_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.4e-70
WP_001135302.1|5001336_5001834_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000284515.1|5001833_5002049_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|5002191_5002590_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|5002670_5002829_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001235472.1|5003909_5004533_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001028835.1|5004529_5005195_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	2.9e-131
WP_001223930.1|5005191_5005794_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.1	1.2e-91
WP_001108084.1|5005768_5006335_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_000612803.1|5006904_5008677_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.7	0.0e+00
WP_024182502.1|5009180_5009363_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	95.0	1.8e-27
WP_170996547.1|5009721_5010934_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	6.5e-169
WP_000344548.1|5011283_5011604_-	hypothetical protein	NA	A0A2I6PIG0	Escherichia_phage	71.7	1.4e-35
WP_000229806.1|5011621_5011828_-	hypothetical protein	NA	G9L683	Escherichia_phage	94.1	1.1e-25
WP_162830753.1|5011955_5013168_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	4.5e-170
WP_000145931.1|5013213_5013504_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788878.1|5013500_5014202_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	99.6	1.7e-129
WP_000185469.1|5014198_5015098_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	2.3e-171
WP_000195204.1|5015130_5015427_-	Regulatory protein CII from phage origin	NA	A0A1U9AJB5	Stx1_converting_phage	99.0	1.5e-47
WP_001180318.1|5015533_5015761_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250469.1|5015839_5016547_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_001074605.1|5016644_5017187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528775.1|5017174_5017951_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001434513.1|5018394_5018730_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	64.9	5.0e-31
WP_071533307.1|5018808_5018988_+	antirestriction Ral family protein	NA	M1FQU1	Enterobacteria_phage	98.3	4.3e-29
WP_000065374.1|5019191_5019560_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198860.1|5019632_5019797_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_001371715.1|5019765_5019930_+	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	96.3	7.1e-23
WP_000995439.1|5019983_5020280_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100844.1|5020285_5021071_+	phage recombination protein Bet	NA	A0A0K2FJF1	Enterobacteria_phage	100.0	1.4e-148
WP_000186784.1|5021067_5021748_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.7	2.3e-131
WP_000149544.1|5021744_5021927_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|5021899_5022091_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188870.1|5022167_5022383_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000763378.1|5022481_5022703_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	97.3	8.4e-35
WP_001289864.1|5022699_5023107_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582233.1|5023108_5023864_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.8	3.2e-142
WP_000208001.1|5023874_5024663_+	DUF550 domain-containing protein	NA	A0A075B8H2	Enterobacteria_phage	41.6	3.3e-49
WP_001277762.1|5024759_5024939_+	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	100.0	1.5e-29
WP_001281197.1|5025041_5025386_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|5025503_5025722_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533665.1|5025699_5026773_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.9	2.0e-198
WP_001399835.1|5026867_5029612_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.5	9.2e-38
WP_000829674.1|5029683_5030757_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|5030805_5030979_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_012816753.1|5030968_5031199_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|5031173_5031362_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|5031372_5031585_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_000087763.1|5031870_5032083_+	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_001299283.1|5032524_5032830_+	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_001247608.1|5032936_5033581_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001038077.1|5033577_5034324_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_000742329.1|5034323_5036420_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001300224.1|5036465_5037605_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_000057871.1|5037592_5038039_+	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000208667.1|5038058_5040239_+	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000644323.1|5040358_5041657_-	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000270305.1|5041732_5041825_-	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_000460803.1|5041837_5042974_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
5042721:5042738	attR	CCGGAAAACGCCGCTGCA	NA	NA	NA	NA
WP_000263563.1|5042985_5044530_-	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_000004915.1|5044663_5045521_-	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000063983.1|5045517_5045916_-	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000003672.1|5045912_5046500_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186415.1|5046496_5047204_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107389.1|5047222_5049016_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001295940.1|5049012_5050131_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000375136.1|5050851_5051511_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 18
NZ_CP010240	Escherichia coli strain C7 chromosome, complete genome	5310035	5276353	5308896	5310035	tail,head,lysis,terminase,capsid,holin,portal	Enterobacteria_phage(48.48%)	35	NA	NA
WP_001399730.1|5276353_5277643_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.6	6.5e-18
WP_000767413.1|5277701_5278178_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001102750.1|5278856_5280095_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	82.3	3.6e-207
WP_001131650.1|5280432_5281008_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	75.9	1.5e-75
WP_000652080.1|5281534_5282383_-	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
WP_000950984.1|5282606_5283488_-	hypothetical protein	NA	A5LH48	Enterobacteria_phage	90.4	1.0e-147
WP_096150060.1|5283651_5283783_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_062876567.1|5284129_5285110_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	1.3e-87
WP_001023455.1|5285286_5285556_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_000279086.1|5285557_5286871_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	4.1e-76
WP_001230343.1|5286935_5287535_-	Ail/Lom family protein	NA	A0A291AWV3	Escherichia_phage	99.0	6.7e-111
WP_000090913.1|5291059_5291662_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	3.6e-88
WP_001300229.1|5291598_5292342_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.5	5.7e-144
WP_001152529.1|5292346_5293045_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	2.9e-129
WP_000847393.1|5293044_5293374_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.7e-53
WP_000533411.1|5295115_5295529_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	80.2	5.1e-41
WP_000479115.1|5295555_5295987_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.3	2.8e-42
WP_001143019.1|5296000_5296753_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.2	1.4e-126
WP_000683065.1|5296760_5297156_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	83.2	6.7e-59
WP_000975031.1|5297152_5297686_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.0e-57
WP_001204560.1|5297700_5298054_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	1.5e-41
WP_000201512.1|5298046_5298430_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522623.1|5298481_5299510_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|5299567_5299915_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253918.1|5299951_5301457_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_000831809.1|5301446_5303039_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	61.2	9.3e-184
WP_000259002.1|5303035_5303242_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001300274.1|5303225_5305154_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	6.1e-262
WP_001429103.1|5305125_5305632_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	47.9	1.5e-34
WP_001443307.1|5306059_5306254_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	3.3e-27
WP_000881326.1|5306441_5307059_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	85.9	6.5e-93
WP_000092324.1|5307208_5307646_-|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	98.6	1.4e-70
WP_001135302.1|5307642_5308140_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	1.4e-90
WP_000284515.1|5308139_5308355_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_033816266.1|5308497_5308896_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
