The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	0	38097	4797106	portal,integrase,head,tail,transposase,holin,terminase	Escherichia_phage(26.09%)	32	5396:5410	37770:37784
WP_000256818.1|736_1084_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_073569585.1|1120_2626_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	3.6e-100
WP_073569586.1|2615_4208_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	1.2e-183
WP_000259002.1|4204_4411_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_053886798.1|4394_6323_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.5e-260
5396:5410	attL	TGAAAAACATCAGGC	NA	NA	NA	NA
WP_052893166.1|6294_6804_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	42.7	2.3e-11
WP_001299691.1|7206_7431_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	87.3	1.0e-19
WP_001303878.1|7512_7827_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|8354_8540_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|8761_8875_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|9095_9629_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|9788_10061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053897820.1|10316_10532_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.7e-32
WP_073569587.1|10970_12821_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_001064889.1|14361_15051_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_000140036.1|15047_15413_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.1	9.3e-39
WP_053881714.1|15413_16469_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	8.3e-88
WP_032351946.1|16470_16749_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	5.7e-12
WP_021570068.1|16916_17072_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	7.2e-17
WP_000264572.1|17349_20148_-	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_000693883.1|21979_22405_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391948.1|22388_22670_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362152.1|22770_23190_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000379575.1|23455_23611_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171930.1|23770_23989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|24557_24746_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|24742_24931_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073569588.1|25026_27498_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.7	2.9e-59
WP_000096348.1|27556_27760_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533607.1|27759_28785_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.3	6.4e-101
WP_001300307.1|29020_29818_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_114042815.1|36934_38097_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
37770:37784	attR	GCCTGATGTTTTTCA	NA	NA	NA	NA
>prophage 2
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	55276	56443	4797106		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001296209.1|55276_56443_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
>prophage 3
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	64067	64967	4797106		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|64067_64967_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 4
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	72320	75142	4797106		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000704856.1|72320_73487_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.3e-110
WP_000043440.1|73735_75142_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
>prophage 5
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	83826	87510	4797106		Bacillus_phage(33.33%)	3	NA	NA
WP_000183060.1|83826_84720_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|84962_85958_-	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001115987.1|86115_87510_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.7e-19
>prophage 6
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	93018	99812	4797106		Bacillus_phage(25.0%)	6	NA	NA
WP_001296216.1|93018_94389_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.7e-32
WP_000079263.1|94581_96018_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_042963480.1|96020_97244_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479838.1|97240_97720_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000043654.1|97722_98688_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	1.3e-87
WP_000048190.1|98690_99812_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 7
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	104055	114466	4797106		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|104055_104895_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137196.1|104987_107150_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|107152_107596_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|107601_108741_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_001569003.1|109400_110984_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|111276_113130_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|113151_113733_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|113824_114466_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 8
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	119191	120544	4797106		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469709.1|119191_120544_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.1	4.1e-07
>prophage 9
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	134392	141257	4797106	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675146.1|134392_135796_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137873.1|135792_136515_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|136705_137038_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|137246_137543_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|137544_137841_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476018.1|137943_139305_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	3.2e-217
WP_001352710.1|139634_139952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|140357_141257_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 10
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	150479	154036	4797106		Serratia_phage(50.0%)	4	NA	NA
WP_000846226.1|150479_151484_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	1.7e-13
WP_000011973.1|151480_152446_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|152419_153166_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001297420.1|153217_154036_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
>prophage 11
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	164683	166717	4797106	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|164683_166717_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 12
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	179227	188669	4797106		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|179227_180364_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001512920.1|180360_182361_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|182485_182947_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_073569595.1|182987_183458_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	98.7	2.0e-81
WP_000598641.1|183504_184224_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|184220_185906_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|186127_186859_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|186918_187026_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|187006_187738_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569366.1|187742_188669_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 13
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	208984	210505	4797106		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|208984_210505_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 14
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	214199	217985	4797106		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|214199_214868_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425444.1|215125_215962_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489249.1|215993_217985_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 15
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	222054	222912	4797106		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|222054_222912_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 16
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	237410	241711	4797106		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848214.1|237410_238877_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_000198823.1|238994_239981_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|240019_240733_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241011.1|241144_241711_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 17
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	247465	255112	4797106		Vibrio_phage(50.0%)	7	NA	NA
WP_000194940.1|247465_249055_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|249058_249403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213363.1|249734_250925_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.5	1.7e-20
WP_001234848.1|250952_251648_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|251796_253557_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|253681_253966_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|254104_255112_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 18
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	266811	267429	4797106		Bacillus_virus(100.0%)	1	NA	NA
WP_001296826.1|266811_267429_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	2.5e-12
>prophage 19
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	276196	281974	4797106		Bacillus_phage(25.0%)	5	NA	NA
WP_024239111.1|276196_277840_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884942.1|277915_278566_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710370.1|278565_279630_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406098.1|279703_280759_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865571.1|280870_281974_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	6.2e-118
>prophage 20
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	286250	289100	4797106		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|286250_289100_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 21
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	298800	312856	4797106		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|298800_301428_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990754.1|301574_302297_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001220036.1|302424_306159_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.4	6.9e-20
WP_001075170.1|306854_309140_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.9e-283
WP_000332036.1|309228_310359_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|310358_310613_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|310666_311317_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000768973.1|311779_312856_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 22
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	318749	319652	4797106	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140590.1|318749_319652_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.4	1.6e-68
>prophage 23
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	322804	327809	4797106		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|322804_323407_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001342601.1|323715_324855_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.9e-29
WP_000461661.1|324858_325827_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_000860259.1|325826_327809_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 24
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	362225	365453	4797106		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|362225_362825_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012891.1|362883_364716_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|364802_365453_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 25
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	376012	377885	4797106		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|376012_376915_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|377111_377885_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 26
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	382096	383614	4797106		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|382096_383614_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 27
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	388199	486470	4797106	tRNA,capsid,integrase,lysis,head,tail,transposase,protease,holin,terminase	Enterobacteria_phage(34.25%)	113	418014:418030	495930:495946
WP_001283581.1|388199_389012_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_073569599.1|389011_390025_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|390090_391227_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_024239112.1|391325_392321_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127750.1|392317_393496_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|393779_395000_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683799.1|395158_397165_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|397285_397564_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|397597_398146_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447356.1|398145_398955_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_001043821.1|398954_399779_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001297933.1|399782_400868_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001309606.1|400902_401835_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|402000_402552_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000399648.1|402746_403727_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001442176.1|403953_404826_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_000730291.1|404812_405337_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000822649.1|405333_405804_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000842082.1|405800_406349_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001281615.1|406323_407076_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001112828.1|407095_409738_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033328.1|409819_410383_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|411066_411552_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426164.1|411754_413899_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531954.1|413898_415209_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|415388_415673_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|416044_417385_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
418014:418030	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|418990_419746_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|420039_420972_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
WP_024228548.1|421283_422441_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.0	1.5e-220
WP_114043327.1|422559_422769_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_032361482.1|422908_423499_-	protein kinase	NA	NA	NA	NA	NA
WP_001023396.1|424631_424901_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_073569602.1|424902_426216_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.6	1.8e-76
WP_001230471.1|426280_426880_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_122998565.1|430657_431290_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	93.8	4.5e-105
WP_073569603.1|431235_431979_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.6e-147
WP_053890320.1|431989_432688_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	1.2e-130
WP_000807964.1|432687_433029_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_073569604.1|433021_436264_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	94.9	0.0e+00
WP_001513217.1|436311_436521_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030043.1|436616_436991_-|tail	phage tail assembly chaperone	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275476.1|436996_437713_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	98.7	5.6e-128
WP_000133388.1|437779_438124_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|438120_438567_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007889.1|438563_438914_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125984.1|438924_439251_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_024239159.1|441291_441513_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	97.2	4.2e-34
WP_073569605.1|441557_443495_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.8	0.0e+00
WP_024239161.1|445387_447049_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_024239162.1|447045_447609_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	91.4	2.2e-79
WP_000279804.1|447899_448265_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	99.2	4.0e-66
WP_000095738.1|448306_448507_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	92.4	5.8e-27
WP_000828070.1|448638_448965_-	TonB family protein	NA	H6WZK5	Escherichia_phage	98.1	6.3e-55
WP_000735651.1|449303_449528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032217790.1|449613_449799_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	85.2	6.2e-23
WP_001280932.1|450021_450153_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001151823.1|450167_450350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092963.1|450506_451040_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	4.3e-101
WP_001359554.1|451090_451381_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.0	2.5e-47
WP_000381395.1|451411_452983_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|453002_453350_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001299364.1|453349_454027_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000736096.1|454386_454611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001082547.1|454607_455102_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	100.0	1.7e-83
WP_073569606.1|455400_455934_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	98.3	2.3e-102
WP_000731247.1|455984_456329_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	3.8e-58
WP_024164617.1|456333_456549_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_073569587.1|456987_458838_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.6	0.0e+00
WP_000499454.1|459135_459294_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_139944056.1|459379_460123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052935690.1|460374_460998_-	antitermination protein	NA	K7P6X1	Enterobacteria_phage	99.0	1.5e-113
WP_073569607.1|460994_461660_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	98.2	2.1e-129
WP_073569608.1|461656_462262_-	recombination protein NinG	NA	Q8VNP2	Enterobacteria_phage	98.0	4.7e-96
WP_001004008.1|462261_462984_-	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	99.6	3.9e-129
WP_000211422.1|463058_463793_-	phage antirepressor Ant	NA	A0A0N7C203	Escherichia_phage	100.0	1.9e-123
WP_001254221.1|464067_464250_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_000153280.1|464246_464774_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_000736903.1|464770_465211_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_073569609.1|465284_465575_-	protein ren	NA	K7P7K7	Enterobacteria_phage	99.0	4.8e-46
WP_073569610.1|465571_466273_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_033801434.1|466269_467208_-	replication protein	NA	H6WZI2	Escherichia_phage	99.7	8.2e-172
WP_000438541.1|467240_467537_-	hypothetical protein	NA	C1JJ56	Enterobacteria_phage	100.0	8.9e-48
WP_001180318.1|467675_467903_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000250473.1|467981_468689_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_073569611.1|468769_469795_+	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	42.4	7.1e-76
WP_000198444.1|470298_470682_+	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_024246248.1|470743_471367_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	95.7	4.7e-107
WP_000065374.1|471547_471916_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198861.1|471988_472153_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372941.1|472121_472265_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_073519243.1|472339_472618_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.7e-45
WP_073569612.1|472642_473428_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	3.1e-148
WP_000186788.1|473424_474105_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	1.8e-131
WP_000682297.1|474101_474284_+	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	96.7	2.4e-27
WP_000548537.1|474256_474448_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_032310578.1|474524_474740_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	1.7e-32
WP_073569613.1|474838_475060_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	3.2e-34
WP_001289864.1|475056_475464_+	ead/Ea22-like family protein	NA	A0A125RPT9	Escherichia_phage	97.8	2.8e-68
WP_000582229.1|475465_476221_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	5.5e-142
WP_001277762.1|476957_477137_+	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	100.0	1.5e-29
WP_001163428.1|477268_477469_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_000996991.1|477741_479016_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.8	5.9e-72
WP_073569615.1|479046_479928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000173141.1|480030_480246_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001118612.1|480606_480783_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	55.6	4.2e-05
WP_001246994.1|480775_481135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027154.1|481166_481451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001075586.1|481447_481831_+	DUF5375 family protein	NA	NA	NA	NA	NA
WP_024239199.1|481827_484500_+	TOPRIM and DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.6	3.2e-59
WP_001066218.1|484900_485644_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000126950.1|485640_486192_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185341.1|486197_486470_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	40.6	1.7e-08
495930:495946	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 28
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	492043	493477	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|492043_493477_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 29
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	500118	507695	4797106		Hokovirus(50.0%)	4	NA	NA
WP_001348569.1|500118_503712_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|503767_504913_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|504986_505931_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283499.1|506000_507695_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
>prophage 30
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	511110	513606	4797106	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_087599250.1|511110_512273_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000484404.1|512685_513606_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 31
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	517424	518159	4797106		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|517424_518159_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 32
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	543853	559223	4797106		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|543853_545869_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|545939_546926_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|547155_547917_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|548101_549073_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|549456_549714_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|549758_551486_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|551526_552036_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_024239077.1|552077_552929_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|553033_553402_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001297645.1|553404_554316_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000021040.1|554449_555547_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852686.1|555536_556412_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458405.1|556411_557245_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290223.1|557244_558261_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517431.1|558431_559223_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 33
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	562701	567639	4797106		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|562701_564006_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|564063_564963_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|565058_565634_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001325675.1|565694_566144_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|566130_566556_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|566769_567639_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 34
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	586193	587144	4797106		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|586193_587144_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 35
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	605192	605906	4797106		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|605192_605906_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 36
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	627198	631200	4797106		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|627198_628488_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|628573_629200_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|629524_630562_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|630561_631200_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 37
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	637446	643931	4797106		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|637446_637599_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|637616_637808_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001317257.1|638118_638637_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000755173.1|638652_639192_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_000138282.1|639286_640864_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|640932_642399_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|642560_643931_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 38
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	652760	653192	4797106		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|652760_653192_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 39
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	663083	669540	4797106		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|663083_664367_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|664544_664745_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|664756_665092_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|665093_666944_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|666960_667476_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|667571_667895_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|667911_668298_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|668325_669540_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 40
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	684704	686216	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493457.1|684704_686216_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.3	3.3e-13
>prophage 41
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	691974	703282	4797106		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|691974_693228_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883101.1|693556_694747_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|694791_695130_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|695190_696525_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215855.1|696514_697228_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298980.1|697391_698819_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970114.1|699394_703282_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	7.7e-131
>prophage 42
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	707401	707662	4797106		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|707401_707662_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 43
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	711121	714864	4797106		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|711121_711802_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|712074_713049_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790178.1|713064_714864_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 44
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	721912	723247	4797106		Cafeteria_roenbergensis_virus(100.0%)	1	NA	NA
WP_000219193.1|721912_723247_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 45
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	726361	729450	4797106	tRNA	Enterobacteria_phage(33.33%)	4	NA	NA
WP_000627807.1|726361_726745_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|727049_727739_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|727786_728824_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|729030_729450_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 46
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	734743	736042	4797106		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|734743_736042_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 47
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	741907	744481	4797106		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|741907_744481_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 48
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	750387	751458	4797106		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168054.1|750387_751458_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	5.3e-90
>prophage 49
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	765092	772856	4797106	transposase,integrase	Escherichia_phage(66.67%)	6	762880:762893	769993:770006
762880:762893	attL	CGACTATTTGAACT	NA	NA	NA	NA
WP_000162574.1|765092_765575_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_001341819.1|766317_767547_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|767585_768002_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214990.1|768073_769822_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.8	0.0e+00
WP_000577255.1|769823_771542_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.7	2.1e-306
769993:770006	attR	AGTTCAAATAGTCG	NA	NA	NA	NA
WP_087599250.1|771693_772856_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 50
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	778114	782239	4797106		Klosneuvirus(50.0%)	4	NA	NA
WP_001087610.1|778114_779395_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	8.4e-34
WP_001325764.1|779705_781106_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|781126_781789_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|781789_782239_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 51
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	786174	791470	4797106		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|786174_786420_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|786416_786827_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246530.1|786799_788944_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.1	2.4e-195
WP_000777969.1|788953_789913_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_001299852.1|790267_791470_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 52
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	804655	810215	4797106	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|804655_804841_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047176.1|805075_807706_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_073569619.1|807833_808334_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|808576_809638_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|809717_810215_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 53
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	815681	816647	4797106		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287415.1|815681_816647_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	1.8e-36
>prophage 54
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	824122	825133	4797106		Enterobacteria_phage(100.0%)	1	NA	NA
WP_077898858.1|824122_825133_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	2.7e-27
>prophage 55
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	844204	851344	4797106		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|844204_846766_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|846871_847528_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|847578_848346_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|848541_849450_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|849446_850709_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|850705_851344_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 56
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	856558	860274	4797106		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|856558_857551_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|857613_858753_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|858892_859519_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001349984.1|859512_860274_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	4.9e-58
>prophage 57
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	863386	865419	4797106		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|863386_863992_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090348.1|863991_865419_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	2.2e-30
>prophage 58
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	895318	901161	4797106		Vibrio_phage(33.33%)	6	NA	NA
WP_001199982.1|895318_895990_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001379137.1|896162_896765_+	LemA family protein	NA	NA	NA	NA	NA
WP_000793004.1|896778_897684_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000034929.1|897719_898082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|898137_899436_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|899523_901161_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 59
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	905193	909308	4797106		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046785.1|905193_906495_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|906551_909308_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 60
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	916842	917691	4797106		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|916842_917691_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 61
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	922549	923305	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|922549_923305_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 62
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	934831	950380	4797106	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_001299106.1|934831_936037_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
WP_000184249.1|936036_936480_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117734.1|936530_937337_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	3.8e-16
WP_000678646.1|937575_938673_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|939252_940506_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237948.1|940737_942069_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775946.1|942130_943957_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.6	7.8e-25
WP_001285985.1|943956_947499_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.5e-08
WP_001138163.1|947491_950380_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 63
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	955857	962630	4797106		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|955857_956652_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|956658_957534_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|957684_959931_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|959943_960474_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|961158_961848_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|961916_962630_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 64
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	972261	974756	4797106		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|972261_973680_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|973994_974756_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 65
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	997583	998339	4797106		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|997583_998339_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 66
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1022618	1038010	4797106	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|1022618_1024019_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|1024036_1025353_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|1025388_1026756_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|1026791_1027280_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|1027279_1029199_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|1029634_1031083_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|1031084_1031210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|1031206_1031278_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192814.1|1031332_1031881_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|1031923_1033441_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|1033450_1034549_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813215.1|1034639_1036373_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|1036378_1037089_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|1037113_1038010_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 67
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1041934	1047307	4797106		Pandoravirus(50.0%)	3	NA	NA
WP_001363803.1|1041934_1043368_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	2.6e-31
WP_000951948.1|1043424_1044168_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195058.1|1044433_1047307_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	2.8e-263
>prophage 68
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1055834	1057067	4797106		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|1055834_1057067_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 69
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1075118	1075796	4797106		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|1075118_1075796_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 70
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1089372	1090527	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|1089372_1090527_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 71
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1144086	1145259	4797106		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524975.1|1144086_1145259_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	9.4e-40
>prophage 72
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1167473	1168358	4797106		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_073569625.1|1167473_1168358_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.5	3.4e-66
>prophage 73
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1175713	1186537	4797106		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|1175713_1176541_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|1176740_1177667_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848540.1|1177717_1177975_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|1178017_1180237_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|1180347_1181760_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|1181834_1182572_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|1182805_1185064_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|1185609_1186092_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|1186144_1186537_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 74
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1190364	1201326	4797106		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|1190364_1192257_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|1192285_1192867_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|1192866_1193694_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|1193718_1194141_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|1194141_1194771_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|1194975_1196457_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|1196604_1197276_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442859.1|1197281_1198442_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001442184.1|1198479_1199268_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|1199410_1200184_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|1200241_1200412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|1200672_1201326_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 75
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1210841	1212275	4797106		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869187.1|1210841_1212275_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	5.1e-40
>prophage 76
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1217412	1218651	4797106	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|1217412_1218651_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 77
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1225033	1241216	4797106	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|1225033_1226047_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|1226283_1226499_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|1226609_1228355_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|1228549_1230391_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|1230468_1230975_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|1231228_1231993_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018018.1|1232269_1232893_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094676.1|1233046_1234567_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001365895.1|1234984_1236364_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.4	5.8e-33
WP_000450589.1|1236405_1236738_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|1236956_1237940_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_073569627.1|1238123_1241216_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	33.9	5.9e-158
>prophage 78
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1253636	1254602	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_001098805.1|1253636_1254602_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 79
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1280835	1283130	4797106		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1280835_1283130_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 80
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1291009	1292155	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_024239262.1|1291009_1292155_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	2.2e-49
>prophage 81
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1315164	1322957	4797106		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809253.1|1315164_1316025_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
WP_000249157.1|1316088_1318125_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246859.1|1318082_1318478_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158035.1|1318497_1319088_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|1319097_1319673_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147619.1|1319786_1320827_-	permease	NA	NA	NA	NA	NA
WP_001315854.1|1320899_1321535_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|1321662_1322181_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449451.1|1322160_1322604_-	YhbP family protein	NA	NA	NA	NA	NA
WP_001345969.1|1322654_1322957_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
>prophage 82
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1328784	1330674	4797106		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|1328784_1330674_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 83
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1336155	1342794	4797106		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|1336155_1338828_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|1338852_1340340_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|1340367_1340820_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207683.1|1341450_1342794_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 84
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1346876	1349749	4797106	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|1346876_1347725_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|1347814_1349749_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 85
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1356377	1357855	4797106		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|1356377_1357349_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|1357576_1357855_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 86
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1361923	1376718	4797106		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|1361923_1362733_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|1362942_1363920_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|1363933_1364920_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|1364940_1365507_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|1365503_1366079_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|1366047_1366605_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|1366611_1367337_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809036.1|1367384_1368818_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|1368840_1369128_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|1369245_1369737_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|1369782_1370637_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|1370633_1370906_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|1371119_1371752_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|1371748_1372477_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001297560.1|1372473_1373127_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|1373356_1375693_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001176896.1|1375788_1376718_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 87
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1383467	1388215	4797106		Salmonella_phage(50.0%)	5	NA	NA
WP_000445145.1|1383467_1384595_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	87.8	1.4e-72
WP_000979882.1|1384654_1385119_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209003.1|1385115_1385991_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|1385987_1386677_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|1386724_1388215_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 88
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1391919	1392417	4797106	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1391919_1392417_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 89
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1396383	1398908	4797106	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|1396383_1397751_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|1397840_1398908_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 90
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1415404	1416448	4797106		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1415404_1416448_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 91
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1427013	1427898	4797106		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258910.1|1427013_1427898_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.4e-24
>prophage 92
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1434402	1438556	4797106		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|1434402_1435428_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|1435495_1436677_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001299298.1|1436686_1437790_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078339.1|1437797_1438556_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 93
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1449056	1450528	4797106	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|1449056_1449566_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004451.1|1449580_1450528_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 94
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1470405	1475979	4797106		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|1470405_1471590_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|1471660_1473775_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|1473871_1474342_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|1474438_1474813_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|1474938_1475226_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820724.1|1475233_1475593_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209710.1|1475592_1475979_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
>prophage 95
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1481549	1491090	4797106		Tupanvirus(25.0%)	9	NA	NA
WP_024239043.1|1481549_1483463_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
WP_000057405.1|1483462_1484485_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|1484478_1484697_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274684.1|1484750_1485620_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|1485674_1486079_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|1486380_1487013_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001345983.1|1487063_1489154_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963785.1|1489220_1490441_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|1490526_1491090_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 96
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1515317	1516154	4797106		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1515317_1516154_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 97
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1533129	1537641	4797106		Bacillus_phage(66.67%)	5	NA	NA
WP_001265681.1|1533129_1534752_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493756.1|1534868_1535186_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650976.1|1535244_1535541_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253692.1|1535572_1536925_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	1.1e-10
WP_001157751.1|1536921_1537641_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 98
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1544223	1545102	4797106		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|1544223_1545102_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 99
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1551071	1553465	4797106		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1551071_1553465_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 100
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1557844	1559071	4797106		Ralstonia_phage(100.0%)	1	NA	NA
WP_073569633.1|1557844_1559071_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.8	8.9e-134
>prophage 101
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1568300	1570748	4797106		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|1568300_1570748_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 102
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1590757	1592568	4797106		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073590.1|1590757_1591501_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
WP_000907801.1|1591497_1592568_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 103
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1596108	1597591	4797106		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|1596108_1596822_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|1596823_1597591_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 104
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1604072	1606891	4797106		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|1604072_1604927_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|1605171_1606230_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|1606222_1606891_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 105
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1609894	1614026	4797106		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|1609894_1610521_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106527.1|1610594_1612793_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000130621.1|1612894_1613140_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|1613360_1614026_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 106
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1621919	1627802	4797106		Bacillus_virus(50.0%)	5	NA	NA
WP_000173666.1|1621919_1622726_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|1622731_1623133_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|1623252_1623612_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001442171.1|1623942_1625067_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149168.1|1625066_1627802_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 107
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1641216	1643259	4797106		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|1641216_1643259_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 108
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1646604	1648739	4797106		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008971.1|1646604_1646958_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.0	1.4e-23
WP_000922639.1|1647011_1648301_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|1648313_1648739_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 109
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1653620	1654268	4797106		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|1653620_1654268_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 110
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1701731	1703716	4797106		Bacillus_virus(50.0%)	2	NA	NA
WP_000107026.1|1701731_1702736_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196496.1|1702732_1703716_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 111
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1719466	1721800	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_000013957.1|1719466_1721800_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 112
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1725454	1725667	4797106		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1725454_1725667_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 113
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1729891	1730887	4797106		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|1729891_1730887_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 114
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1736205	1737747	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|1736205_1737747_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 115
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1761934	1770331	4797106	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000582487.1|1761934_1763779_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
WP_000206275.1|1763775_1765167_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|1765264_1765873_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_073569635.1|1766101_1770331_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.8	1.6e-25
>prophage 116
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1792326	1803054	4797106		Rhizobium_phage(16.67%)	10	NA	NA
WP_000024392.1|1792326_1792578_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001315904.1|1792718_1793150_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_001352773.1|1793394_1794939_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|1794948_1796232_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|1796235_1797195_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982091.1|1797181_1798216_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|1798454_1799480_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213828.1|1799489_1800686_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000842823.1|1800960_1801818_-	protein YibB	NA	NA	NA	NA	NA
WP_000587764.1|1802121_1803054_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
>prophage 117
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1814985	1819548	4797106		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|1814985_1815465_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|1815503_1816313_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|1816410_1816578_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|1816598_1816835_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001352775.1|1817051_1817720_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|1817891_1819112_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|1819089_1819548_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 118
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1822921	1829672	4797106		Morganella_phage(25.0%)	6	NA	NA
WP_001299758.1|1822921_1823746_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	6.9e-90
WP_000924289.1|1824037_1824655_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_001347580.1|1824651_1826334_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.5	8.7e-23
WP_001295237.1|1826591_1827215_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|1827269_1827545_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|1827563_1829672_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 119
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1834115	1835507	4797106		environmental_Halophage(100.0%)	1	NA	NA
WP_024238999.1|1834115_1835507_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	99.3	4.2e-71
>prophage 120
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1871642	1873181	4797106		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000723931.1|1871642_1873181_+	type III secretion system LEE outer membrane ring protein EscC	NA	D0U184	Enterobacteria_phage	29.3	1.0e-09
>prophage 121
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1895151	1896486	4797106		Moraxella_phage(100.0%)	1	NA	NA
WP_001570473.1|1895151_1896486_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 122
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1907151	1916174	4797106		Micromonas_pusilla_virus(25.0%)	10	NA	NA
WP_000168463.1|1907151_1908840_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.7	1.2e-56
WP_001312198.1|1908945_1909044_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|1909608_1909698_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001306726.1|1909977_1911162_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	6.8e-14
WP_000148037.1|1911169_1911667_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|1911663_1912026_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|1912015_1912363_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|1912472_1912922_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|1912968_1914462_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|1914458_1916174_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 123
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1922527	1923481	4797106		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|1922527_1922956_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|1923067_1923481_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 124
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1927908	1929057	4797106		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1927908_1929057_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 125
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1933763	1941132	4797106		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|1933763_1936178_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|1936206_1937280_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|1937279_1938380_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|1938384_1939788_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|1940084_1940165_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|1940394_1940535_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|1940551_1940911_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|1940874_1941132_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 126
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1951330	1952668	4797106		Moraxella_phage(100.0%)	1	NA	NA
WP_001365822.1|1951330_1952668_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	4.5e-62
>prophage 127
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1963658	1967499	4797106		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|1963658_1964432_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|1964522_1965413_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|1965412_1966372_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|1966458_1967499_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 128
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1973030	1976392	4797106		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334106.1|1973030_1974860_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	2.5e-132
WP_000933726.1|1975021_1976392_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 129
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1988344	1989337	4797106		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845134.1|1988344_1989337_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 130
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	1992505	1998358	4797106		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|1992505_1994374_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001297694.1|1994540_1994960_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387752.1|1994967_1996473_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	6.0e-15
WP_000211858.1|1996477_1997443_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|1997467_1998358_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 131
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2011838	2013485	4797106		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012621.1|2011838_2013485_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	7.4e-67
>prophage 132
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2021900	2027312	4797106		Bacillus_phage(33.33%)	4	NA	NA
WP_001238890.1|2021900_2023922_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001299253.1|2023968_2025453_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|2025586_2026852_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|2026982_2027312_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 133
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2031354	2037498	4797106		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866673.1|2031354_2032485_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	1.9e-26
WP_000006625.1|2032481_2033744_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226586.1|2033743_2034811_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	2.1e-102
WP_000676056.1|2034829_2035711_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145196.1|2035688_2036363_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|2036367_2037498_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 134
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2053813	2056602	4797106		Salmonella_phage(100.0%)	2	NA	NA
WP_073569638.1|2053813_2055127_-	DKNYY family protein	NA	A0A0U2C3T4	Salmonella_phage	33.6	4.7e-08
WP_001300182.1|2055123_2056602_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 135
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2059638	2063497	4797106		Bacillus_phage(100.0%)	3	NA	NA
WP_000130701.1|2059638_2060535_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|2060534_2061251_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383411.1|2061334_2063497_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.0	1.0e-116
>prophage 136
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2070983	2072813	4797106		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|2070983_2072813_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 137
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2085225	2088512	4797106		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|2085225_2086866_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|2086944_2087214_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|2087217_2087733_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|2087735_2088512_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 138
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2097302	2097917	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_001296979.1|2097302_2097917_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 139
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2111605	2114392	4797106		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|2111605_2114392_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 140
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2118470	2120941	4797106		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|2118470_2119880_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|2119891_2120941_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 141
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2128257	2132988	4797106		Escherichia_phage(33.33%)	5	NA	NA
WP_000022286.1|2128257_2129046_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	1.3e-21
WP_001442188.1|2129085_2129982_-	sugar kinase	NA	NA	NA	NA	NA
WP_001299483.1|2130154_2131033_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.7e-47
WP_000094544.1|2131057_2131945_+	aldolase	NA	NA	NA	NA	NA
WP_000357967.1|2131977_2132988_+	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
>prophage 142
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2145732	2148783	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_077629914.1|2145732_2148783_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 143
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2163546	2168407	4797106		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_001297064.1|2163546_2164167_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|2164426_2165410_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270248.1|2165558_2166233_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2166338_2167712_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2167708_2168407_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 144
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2179982	2184485	4797106		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|2179982_2180828_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2181252_2181498_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2181582_2182068_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2182160_2183087_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|2183153_2184485_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 145
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2207176	2214423	4797106		Synechococcus_phage(33.33%)	5	NA	NA
WP_024239114.1|2207176_2207839_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174083.1|2207850_2210352_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|2210660_2211740_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|2211754_2212075_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184821.1|2212125_2214423_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 146
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2226540	2227755	4797106		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|2226540_2227755_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 147
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2234505	2236350	4797106		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|2234505_2236350_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 148
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2244941	2247994	4797106		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|2244941_2245892_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|2246809_2247994_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 149
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2252110	2260439	4797106		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|2252110_2256139_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|2256215_2260439_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 150
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2269655	2271419	4797106		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|2269655_2270327_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|2270369_2270960_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|2271146_2271419_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 151
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2276787	2278377	4797106		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|2276787_2278377_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 152
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2293846	2297530	4797106		Dickeya_phage(100.0%)	1	NA	NA
WP_000096012.1|2293846_2297530_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 153
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2303180	2303972	4797106		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130533.1|2303180_2303972_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.2e-46
>prophage 154
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2319779	2320895	4797106		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|2319779_2320895_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 155
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2330110	2330719	4797106		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|2330110_2330719_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 156
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2337309	2339857	4797106		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|2337309_2338725_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|2338777_2339857_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 157
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2344065	2347678	4797106		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|2344065_2346888_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|2347141_2347678_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 158
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2351495	2352845	4797106		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|2351495_2352845_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 159
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2359204	2361163	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|2359204_2361163_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 160
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2370446	2372594	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|2370446_2372594_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 161
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2377839	2379825	4797106		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001365978.1|2377839_2379825_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 162
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2383810	2385426	4797106		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611419.1|2383810_2384491_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	3.2e-08
WP_001075526.1|2384667_2385426_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 163
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2390992	2391781	4797106		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|2390992_2391781_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 164
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2396620	2398123	4797106		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|2396620_2398123_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 165
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2419319	2422531	4797106	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|2419319_2420837_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|2421073_2422531_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 166
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2436808	2438792	4797106		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|2436808_2437102_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|2437145_2438792_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 167
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2444577	2445111	4797106		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|2444577_2445111_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 168
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2450031	2451009	4797106		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|2450031_2451009_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 169
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2458427	2458973	4797106		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|2458427_2458973_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 170
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2462888	2475920	4797106	protease,tRNA	Vibrio_phage(20.0%)	11	NA	NA
WP_000990322.1|2462888_2464226_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	1.1e-17
WP_001122500.1|2464235_2466083_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|2466075_2467026_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|2467111_2467420_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|2467496_2468777_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312490.1|2468862_2470122_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|2470124_2471129_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|2471210_2471408_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527958.1|2471511_2472810_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.6	3.8e-66
WP_001177639.1|2473014_2473440_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|2473478_2475920_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
>prophage 171
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2479853	2481017	4797106		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943987.1|2479853_2481017_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
>prophage 172
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2495901	2497110	4797106	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_063106993.1|2495901_2497110_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	3.2e-208
>prophage 173
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2517052	2523710	4797106		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|2517052_2517583_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|2517892_2518849_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205795.1|2519158_2520661_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_001296689.1|2520674_2521697_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|2521683_2522679_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|2522711_2523710_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 174
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2528020	2530781	4797106		Vibrio_phage(100.0%)	2	NA	NA
WP_001106222.1|2528020_2528485_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|2528642_2530781_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 175
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2534419	2540876	4797106	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_001181332.1|2534419_2535367_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001387276.1|2535551_2535605_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|2535745_2538442_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001118337.1|2538486_2538942_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047539.1|2539007_2539394_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|2539466_2539928_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|2539940_2540876_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 176
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2549154	2560210	4797106	integrase,tRNA	Klosneuvirus(25.0%)	8	2546765:2546780	2563350:2563365
2546765:2546780	attL	GGAAGAACAGCGTGAA	NA	NA	NA	NA
WP_000416382.1|2549154_2552010_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|2552009_2552453_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|2552586_2554098_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|2554364_2555465_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|2555464_2556547_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001283180.1|2556665_2558168_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	8.8e-83
WP_001514390.1|2558250_2558460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218945.1|2558965_2560210_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.4	5.0e-84
2563350:2563365	attR	GGAAGAACAGCGTGAA	NA	NA	NA	NA
>prophage 177
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2564488	2570217	4797106		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001127874.1|2564488_2567644_+	hypothetical protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	24.8	1.8e-13
WP_001046727.1|2567649_2570217_+	ATP-dependent DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	27.2	2.6e-26
>prophage 178
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2584666	2585017	4797106		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000624722.1|2584666_2585017_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
>prophage 179
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2590915	2596121	4797106	transposase	Stx2-converting_phage(60.0%)	7	NA	NA
WP_000381395.1|2590915_2592487_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2592506_2592854_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001299364.1|2592853_2593531_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_073569646.1|2593708_2594161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298943.1|2594232_2594706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234409.1|2594825_2595647_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	37.6	1.2e-44
WP_001096016.1|2595677_2596121_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.2	3.5e-16
>prophage 180
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2600461	2601442	4797106		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001366032.1|2600461_2601442_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	9.4e-102
>prophage 181
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2604803	2606480	4797106		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|2604803_2605406_+	type 1 fimbria switch DNA invertase FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|2605883_2606480_+	type 1 fimbria switch DNA invertase FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 182
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2616745	2618206	4797106		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208180.1|2616745_2618206_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 183
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2624773	2625328	4797106		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151848.1|2624773_2625328_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	7.8e-37
>prophage 184
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2632829	2633786	4797106	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181158.1|2632829_2633786_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	5.1e-60
>prophage 185
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2653853	2659218	4797106		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919571.1|2653853_2655518_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|2655566_2656928_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|2657142_2658057_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106030.1|2658195_2659218_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 186
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2662445	2663725	4797106		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|2662445_2663183_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098819.1|2663185_2663725_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	61.7	8.4e-28
>prophage 187
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2671622	2674498	4797106		Streptococcus_phage(50.0%)	3	NA	NA
WP_073569647.1|2671622_2673212_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.4	1.8e-30
WP_001295748.1|2673604_2674210_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|2674336_2674498_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
>prophage 188
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2680133	2681456	4797106		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|2680133_2681456_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 189
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2688199	2693554	4797106		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|2688199_2689432_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|2689738_2691406_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|2691616_2693554_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 190
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2696837	2698951	4797106		Bacillus_phage(50.0%)	2	NA	NA
WP_001188666.1|2696837_2697527_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_024239017.1|2697526_2698951_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	22.1	9.4e-10
>prophage 191
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2710719	2719788	4797106		Cyanophage(20.0%)	9	NA	NA
WP_000130185.1|2710719_2711673_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.5	1.7e-10
WP_001094682.1|2711787_2712375_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|2712409_2712976_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102379.1|2713124_2713838_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|2713863_2714268_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|2714644_2716561_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|2716649_2717780_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|2717883_2718093_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681368.1|2718621_2719788_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 192
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2726819	2729636	4797106	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|2726819_2729636_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 193
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2734042	2735191	4797106		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|2734042_2735191_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 194
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2740661	2746322	4797106		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|2740661_2742215_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349932.1|2742288_2743506_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347137.1|2743634_2744777_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787100.1|2744807_2746322_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 195
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2754216	2755616	4797106		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|2754216_2754696_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257186.1|2754773_2755616_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 196
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2763360	2768783	4797106		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117010.1|2763360_2766267_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_024239015.1|2766431_2768783_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	2.3e-37
>prophage 197
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2775115	2775814	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|2775115_2775814_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 198
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2788516	2790241	4797106		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|2788516_2790241_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 199
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2816214	2817258	4797106		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|2816214_2817258_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 200
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2821503	2822055	4797106		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|2821503_2822055_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 201
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2830682	2832107	4797106		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|2830682_2832107_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 202
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2839757	2846380	4797106		Mamastrovirus(33.33%)	5	NA	NA
WP_001189626.1|2839757_2841308_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001349940.1|2841509_2843900_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|2844105_2844642_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|2844682_2845345_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|2845453_2846380_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 203
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2849642	2850545	4797106		Sodalis_phage(100.0%)	1	NA	NA
WP_000339944.1|2849642_2850545_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 204
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2861227	2868033	4797106	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174639.1|2861227_2862646_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|2862684_2863611_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|2863647_2864103_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|2864280_2864985_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|2864999_2865530_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001365765.1|2865603_2868033_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	1.8e-40
>prophage 205
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2873276	2874074	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158929.1|2873276_2874074_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	6.0e-14
>prophage 206
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2879985	2880330	4797106		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|2879985_2880330_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 207
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2884259	2885684	4797106	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_073569649.1|2884259_2885684_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 208
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2897568	2898327	4797106		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|2897568_2898327_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 209
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2907155	2911271	4797106		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|2907155_2907752_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|2907788_2911271_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 210
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2924230	2925262	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|2924230_2925262_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 211
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2931778	2939631	4797106		Indivirus(25.0%)	9	NA	NA
WP_000997010.1|2931778_2932582_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648601.1|2932578_2933493_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2933733_2934534_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|2934611_2935382_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644683.1|2935429_2936788_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052751.1|2936859_2937615_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|2937648_2938371_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2938367_2938835_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|2938899_2939631_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 212
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2950104	2952942	4797106		Enterobacteria_phage(100.0%)	1	NA	NA
WP_053893895.1|2950104_2952942_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	27.7	5.9e-80
>prophage 213
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2963894	2970356	4797106		Ralstonia_phage(50.0%)	2	NA	NA
WP_053877322.1|2963894_2966036_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_073569650.1|2966111_2970356_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	1.5e-23
>prophage 214
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2977536	2981455	4797106		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|2977536_2978115_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|2978320_2979088_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|2979058_2979799_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|2979954_2980233_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|2980235_2980496_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543897.1|2980681_2981455_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.6e-19
>prophage 215
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2986533	2987673	4797106		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528869.1|2986533_2987673_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
>prophage 216
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	2992350	2999932	4797106		Streptococcus_phage(50.0%)	6	NA	NA
WP_000749881.1|2992350_2993406_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|2993693_2994797_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|2994808_2996062_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001111349.1|2996378_2996789_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000121330.1|2996767_2997724_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|2997733_2999932_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 217
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3003019	3005635	4797106	transposase	Stx2-converting_phage(100.0%)	3	NA	NA
WP_001299364.1|3003019_3003697_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3003696_3004044_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3004063_3005635_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
>prophage 218
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3022835	3024161	4797106		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046330.1|3022835_3024161_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	48.1	1.3e-114
>prophage 219
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3029735	3040211	4797106	holin	Catovirus(33.33%)	5	NA	NA
WP_001159102.1|3029735_3031406_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089066.1|3031419_3032892_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001351501.1|3032905_3033493_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|3033621_3035655_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_072128909.1|3036227_3040211_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	9.3e-124
>prophage 220
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3052204	3056742	4797106		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|3052204_3053689_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|3053681_3054653_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|3054649_3055606_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692742.1|3055692_3056742_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
>prophage 221
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3065122	3067009	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010284.1|3065122_3067009_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 222
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3071197	3072097	4797106		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952485.1|3071197_3072097_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 223
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3075937	3080217	4797106		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_000177960.1|3075937_3079012_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	97.9	0.0e+00
WP_000805910.1|3079134_3080217_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
>prophage 224
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3085627	3087588	4797106		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|3085627_3086578_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|3086574_3087588_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 225
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3090666	3091776	4797106		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|3090666_3091776_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 226
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3097065	3097833	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939380.1|3097065_3097833_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	39.8	1.5e-25
>prophage 227
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3104797	3105955	4797106		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830739.1|3104797_3105955_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 228
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3113370	3114486	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|3113370_3114486_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 229
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3118829	3128801	4797106		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|3118829_3119741_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219321.1|3119865_3120774_+	fructokinase	NA	NA	NA	NA	NA
WP_001433175.1|3120916_3122101_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698919.1|3122226_3125370_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|3125366_3126569_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|3126758_3127448_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_073569653.1|3127505_3128801_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.9	1.7e-26
>prophage 230
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3135753	3144734	4797106	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|3135753_3136881_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|3136903_3137236_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|3137263_3139111_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|3139121_3140093_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|3140221_3140569_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|3140745_3141630_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|3141928_3142468_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|3142618_3143068_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150472.1|3143071_3144175_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_001021161.1|3144263_3144734_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 231
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3168440	3173487	4797106	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|3168440_3169064_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|3169189_3170464_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|3170651_3173006_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|3173214_3173487_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 232
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3176627	3177323	4797106		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817236.1|3176627_3177323_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	8.4e-89
>prophage 233
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3180645	3184192	4797106		Bacillus_phage(100.0%)	2	NA	NA
WP_001235606.1|3180645_3182418_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256182.1|3182410_3184192_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	5.2e-42
>prophage 234
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3193027	3196177	4797106		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|3193027_3196177_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 235
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3203185	3211643	4797106		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|3203185_3203737_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|3203865_3205797_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_001442196.1|3205849_3206179_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|3206178_3206784_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|3206893_3208768_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001345715.1|3208948_3209593_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250120.1|3209724_3210687_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801838.1|3210683_3211643_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.7	2.9e-15
>prophage 236
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3219887	3222847	4797106		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|3219887_3220229_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_000078264.1|3220342_3222847_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	2.9e-115
>prophage 237
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3227386	3228064	4797106		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|3227386_3228064_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 238
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3231200	3231887	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110573.1|3231200_3231887_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 239
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3239425	3240136	4797106		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001306947.1|3239425_3240136_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
>prophage 240
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3245393	3247175	4797106		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|3245393_3247175_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 241
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3253365	3254511	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|3253365_3254511_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 242
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3265931	3269062	4797106	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912345.1|3265931_3267317_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|3267352_3267874_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|3267981_3268194_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|3268195_3269062_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 243
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3286218	3296286	4797106		uncultured_Caudovirales_phage(33.33%)	5	NA	NA
WP_001514606.1|3286218_3291018_-	PAAR domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	31.2	7.5e-19
WP_001160804.1|3291037_3291499_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103243.1|3291526_3293428_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.3	1.7e-27
WP_000253830.1|3294164_3295613_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|3295602_3296286_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
>prophage 244
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3299431	3302575	4797106		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|3299431_3302575_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 245
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3314004	3320047	4797106		Tupanvirus(50.0%)	3	NA	NA
WP_000077724.1|3314004_3317886_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.2	8.4e-61
WP_000096713.1|3318101_3319235_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|3319231_3320047_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 246
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3334593	3336416	4797106		uncultured_marine_virus(50.0%)	2	NA	NA
WP_072128896.1|3334593_3335223_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	3.8e-56
WP_000029813.1|3335195_3336416_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 247
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3339483	3341598	4797106		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|3339483_3341049_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|3341169_3341598_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 248
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3357022	3357670	4797106		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|3357022_3357232_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|3357286_3357670_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 249
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3362485	3364925	4797106		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|3362485_3363697_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231415.1|3363836_3364925_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 250
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3371935	3374518	4797106	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|3371935_3374518_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 251
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3381456	3384989	4797106		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367906.1|3381456_3383127_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	6.8e-76
WP_001207522.1|3383210_3384146_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|3384263_3384989_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 252
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3392885	3393926	4797106		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|3392885_3393926_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 253
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3398061	3399726	4797106		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|3398061_3399726_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 254
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3404352	3408166	4797106	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|3404352_3406299_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|3406501_3408166_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 255
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3412315	3413080	4797106		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773279.1|3412315_3413080_-	esterase	NA	A0A1J0GNR5	Mycobacterium_phage	31.5	2.9e-05
>prophage 256
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3419735	3425716	4797106		Bacillus_phage(33.33%)	4	NA	NA
WP_000186103.1|3419735_3420413_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001356143.1|3420409_3423094_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_001344323.1|3423086_3423659_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087961.1|3423667_3425716_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.6	3.4e-37
>prophage 257
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3431659	3439859	4797106		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000371590.1|3431659_3432457_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	45.3	4.9e-24
WP_000873944.1|3432456_3432783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021545485.1|3433687_3434335_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	55.2	7.5e-15
WP_000832340.1|3434331_3434901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076004.1|3436416_3436926_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000628038.1|3436922_3438341_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
WP_001513055.1|3438494_3439859_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	3.0e-45
>prophage 258
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3443237	3444029	4797106		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114035.1|3443237_3444029_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 259
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3480067	3483587	4797106		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|3480067_3480787_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|3480783_3481725_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|3481838_3482219_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_001109196.1|3482534_3483587_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 260
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3487941	3494516	4797106		Tupanvirus(33.33%)	7	NA	NA
WP_001265443.1|3487941_3488958_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
WP_000096874.1|3489219_3490692_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	7.9e-12
WP_001147439.1|3490759_3491548_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|3491676_3491826_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101994.1|3491992_3492766_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|3492765_3493455_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|3493457_3494516_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 261
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3504319	3569289	4797106	portal,capsid,integrase,lysis,head,tail,transposase,terminase	Enterobacteria_phage(48.44%)	82	3523402:3523419	3537446:3537463
WP_000533645.1|3504319_3505390_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
WP_001303849.1|3505367_3505586_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|3505625_3505793_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|3506035_3506638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032351965.1|3506848_3507070_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	98.6	1.1e-34
WP_000188870.1|3507168_3507384_-	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_000548531.1|3507460_3507652_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682318.1|3507624_3507807_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_024239197.1|3507803_3508484_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	3.0e-131
WP_073569612.1|3508480_3509266_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	3.1e-148
WP_073519243.1|3509290_3509569_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.7e-45
WP_000233576.1|3509645_3509852_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000846934.1|3510352_3511159_-	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000095354.1|3511155_3512004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295669.1|3512050_3512743_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|3512853_3513081_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_001182867.1|3513111_3513651_+	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	66.5	9.8e-61
WP_000147916.1|3513647_3514667_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	3.3e-110
WP_000788784.1|3514663_3515365_+	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.9e-128
WP_000145945.1|3515361_3515655_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	86.0	3.4e-39
WP_001524215.1|3515943_3516696_+	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	36.5	2.3e-31
WP_024239196.1|3516952_3517435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072106870.1|3517526_3517628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001050828.1|3517624_3518080_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	1.7e-58
WP_000224914.1|3518079_3518250_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774473.1|3518242_3518533_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_024239195.1|3518529_3518892_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	9.5e-60
WP_000971055.1|3518888_3519029_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204777.1|3519114_3519492_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000780581.1|3519647_3520172_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_000592546.1|3520364_3521324_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
3523402:3523419	attL	GTACGCGAACCAGACCGC	NA	NA	NA	NA
WP_000624722.1|3524357_3524708_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_001135261.1|3525348_3525846_+	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.6	4.2e-90
WP_024239299.1|3525842_3526310_+|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.1	2.1e-75
WP_001139678.1|3526297_3526450_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|3526801_3527212_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_032352032.1|3527268_3527502_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.6	2.8e-20
WP_000453576.1|3527890_3528436_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027268.1|3528410_3530336_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|3530332_3530539_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001355837.1|3530535_3532137_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.5	2.7e-308
WP_000123309.1|3532117_3533437_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_001358225.1|3533446_3533779_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_073569660.1|3534242_3535523_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	44.9	1.1e-99
WP_001299364.1|3535522_3536200_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|3536199_3536547_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3536566_3538138_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
3537446:3537463	attR	GCGGTCTGGTTCGCGTAC	NA	NA	NA	NA
WP_024239328.1|3538187_3538409_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_024239329.1|3538460_3539810_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	60.6	7.0e-164
WP_024239330.1|3539833_3540028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077817698.1|3540107_3540371_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920681.1|3540363_3540549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001156310.1|3540548_3540740_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	59.3	1.1e-11
WP_001091146.1|3540740_3540962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000425298.1|3540979_3541279_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_024239254.1|3541275_3543027_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	40.9	1.4e-92
WP_001356810.1|3543316_3543574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001710062.1|3543570_3544020_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_032257180.1|3544236_3545277_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	42.4	2.0e-65
WP_000190772.1|3545286_3545628_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001178671.1|3545639_3546023_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_053877334.1|3546268_3546820_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	72.2	9.1e-70
WP_053877333.1|3546926_3547832_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_000158880.1|3548798_3549194_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.9	2.2e-57
WP_000752994.1|3549205_3549559_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	100.0	9.0e-63
WP_024239233.1|3549570_3550149_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	96.9	1.9e-78
WP_000683142.1|3550145_3550541_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	2.9e-70
WP_024239231.1|3550548_3551289_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	6.6e-132
WP_001468358.1|3551304_3551727_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	97.9	2.8e-71
WP_000459457.1|3551708_3552143_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_053888148.1|3552135_3554697_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.2	0.0e+00
WP_000847379.1|3554693_3555023_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|3555022_3555721_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_053887856.1|3555726_3556470_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	8.6e-148
WP_000090917.1|3556406_3557039_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_053886807.1|3557099_3560597_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	97.4	0.0e+00
WP_001233090.1|3560667_3561267_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_072172145.1|3561331_3564730_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_053877315.1|3564729_3565314_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.3e-103
WP_000586345.1|3565387_3566719_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000767389.1|3567464_3567941_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_001389241.1|3567999_3569289_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 262
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3575770	3576679	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|3575770_3576679_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 263
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3587990	3602799	4797106		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996092.1|3587990_3589727_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|3589719_3590715_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|3590717_3591389_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|3591617_3592982_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145127.1|3593213_3593696_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	2.6e-36
WP_001398823.1|3593815_3595966_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.0	7.4e-43
WP_000386551.1|3595993_3596956_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443538.1|3597096_3598179_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|3598407_3598668_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|3598932_3599199_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990176.1|3599272_3599950_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430036.1|3599991_3602274_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|3602538_3602799_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 264
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3606339	3611563	4797106		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|3606339_3607062_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|3607058_3607718_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_073569661.1|3607856_3608603_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|3609006_3609510_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|3609808_3610696_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|3610929_3610995_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|3611047_3611563_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 265
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3616560	3618153	4797106		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|3616560_3618153_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 266
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3622045	3626176	4797106		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|3622045_3624478_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001295295.1|3624483_3625383_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001297004.1|3625513_3626176_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.7	9.7e-26
>prophage 267
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3629494	3631366	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_001365690.1|3629494_3631366_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 268
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3642701	3643904	4797106		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|3642701_3643904_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 269
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3652470	3661620	4797106		Vibrio_phage(25.0%)	11	NA	NA
WP_001195231.1|3652470_3652728_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_001201576.1|3652887_3653175_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|3653158_3653881_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|3653941_3654844_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|3654931_3655408_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126097.1|3655758_3656871_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996017.1|3656965_3658099_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105438.1|3658108_3659062_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|3659058_3659904_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|3659963_3660452_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|3660492_3661620_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 270
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3664957	3667695	4797106		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|3664957_3665686_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|3665903_3666419_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|3666544_3666868_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|3666864_3667695_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 271
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3671282	3673001	4797106		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|3671282_3673001_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 272
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3682260	3706156	4797106	protease,tRNA	uncultured_Mediterranean_phage(16.67%)	16	NA	NA
WP_000188193.1|3682260_3684207_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000410785.1|3684279_3684504_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|3684826_3685147_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3685177_3687454_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|3688197_3688416_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241694.1|3688700_3689405_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202185.1|3689446_3691168_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.4e-20
WP_001043587.1|3691168_3692935_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_000537418.1|3693057_3694023_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|3694567_3695062_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077018.1|3695196_3699342_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3699496_3700108_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067767.1|3700118_3701462_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|3701552_3702845_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850306.1|3703083_3705528_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|3705538_3706156_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 273
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3712466	3715681	4797106		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|3712466_3713207_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|3713398_3715681_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 274
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3719779	3720868	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|3719779_3720868_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 275
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3725954	3730495	4797106		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|3725954_3726239_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705700.1|3726445_3728710_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|3728746_3730495_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 276
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3745200	3745749	4797106		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|3745200_3745749_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 277
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3749296	3757610	4797106	tRNA	Enterobacteria_phage(25.0%)	5	NA	NA
WP_000977920.1|3749296_3750385_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|3750986_3752387_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|3752555_3753758_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|3754023_3756636_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090508.1|3756842_3757610_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 278
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3773531	3775439	4797106		Tupanvirus(100.0%)	1	NA	NA
WP_000053122.1|3773531_3775439_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	3.2e-53
>prophage 279
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3788049	3790104	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|3788049_3790104_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 280
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3794337	3822853	4797106	integrase,transposase,protease	Stx2-converting_phage(18.75%)	29	3786574:3786589	3802444:3802459
3786574:3786589	attL	GCTGACGCAACAAAAT	NA	NA	NA	NA
WP_000375136.1|3794337_3794997_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_001299351.1|3795404_3796424_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_032256979.1|3796401_3796644_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073569664.1|3796711_3799183_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	1.9e-58
WP_000199473.1|3799278_3799467_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|3799463_3799652_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001171933.1|3800220_3800439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052924993.1|3800510_3800810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000948454.1|3801189_3801666_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|3801790_3802114_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693906.1|3802097_3802523_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
3802444:3802459	attR	ATTTTGTTGCGTCAGC	NA	NA	NA	NA
WP_000095669.1|3802545_3803508_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788950.1|3803514_3804261_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_073569665.1|3804282_3805053_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.7	1.4e-79
WP_032258043.1|3805068_3805494_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.6	2.9e-60
WP_000150294.1|3805668_3806334_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001427299.1|3806518_3807637_+	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.7	1.7e-35
WP_001012717.1|3807650_3808529_+	NgoMIV family type II restriction endonuclease	NA	NA	NA	NA	NA
WP_187668462.1|3808585_3808873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000422741.1|3808926_3809352_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|3809348_3809699_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_016236744.1|3809729_3811343_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	8.8e-182
WP_073569666.1|3811329_3812013_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	44.9	2.6e-18
WP_073569668.1|3814187_3819458_+	conjugative transfer relaxase/helicase TraI	NA	V5UQN3	Mycobacterium_phage	30.1	4.0e-05
WP_000205725.1|3819477_3820224_+	conjugal transfer pilus acetylase TraX	NA	NA	NA	NA	NA
WP_000704523.1|3820282_3821143_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000139323.1|3821245_3821806_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|3821934_3822147_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|3822391_3822853_+	thermonuclease family protein	NA	A0A1W6JP77	Staphylococcus_phage	38.2	5.3e-07
>prophage 281
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3829691	3833400	4797106		Mycoplasma_phage(66.67%)	3	NA	NA
WP_000938114.1|3829691_3831053_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.4	2.8e-51
WP_000799400.1|3831416_3832280_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3832263_3833400_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 282
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3838520	3839891	4797106		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|3838520_3839891_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 283
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3843027	3846756	4797106		Enterobacteria_phage(66.67%)	6	NA	NA
WP_000444487.1|3843027_3844278_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|3844380_3844704_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_120795380.1|3844956_3845001_-	protein YmgK	NA	NA	NA	NA	NA
WP_032141808.1|3845236_3845347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|3845399_3845804_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|3846024_3846756_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 284
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3852623	3854945	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_015953141.1|3852623_3854945_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.3	2.3e-90
>prophage 285
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3863480	3865168	4797106		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|3863480_3863900_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|3863899_3865168_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 286
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3891911	3894663	4797106		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|3891911_3893591_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|3893715_3894663_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 287
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3897799	3904068	4797106		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000804726.1|3897799_3898882_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456467.1|3898881_3899715_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|3899711_3900104_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|3900107_3900917_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|3900952_3901807_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170965.1|3901955_3902063_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295620.1|3902467_3903568_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146442.1|3903837_3904068_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 288
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3915322	3925154	4797106		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|3915322_3916861_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|3916857_3917568_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|3917567_3918245_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|3918791_3919634_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|3919683_3920142_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|3920254_3921160_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_073569669.1|3921251_3922265_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|3922466_3923375_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|3923518_3923932_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|3924536_3925154_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 289
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3933564	3935579	4797106		Planktothrix_phage(50.0%)	2	NA	NA
WP_024238993.1|3933564_3934578_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	1.5e-14
WP_000994905.1|3934574_3935579_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 290
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3947237	3950195	4797106		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983908.1|3947237_3948599_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|3948599_3950195_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 291
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3955128	3960420	4797106	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559278.1|3955128_3955887_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
WP_000422045.1|3956106_3957156_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|3957191_3957443_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|3957822_3960420_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 292
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3965343	3965934	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3965343_3965934_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 293
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3973749	3979407	4797106		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484982.1|3973749_3975684_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_000437858.1|3975751_3976879_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3977023_3977812_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968853.1|3978179_3978533_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|3978600_3979407_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 294
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	3992321	3993587	4797106		Klosneuvirus(100.0%)	1	NA	NA
WP_000069259.1|3992321_3993587_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 295
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4007583	4008666	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|4007583_4008666_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 296
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4026828	4027344	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945009.1|4026828_4027344_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	43.4	1.1e-24
>prophage 297
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4033667	4040937	4797106	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628065.1|4033667_4034900_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|4035154_4036138_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123738.1|4036615_4037989_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081418.1|4038117_4039053_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001082294.1|4039228_4039663_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|4039803_4040937_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 298
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4045897	4046887	4797106		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|4045897_4046887_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 299
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4078174	4082077	4797106		Klosneuvirus(100.0%)	1	NA	NA
WP_073569671.1|4078174_4082077_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
>prophage 300
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4086016	4086965	4797106		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|4086016_4086547_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|4086791_4086965_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 301
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4098772	4108923	4797106	transposase	Escherichia_phage(25.0%)	9	NA	NA
WP_000826466.1|4098772_4099981_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.6e-207
WP_001323465.1|4100020_4101235_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429152.1|4101287_4101824_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001442195.1|4101896_4103858_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	27.9	1.2e-23
WP_000494244.1|4103948_4104179_-	YncJ family protein	NA	NA	NA	NA	NA
WP_001270286.1|4104600_4105017_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760589.1|4105095_4106502_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047429.1|4106746_4107892_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|4107909_4108923_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 302
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4112304	4113114	4797106		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|4112304_4113114_+	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 303
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4117379	4119482	4797106		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|4117379_4119482_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 304
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4124390	4126499	4797106		Ralstonia_phage(100.0%)	1	NA	NA
WP_001475081.1|4124390_4126499_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	7.3e-27
>prophage 305
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4133849	4138382	4797106		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_073569673.1|4133849_4138382_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.3	5.6e-24
>prophage 306
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4144309	4145854	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_000702561.1|4144309_4145854_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 307
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4152739	4153030	4797106		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001295648.1|4152739_4153030_-	porin	NA	Q1MVN1	Enterobacteria_phage	65.1	2.7e-25
>prophage 308
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4159042	4160484	4797106		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|4159042_4159327_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|4159473_4160484_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 309
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4170519	4172425	4797106		Planktothrix_phage(100.0%)	2	NA	NA
WP_073569674.1|4170519_4171446_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.5	4.1e-14
WP_000193522.1|4171438_4172425_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.7e-18
>prophage 310
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4176741	4180548	4797106		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|4176741_4179141_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426265.1|4179165_4180548_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 311
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4185822	4192758	4797106		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001245010.1|4185822_4188606_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.3e-19
WP_000832439.1|4188662_4191035_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001365957.1|4191072_4192758_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.3	3.8e-10
>prophage 312
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4209346	4214767	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_021562216.1|4209346_4214767_-	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.2	3.0e-141
>prophage 313
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4218170	4219706	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194889.1|4218170_4219706_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
>prophage 314
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4227587	4229006	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|4227587_4229006_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 315
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4236751	4238881	4797106		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|4236751_4237135_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|4237166_4237385_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|4237441_4238881_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 316
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4246385	4247276	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|4246385_4247276_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 317
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4252642	4254342	4797106		Salmonella_phage(50.0%)	2	NA	NA
WP_000214712.1|4252642_4252846_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527797.1|4252881_4254342_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
>prophage 318
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4257447	4318387	4797106	portal,lysis,tail,transposase,protease,holin,terminase	Enterobacteria_phage(39.58%)	65	NA	NA
WP_000885571.1|4257447_4258029_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.9e-103
WP_073569675.1|4258028_4261307_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_073569676.1|4261371_4261971_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	9.7e-110
WP_032236353.1|4262040_4265538_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.1	0.0e+00
WP_001309913.1|4265598_4266246_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_063090611.1|4266143_4266887_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152385.1|4266892_4267591_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447247.1|4267600_4267930_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	99.1	1.7e-60
WP_073569677.1|4267929_4270995_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161005.1|4270966_4271296_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	99.1	2.9e-55
WP_016236744.1|4271632_4273246_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	8.8e-182
WP_000624722.1|4273276_4273627_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|4273623_4274049_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001398453.1|4274291_4275035_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.2	1.5e-131
WP_001079398.1|4275046_4275448_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677091.1|4275444_4276023_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|4276034_4276310_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097053.1|4276302_4276626_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001583540.1|4276712_4278743_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_072128716.1|4278687_4280268_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.8	1.3e-289
WP_001072975.1|4280195_4280408_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934104.1|4280404_4282507_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000373428.1|4282506_4283001_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	99.4	3.8e-83
WP_000085745.1|4283572_4284265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000700650.1|4284433_4284970_-	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	4.2e-72
WP_000992051.1|4284966_4285509_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.2	9.5e-96
WP_000369848.1|4285614_4285887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193284.1|4285852_4286197_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.1e-36
WP_000839572.1|4286201_4286417_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000762931.1|4286852_4287674_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000140005.1|4287670_4288051_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	1.7e-35
WP_001265024.1|4288051_4289107_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.3	3.2e-87
WP_032151735.1|4289108_4289387_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_000981001.1|4289453_4289705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|4289921_4290077_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000096969.1|4290710_4292060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402181.1|4293292_4293559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023156363.1|4293568_4294276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001151185.1|4294648_4295074_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	5.4e-62
WP_000054496.1|4295114_4296080_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_000705360.1|4296060_4296582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476993.1|4296565_4296793_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|4296870_4297278_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379589.1|4297470_4297626_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344950.1|4297627_4298203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783095.1|4298689_4298878_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083280.1|4298874_4299066_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_073569680.1|4299159_4301631_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_000005552.1|4301703_4301955_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001299364.1|4302597_4303275_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|4303274_4303622_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4303641_4305213_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_072133799.1|4305994_4306105_-	transporter	NA	NA	NA	NA	NA
WP_000836079.1|4306162_4307182_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001295394.1|4307193_4308408_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4308613_4308940_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|4309074_4309416_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|4309450_4310011_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|4310013_4310724_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|4310831_4311137_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041554.1|4311335_4313762_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001515050.1|4313822_4316246_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	8.3e-208
WP_000213028.1|4316256_4316874_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526474.1|4316875_4317730_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|4317772_4318387_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 319
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4325227	4341978	4797106	portal,capsid,integrase,head,tail,protease,terminase	uncultured_Caudovirales_phage(100.0%)	24	4330853:4330868	4353158:4353173
WP_001260855.1|4325227_4326049_+|protease	serine protease	protease	NA	NA	NA	NA
WP_000046661.1|4326087_4326417_-	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_000276149.1|4326403_4326769_-	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000133423.1|4328082_4328364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053893843.1|4328377_4330039_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.4	4.4e-277
WP_021557757.1|4330022_4330379_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.2	9.4e-52
WP_000174068.1|4330503_4330686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145906.1|4330669_4331110_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
4330853:4330868	attL	ATTAATCGGGATAATG	NA	NA	NA	NA
WP_000134113.1|4331109_4331406_-|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001020670.1|4331402_4331741_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_032261762.1|4331737_4332949_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	2.5e-189
WP_033809508.1|4332950_4333508_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	7.0e-62
WP_001137345.1|4333563_4334721_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000233300.1|4335008_4335281_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126692.1|4335291_4335702_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_016235571.1|4335698_4335950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053877286.1|4336152_4337553_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	1.4e-114
WP_000770163.1|4337549_4337849_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_053893842.1|4337854_4338088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204073.1|4338089_4338311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024218766.1|4338283_4338529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024218767.1|4338518_4338986_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|4340185_4340374_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_053893840.1|4340748_4341978_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.1	7.8e-130
4353158:4353173	attR	ATTAATCGGGATAATG	NA	NA	NA	NA
>prophage 320
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4350994	4352296	4797106		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|4350994_4352296_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 321
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4362191	4364003	4797106		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945875.1|4362191_4364003_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.8	0.0e+00
>prophage 322
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4383789	4385064	4797106	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_000168638.1|4383789_4385064_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 323
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4391975	4393474	4797106		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|4391975_4392497_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|4392577_4393474_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 324
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4402277	4411069	4797106		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|4402277_4403093_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|4403220_4403802_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|4403947_4405117_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|4405282_4405372_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|4405670_4406696_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|4406692_4407625_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|4407737_4408949_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098912.1|4409239_4410388_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	3.2e-85
WP_000493947.1|4410427_4411069_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 325
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4416573	4418840	4797106		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|4416573_4417386_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069998.1|4417389_4418175_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|4418171_4418840_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 326
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4427130	4432214	4797106		environmental_halophage(33.33%)	5	NA	NA
WP_000144602.1|4427130_4428351_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	2.6e-93
WP_000908012.1|4428347_4429619_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|4429593_4430340_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000089364.1|4430349_4431837_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|4431845_4432214_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 327
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4450860	4470400	4797106	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_000869246.1|4450860_4452507_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
WP_000069375.1|4452563_4454942_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|4455274_4456108_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082204.1|4456264_4457311_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|4457442_4457634_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175615.1|4457637_4459074_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001315654.1|4459136_4459850_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|4460096_4460561_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|4460638_4461388_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|4461387_4461939_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956500.1|4462001_4462982_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|4463082_4463382_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672381.1|4463386_4465774_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|4465788_4466772_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|4467055_4467100_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|4467222_4467579_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|4467631_4467829_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|4467925_4468468_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|4468471_4470400_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 328
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4481669	4483931	4797106		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|4481669_4483931_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 329
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4490058	4490886	4797106		Bacillus_virus(100.0%)	1	NA	NA
WP_000175011.1|4490058_4490886_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	1.0e-72
>prophage 330
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4498362	4499583	4797106		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|4498362_4499583_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 331
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4506347	4507001	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_001299207.1|4506347_4507001_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.2	8.4e-14
>prophage 332
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4512599	4514561	4797106		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235796.1|4512599_4514561_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 333
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4519487	4523572	4797106		Tupanvirus(50.0%)	4	NA	NA
WP_001120527.1|4519487_4520129_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
WP_000438810.1|4520221_4521580_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|4521696_4522455_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|4522591_4523572_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 334
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4532385	4533240	4797106		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|4532385_4533240_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 335
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4536558	4541135	4797106		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|4536558_4537842_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|4537988_4539464_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|4539644_4541135_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 336
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4547085	4548294	4797106	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_073569688.1|4547085_4548294_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.6e-207
>prophage 337
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4557637	4565744	4797106	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|4557637_4559323_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000268230.1|4559527_4560109_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220979.1|4560148_4560844_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|4560901_4562812_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|4562943_4563288_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|4563650_4564010_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|4564129_4564309_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855019.1|4564382_4565744_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 338
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4569606	4571163	4797106		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|4569606_4571163_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 339
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4576803	4577013	4797106		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|4576803_4577013_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 340
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4582343	4584392	4797106		Moraxella_phage(100.0%)	1	NA	NA
WP_001326055.1|4582343_4584392_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
>prophage 341
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4591888	4596358	4797106		Escherichia_phage(33.33%)	7	NA	NA
WP_000812720.1|4591888_4592545_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	49.8	1.2e-55
WP_000976492.1|4592940_4593282_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879280.1|4593294_4594167_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|4594170_4594545_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|4594683_4594914_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|4595015_4595672_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|4595695_4596358_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 342
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4604414	4605890	4797106		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|4604414_4605890_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 343
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4619474	4620602	4797106		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741723.1|4619474_4620602_+	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 344
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4628065	4697425	4797106	portal,tRNA,capsid,head,tail,transposase,protease,holin,terminase	Enterobacteria_phage(57.63%)	82	NA	NA
WP_001184045.1|4628065_4629388_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|4629403_4630336_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|4630414_4631170_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|4631166_4631952_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|4632098_4633109_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4633117_4633729_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|4633867_4633933_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024930.1|4634003_4634606_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4634607_4635129_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907248.1|4635163_4635904_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001443602.1|4635932_4636385_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258662.1|4636502_4638275_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891611.1|4638584_4639151_+	hydrolase	NA	NA	NA	NA	NA
WP_001217539.1|4639505_4639754_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_072129710.1|4640208_4640907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072163647.1|4641116_4641755_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	38.1	1.1e-26
WP_054447385.1|4641869_4642139_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	95.5	1.3e-42
WP_073569691.1|4642140_4643454_-|tail	phage tail protein	tail	Q9EYE8	Enterobacteria_phage	98.6	3.1e-76
WP_073569692.1|4643518_4644118_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	95.5	3.2e-105
WP_073569693.1|4644184_4647667_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.3	0.0e+00
WP_032283758.1|4647727_4648375_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.0e-108
WP_000194750.1|4648272_4649016_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	9.5e-147
WP_032266453.1|4649021_4649720_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	8.1e-132
WP_000847402.1|4649719_4650049_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_032266452.1|4650045_4652607_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	89.3	0.0e+00
WP_000533402.1|4652587_4653001_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479095.1|4653027_4653459_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	6.2e-42
WP_000235110.1|4653472_4654225_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|4654232_4654628_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974980.1|4654624_4655158_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_001204554.1|4655173_4655527_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000201495.1|4655519_4655903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522591.1|4655954_4656983_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000256823.1|4657040_4657388_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_032266318.1|4657424_4658930_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	4.6e-100
WP_001441018.1|4658919_4660512_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.7e-185
WP_000259002.1|4660508_4660715_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_032266316.1|4660698_4662627_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.9	5.7e-260
WP_000867575.1|4662598_4663147_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_133301888.1|4663649_4663835_-	hypothetical protein	NA	A0A1U9AJA4	Stx1_converting_phage	73.8	1.3e-17
WP_032266315.1|4664353_4664887_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.6	1.5e-101
WP_032266967.1|4664950_4665301_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	4.9e-37
WP_000284510.1|4665305_4665521_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_073569694.1|4665671_4667525_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.0	0.0e+00
WP_000871291.1|4667785_4668121_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001438304.1|4668401_4668533_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	96.4	1.1e-05
WP_053888531.1|4669330_4670380_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	91.1	3.5e-187
WP_000917767.1|4670531_4670729_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_032283388.1|4670962_4671580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032283389.1|4671646_4672039_-	antitermination protein	NA	Q8W638	Enterobacteria_phage	57.6	6.1e-36
WP_032283452.1|4672056_4673046_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.6	6.4e-191
WP_032283390.1|4673097_4673355_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	4.7e-21
WP_000203849.1|4673351_4674752_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.4e-244
WP_000988266.1|4674748_4675648_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_000092416.1|4675658_4676651_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.4	4.6e-56
WP_000995578.1|4676647_4676947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618007.1|4676943_4677168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000626792.1|4677164_4677359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000587267.1|4677355_4678210_-	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	69.0	8.2e-102
WP_032283391.1|4678319_4679027_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	90.6	8.8e-118
WP_000838344.1|4679362_4680019_+	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	97.7	3.1e-125
WP_001422788.1|4680122_4680626_+	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	96.2	1.8e-64
WP_024235200.1|4680913_4681111_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	96.8	1.4e-28
WP_024235201.1|4681317_4681506_+	hypothetical protein	NA	Q8W652	Enterobacteria_phage	90.3	4.6e-26
WP_054447397.1|4681502_4682084_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	87.0	4.4e-99
WP_073569695.1|4682086_4682365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054447395.1|4682546_4683374_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.2	2.6e-129
WP_054447394.1|4683414_4683774_+	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	87.0	3.8e-53
WP_054447393.1|4683805_4684048_+	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	95.0	6.4e-36
WP_001030152.1|4684051_4684198_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	97.9	2.2e-23
WP_000528717.1|4684206_4684443_+	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	9.9e-42
WP_054447392.1|4684498_4685812_+	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	97.7	1.9e-251
WP_049768377.1|4685793_4686564_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.1e-72
WP_000252980.1|4686616_4687012_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_024239115.1|4687052_4687796_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.4	2.0e-24
WP_000564745.1|4687792_4688764_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|4688957_4689938_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000176773.1|4690207_4692637_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214304.1|4692661_4693762_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|4694149_4694896_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001326063.1|4694909_4695476_-	VOC family protein	NA	NA	NA	NA	NA
WP_073569696.1|4695691_4697425_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	2.6e-86
>prophage 345
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4702677	4708321	4797106		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|4702677_4703067_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|4703081_4704131_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204315.1|4704133_4704994_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|4705012_4706614_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
WP_001297437.1|4706659_4708321_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 346
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4718408	4719923	4797106		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024239308.1|4718408_4719923_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
>prophage 347
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4731909	4732662	4797106		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|4731909_4732662_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 348
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4745001	4745670	4797106		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334598.1|4745001_4745670_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.8e-81
>prophage 349
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4759685	4772249	4797106		Bacillus_phage(28.57%)	12	NA	NA
WP_001442160.1|4759685_4761380_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009306.1|4761617_4761800_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|4761878_4762796_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|4762968_4763889_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|4763877_4764348_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157238.1|4764328_4765747_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.3	1.8e-101
WP_000365578.1|4765813_4766509_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.4	8.1e-07
WP_001313057.1|4766548_4766914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824349.1|4767480_4768668_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.2	1.7e-97
WP_000218047.1|4769260_4770112_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826746.1|4770219_4771578_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|4771577_4772249_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
>prophage 350
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4775793	4776324	4797106		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|4775793_4776324_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 351
NZ_CP010238	Escherichia coli strain S50 chromosome, complete genome	4797106	4779366	4796338	4797106	tail	Enterobacteria_phage(38.89%)	18	NA	NA
WP_095111390.1|4779366_4779498_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.5e-07
WP_000950813.1|4779844_4780825_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101711.1|4781001_4781271_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	96.6	3.5e-43
WP_073569698.1|4781272_4782586_-|tail	phage tail protein	tail	H6WZM9	Escherichia_phage	97.0	4.5e-75
WP_001408020.1|4782650_4783274_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.4	1.7e-69
WP_073569699.1|4783342_4786819_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.9	0.0e+00
WP_000649829.1|4786952_4787480_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_072184588.1|4788446_4789079_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.7	9.3e-103
WP_000194790.1|4789024_4789768_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	8.3e-151
WP_001299882.1|4789773_4790472_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	2.1e-132
WP_000847304.1|4790471_4790801_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_073569701.1|4790797_4793377_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000533425.1|4793357_4793771_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	2.7e-42
WP_000479105.1|4793797_4794229_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_001143013.1|4794242_4794995_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|4795002_4795398_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_000975037.1|4795394_4795970_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_053877344.1|4795984_4796338_-|tail	phage tail protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
>prophage 1
NZ_CP010239	Escherichia coli strain S50 plasmid A, complete sequence	184614	39470	78339	184614	protease,transposase,integrase	Stx2-converting_phage(46.67%)	25	28428:28487	53026:53563
28428:28487	attL	TGAACCGCCCCGGGAATCCTGGAGACTAAACTTCCTGAGAAAGAGGTAAACAGGATGACT	NA	NA	NA	NA
WP_024239152.1|39470_40658_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000361612.1|41540_42518_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	3.9e-100
WP_001066947.1|42796_43537_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_032351964.1|43657_43813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071791892.1|46483_46669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000124108.1|46693_46849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053877363.1|47416_51304_+|protease	serine protease autotransporter toxin Pet	protease	Q9LA58	Enterobacterial_phage	39.3	3.1e-225
WP_000272015.1|53568_53961_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
53026:53563	attR	AGTCATCCTGTTTACCTCTTTCTCAGGAAGTTTAGTCTCCAGGATTCCCGGGGCGGTTCAAATTCTCCTCTCACATGCGGCCTGGGTAACCAGGTATTTTGTCCACAGAACCGTGCACAAAATGCTGTGGATAAGCTGGACACAGCAGTCCACAGCAGGCATACAGCCACACCCTCAGAGAATTGAGCGTTTTTTAGTCACAACAATGACATTTGACTGTGTGTGGATTCAGTTATTAGAATGCTGTATATATACAGCAAAAGAAAAGGGAGATGAGAACATGATCCGCATTGAAATTCTTTTCGACCGCCAGAGCACAAAAAACCTCAAATCAGGCACACTTCAGGCGCTACAGAATGAAATCGAACAACGTCTGAAACCACACTAGCCGGAAATCTGGCTGCATATGTGGGAATCCCCGTCCTTCAGAGCAGGGAGCTGTCAACCAGCACTCCATTGACTCAAATGACGGGAAACGCGGAAATCTAAAAATTAAGCCGCACACCCCGAGAAATTTTGCAGGTTTCACGGAGCGAGA	NA	NA	NA	NA
WP_001217833.1|53964_54939_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	45.1	5.3e-73
WP_000752652.1|55177_55552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000312331.1|55551_56184_-	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.1	1.4e-29
WP_024239174.1|56886_58095_+	hypothetical protein	NA	H6WZN3	Escherichia_phage	91.5	3.2e-208
WP_000905839.1|60174_60762_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_024239172.1|61067_62276_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_050574319.1|66092_66395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_183044133.1|69174_69492_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	37.1	4.5e-05
WP_024239100.1|70547_71138_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001299364.1|71431_72109_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|72108_72456_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|72475_74047_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_053886755.1|74173_75712_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	1.7e-283
WP_000612591.1|75761_76109_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_024239145.1|76105_76486_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	98.4	3.5e-65
WP_032232226.1|77216_77519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270415.1|78051_78339_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	45.3	5.5e-18
