The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010231	Escherichia coli strain S30 chromosome, complete genome	4664102	454156	501626	4664102	tail,tRNA,integrase,terminase,lysis,holin,protease	Enterobacteria_phage(36.54%)	63	457887:457909	508215:508237
WP_001297484.1|454156_455263_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|455316_455778_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|455787_456441_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|456612_457863_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
457887:457909	attL	AACGGGCGTGTTATACGCCCGTT	NA	NA	NA	NA
WP_000741339.1|457976_459119_-|integrase	tyrosine-type recombinase/integrase	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000088653.1|459108_459345_-	excisionase	NA	NA	NA	NA	NA
WP_000488406.1|459484_459724_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000763387.1|459771_459990_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	98.6	1.7e-35
WP_077250171.1|460088_460370_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	1.2e-46
WP_000548531.1|460380_460572_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000149532.1|460544_460727_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	96.7	2.8e-28
WP_000186792.1|460723_461404_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_000100847.1|461400_462186_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995467.1|462191_462488_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	3.6e-49
WP_000372937.1|462562_462706_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|462674_462839_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065374.1|462911_463280_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_023156163.1|463483_463663_-	hypothetical protein	NA	M1FQU1	Enterobacteria_phage	98.3	1.5e-29
WP_000281856.1|463929_464412_+	superinfection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000340011.1|464412_464736_-	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000618037.1|465089_465494_-	hypothetical protein	NA	Q716D7	Shigella_phage	98.5	4.3e-69
WP_000028392.1|465490_466123_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|466228_466444_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_073546446.1|466563_466857_+	hypothetical protein	NA	A2SY75	Escherichia_phage	99.0	1.1e-45
WP_073546447.1|466889_467789_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.0	2.7e-172
WP_039025747.1|467785_468487_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	1.2e-127
WP_000145931.1|468483_468774_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_063077928.1|468869_469289_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	99.3	2.2e-76
WP_000153280.1|469285_469813_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|469809_469986_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|469988_470330_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_032178959.1|470322_470517_+	protein ninF	NA	NA	NA	NA	NA
WP_001099706.1|470536_470899_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.9	9.5e-60
WP_032217959.1|470895_471036_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	1.7e-09
WP_073546448.1|471032_471722_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_032217963.1|471943_472747_-	DUF3800 domain-containing protein	NA	Q19UP3	Mannheimia_phage	48.6	5.0e-69
WP_000544528.1|472975_473281_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_032217964.1|473267_473744_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
WP_001228696.1|473960_474146_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|474342_475800_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|475937_476729_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|476721_477654_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|477631_477841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|477844_478939_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|478919_480221_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_073546449.1|480223_481630_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	1.1e-185
WP_001351715.1|481613_482726_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_001551057.1|482830_483595_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
WP_000918487.1|483693_484833_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|485055_485451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016231725.1|485450_485834_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001551059.1|485834_486215_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_000673077.1|486211_486604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072664314.1|486630_487593_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_122452218.1|487743_488103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284309.1|488210_488411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053290123.1|488574_491808_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.6	1.4e-106
WP_001152433.1|492139_492838_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	2.1e-127
WP_064221486.1|492843_493587_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.8e-150
WP_072664338.1|493484_494132_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.3	3.1e-109
WP_073546450.1|494191_497590_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
WP_072664238.1|497656_498256_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	3.5e-107
WP_073546689.1|498320_501626_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	68.1	6.3e-275
508215:508237	attR	AACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 2
NZ_CP010231	Escherichia coli strain S30 chromosome, complete genome	4664102	896593	922086	4664102	lysis,tail,integrase	Enterobacteria_phage(22.73%)	31	888292:888305	921686:921699
888292:888305	attL	ATTTCATCTTTTGT	NA	NA	NA	NA
WP_063091469.1|896593_898054_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.1e-41
WP_120795384.1|900028_900142_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|900210_900444_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|900760_901351_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_072144121.1|901448_901568_-	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_024205207.1|901622_903020_-|tail	tail fiber domain-containing protein	tail	K7PGT9	Enterobacteria_phage	89.4	4.0e-215
WP_000592549.1|904420_905380_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|905572_906097_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|906252_906630_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001265274.1|906647_907697_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_032236628.1|907698_907977_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_000980999.1|908043_908295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000887491.1|908511_908724_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	97.1	1.7e-29
WP_001533279.1|908768_909047_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	1.3e-08
WP_001533280.1|909127_910087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001599153.1|910503_910926_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.6	2.6e-64
WP_001533283.1|910966_911932_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	1.7e-55
WP_000705349.1|911912_912434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476994.1|912417_912645_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003381.1|912722_913130_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000379575.1|913322_913478_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|913479_914055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|914541_914730_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296931.1|914726_914918_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001774503.1|915010_917482_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.5	8.5e-59
WP_001296941.1|917569_917806_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876976.1|917840_919121_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	1.0e-156
WP_001389342.1|919122_919251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|919308_920328_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|920339_921554_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|921759_922086_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
921686:921699	attR	ACAAAAGATGAAAT	NA	NA	NA	NA
>prophage 3
NZ_CP010231	Escherichia coli strain S30 chromosome, complete genome	4664102	1539447	1548888	4664102		Enterobacteria_phage(85.71%)	10	NA	NA
WP_073546555.1|1539447_1540584_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_063091647.1|1540580_1542581_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|1542705_1543167_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|1543206_1543677_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|1543723_1544443_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1544439_1546125_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_073546556.1|1546346_1547078_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	3.1e-110
WP_001216963.1|1547137_1547245_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1547225_1547957_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_061350461.1|1547961_1548888_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 4
NZ_CP010231	Escherichia coli strain S30 chromosome, complete genome	4664102	2160761	2173944	4664102		Escherichia_phage(40.0%)	12	NA	NA
WP_001272928.1|2160761_2163323_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141323.1|2163428_2164085_+	protein-serine/threonine phosphatase	NA	K7P7V3	Enterobacteria_phage	45.8	3.3e-50
WP_001272546.1|2164135_2164933_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_000847985.1|2165098_2166007_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590405.1|2166003_2167266_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.0	8.3e-135
WP_001278994.1|2167262_2167901_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|2167905_2168682_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_049254918.1|2168770_2170135_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|2170228_2171221_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|2171283_2172423_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2172562_2173189_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|2173182_2173944_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 5
NZ_CP010231	Escherichia coli strain S30 chromosome, complete genome	4664102	3888330	3968641	4664102	tail,tRNA,integrase,head,terminase,lysis,portal,capsid	Enterobacteria_phage(44.07%)	84	3881773:3881788	3908771:3908786
3881773:3881788	attL	AAGGGATATCAGTTAA	NA	NA	NA	NA
WP_001218277.1|3888330_3889554_+|integrase	site-specific integrase	integrase	A5LH57	Enterobacteria_phage	98.5	4.0e-235
WP_048943335.1|3889736_3893564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206803.1|3893960_3894581_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.3	2.2e-112
WP_001242723.1|3894580_3894943_-	phage protein	NA	U5P092	Shigella_phage	95.8	4.4e-65
WP_000008209.1|3894933_3895470_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.6e-100
WP_048943336.1|3895597_3896422_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	8.6e-149
WP_000135680.1|3896487_3896850_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_001020632.1|3897552_3898245_-	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_001191669.1|3898342_3898603_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526668.1|3898595_3899153_+	protein YmfL	NA	S5FXP0	Shigella_phage	94.6	1.7e-95
WP_001250269.1|3899328_3899508_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104941.1|3899497_3900439_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.0	6.4e-140
WP_073546633.1|3900435_3900930_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	92.6	1.7e-80
WP_032200251.1|3900929_3901583_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_000210164.1|3901579_3901906_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_000767146.1|3901902_3902292_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.6e-68
WP_032305273.1|3902311_3903109_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.5e-150
WP_001433852.1|3903116_3904106_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	1.9e-195
WP_001047110.1|3904119_3904872_+	antitermination protein	NA	K7PGU5	Enterobacteria_phage	99.2	5.3e-137
WP_000917724.1|3905125_3905329_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|3905479_3906532_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|3906599_3906815_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001468348.1|3906819_3907164_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	96.4	4.4e-38
WP_000370550.1|3907129_3907402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048943344.1|3907507_3908041_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.3e-99
WP_001228702.1|3908257_3908464_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	98.5	5.3e-31
WP_001139678.1|3908492_3908645_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|3908996_3909407_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
3908771:3908786	attR	TTAACTGATATCCCTT	NA	NA	NA	NA
WP_001663509.1|3909463_3909697_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453611.1|3910085_3910631_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027268.1|3910605_3912531_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000198149.1|3912527_3912734_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_032358757.1|3912730_3914332_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_048943348.1|3914312_3915632_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.9	3.8e-231
WP_001338090.1|3915641_3915974_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	6.5e-55
WP_048943349.1|3916029_3917055_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	9.0e-188
WP_048943350.1|3917096_3917492_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_000752996.1|3917503_3917857_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	99.1	1.5e-62
WP_048943351.1|3917868_3918447_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	5.9e-80
WP_000683111.1|3918443_3918839_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_048943399.1|3918846_3919587_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	6.1e-130
WP_001357868.1|3919602_3920025_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_000459457.1|3920006_3920441_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_048943353.1|3920433_3922995_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
WP_000847345.1|3922991_3923321_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152502.1|3923320_3924019_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_048943354.1|3924024_3924768_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.8e-145
WP_000090892.1|3924704_3925337_+|tail	tail assembly protein	tail	C6ZCZ4	Enterobacteria_phage	98.1	2.7e-94
WP_048943357.1|3925396_3928879_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.7	0.0e+00
WP_032202908.1|3928945_3929545_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.2e-109
WP_073546634.1|3929609_3932960_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	39.1	7.3e-13
WP_048943362.1|3932959_3933544_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-103
WP_005025120.1|3933988_3935593_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_048943363.1|3935952_3936213_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	95.1	3.1e-36
WP_000202564.1|3936432_3938019_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295410.1|3938411_3939017_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|3939143_3939305_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299187.1|3939426_3940500_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563070.1|3940496_3941279_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088381.1|3941693_3942557_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_000107765.1|3942528_3944079_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|3944337_3945117_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477828.1|3945283_3946606_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	8.8e-79
WP_000816471.1|3946657_3947881_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|3947937_3948657_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_073546635.1|3948835_3950167_+	type II toxin-antitoxin system HipA family toxin YjjJ	NA	NA	NA	NA	NA
WP_000105843.1|3950167_3951184_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|3951211_3951856_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|3951961_3952930_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029692.1|3952978_3954361_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093812.1|3954381_3955614_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|3955921_3957589_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409472.1|3957799_3959737_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	5.2e-11
WP_000068679.1|3959826_3960153_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001341279.1|3960237_3960759_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|3960810_3961458_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_073546636.1|3961454_3962324_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|3962534_3963008_+	protein CreA	NA	NA	NA	NA	NA
WP_001188679.1|3963020_3963710_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219588.1|3963709_3965134_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_000920345.1|3965191_3966544_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|3966602_3967319_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|3967414_3967555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223188.1|3967954_3968641_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP010231	Escherichia coli strain S30 chromosome, complete genome	4664102	4222654	4234487	4664102	integrase	Enterobacteria_phage(77.78%)	12	4217790:4217802	4230865:4230877
4217790:4217802	attL	GCAGACGAATAAA	NA	NA	NA	NA
WP_001285288.1|4222654_4223758_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|4223769_4225023_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_073546648.1|4225376_4226543_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.7	8.4e-142
WP_077898783.1|4226558_4228049_-	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_073546650.1|4228679_4229243_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.3	3.4e-56
WP_073546651.1|4229239_4229503_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	67.9	8.5e-26
WP_073546652.1|4229499_4230237_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	65.0	1.2e-80
WP_073546654.1|4230786_4231053_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.5	7.5e-30
4230865:4230877	attR	TTTATTCGTCTGC	NA	NA	NA	NA
WP_073546655.1|4231049_4231598_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	2.7e-29
WP_040226160.1|4231594_4231822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040226162.1|4231818_4232139_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_073546656.1|4232153_4234487_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.5	0.0e+00
>prophage 1
NZ_CP010232	Escherichia coli strain S30 plasmid A, complete sequence	155425	5258	25667	155425	protease,integrase,transposase	Escherichia_phage(62.5%)	23	5207:5266	11420:12240
5207:5266	attL	GGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTT	NA	NA	NA	NA
WP_001067858.1|5258_5963_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000454193.1|6421_6772_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|6974_7988_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|8132_8630_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|8741_9032_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|9037_9829_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000679427.1|9992_10340_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001067858.1|10722_11427_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001389365.1|11555_12320_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
11420:12240	attR	AAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTCAATACTCGTGTGGGCTCTGTTGCAAAAATCGTGAAGCTTGAGCATGCTTGGCGGAGATTGGACGGACGGAACGATGACGGATTTCAAGTGGCGCCATTTCCAGGGTGATGTGATCCTGTGGGCGGTGCGCTGGTATTGTCGCTATCCGATCAGCTATCGCGACCTTGAGGAAATGCTGGCGGAACGCGGCATTTCGGTCGACCATACGACGATCTATCGCTGGGTCCAGTGCTACGCCCCGGAGATGGAGAAGCGGCTGCGCTGGTTCTGGCGGCGTGGCTTTGATCCGAGCTGGCGCCTGGATGAAACCTACGTCAAGGTGCGGGGCAAGTGGACCTACCTGTACCGGGCAGTCGACAAGCGGGGCGACACGATCGATTTCTACCTGTCGCCGACCCGCAGCGCCAAGGCAGCGAAGCGGTTCCTGGGCAAGGCCCTGCGAGGCCTGAAGCACTGGGAAAAGCCTGCCACGCTCAATACCGACAAAGCGCCGAGCTATGGTGCAGCGATCACCGAATTGAAGCGCGAAGGAAAGCTGGACCGGGAGACGGCCCACCGGCAGGTGAAGTATCTCAATAACGTGATCGAGGCCGATCACGGAAAGCTCAAGATACTGATCAAGCCGGTGCGCGGTTTCAAATCGATCCCCACGGCCTATGCCACGATCAAGGGATTCGAAGTCATGCGAGCCCTGCGCAAAGGACAGGCTCGCCCCTGGTGCCTGCAGCCCGGCATCAGGGGCGAGGTGCGCCTTGTGG	NA	NA	NA	NA
WP_001137892.1|12812_13397_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|13396_14635_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|14631_15537_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|15658_16363_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000248278.1|17155_17383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000951934.1|17406_17598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000587837.1|18079_18622_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000557454.1|18634_19495_-	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_001067858.1|20591_21296_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000027057.1|21597_22458_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001262765.1|22734_24045_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001398199.1|24329_24731_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_000557619.1|24663_24921_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_000616807.1|25013_25667_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP010232	Escherichia coli strain S30 plasmid A, complete sequence	155425	76129	132194	155425	protease,integrase,transposase,bacteriocin	Macacine_betaherpesvirus(21.43%)	31	83191:83205	98325:98339
WP_000082154.1|76129_77101_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000817028.1|79455_80427_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|80426_81593_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
WP_000715078.1|82747_84250_-	hypothetical protein	NA	NA	NA	NA	NA
83191:83205	attL	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000238252.1|84858_85308_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	67.1	5.0e-42
WP_000190053.1|85425_85905_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968140.1|87188_88046_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000992806.1|88042_88900_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|88896_89724_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_000949004.1|89723_90638_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_085947772.1|93125_94338_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000361611.1|94883_95861_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001066942.1|96145_96886_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_038427931.1|97006_97132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|97569_98478_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
98325:98339	attR	ACTTCCAGTCATGAT	NA	NA	NA	NA
WP_000771475.1|98540_99650_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|100082_101036_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|102308_102467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|102650_103863_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_000928804.1|105317_106505_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|106501_108442_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|108445_109816_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|110612_111554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|113813_115007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000738422.1|118092_118386_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|121535_122651_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001312839.1|122664_126450_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_000933675.1|126553_127783_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_064055648.1|127867_128824_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|128868_131046_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_001259759.1|131990_132194_-|bacteriocin	colicin V family bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP010233	Escherichia coli strain S30 plasmid B, complete sequence	136060	6776	13109	136060	transposase	Escherichia_phage(33.33%)	8	NA	NA
WP_001043260.1|6776_7592_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000954592.1|7921_8098_+	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001067855.1|9087_9792_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|10177_10594_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|10598_11117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014839978.1|11116_11905_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_049824851.1|11924_12395_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	32.7	5.3e-10
WP_001067855.1|12404_13109_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 1
NZ_CP010234	Escherichia coli strain S30 plasmid C, complete sequence	117266	817	99387	117266	integrase,protease,transposase,plate	Escherichia_phage(55.88%)	58	24035:24094	98103:99433
WP_000124023.1|817_3805_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.5	1.7e-295
WP_038989442.1|4316_4628_-	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	93.2	2.8e-44
WP_038989443.1|4678_5710_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A077SLE7	Escherichia_phage	99.4	8.4e-194
WP_000542385.1|5717_5939_-	hypothetical protein	NA	Q38403	Escherichia_phage	100.0	2.6e-36
WP_073546712.1|7208_7418_+	c1 repressor inactivator	NA	A0A077SK26	Escherichia_phage	98.6	4.1e-31
WP_073546713.1|7528_8380_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_038997082.1|10715_10895_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	6.0e-23
WP_073546715.1|10899_11280_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	99.2	1.3e-62
WP_001190712.1|11279_11501_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_073546716.1|14911_18028_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	1.3e-27
WP_001468756.1|18294_18801_-	hypothetical protein	NA	A0A077SK53	Escherichia_phage	97.6	6.5e-91
WP_000107690.1|18873_20136_-	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	99.8	1.6e-234
WP_000578338.1|21667_22402_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000896262.1|23536_23737_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
24035:24094	attL	TGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCCTGCTGC	NA	NA	NA	NA
WP_114142437.1|24045_25319_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	6.8e-169
WP_073546722.1|25442_28940_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	2.7e-98
WP_114142435.1|28987_30261_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.3	5.0e-172
WP_000169527.1|31533_31833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878218.1|31829_32696_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_072660832.1|34506_35037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072660833.1|36049_36535_+	plasmid transfer protein	NA	NA	NA	NA	NA
WP_000133023.1|36531_37254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063082219.1|40818_42177_-	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000937735.1|42555_42747_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_001352013.1|43726_44191_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000794337.1|44366_45239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352007.1|48110_48266_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_001300563.1|48459_49572_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_073546725.1|49731_50241_-|plate	baseplate protein	plate	Q1MVJ9	Enterobacteria_phage	98.2	1.1e-90
WP_000035250.1|50252_50834_-	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
WP_000041769.1|50869_51685_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	5.4e-111
WP_073546726.1|51694_53284_-	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	6.4e-302
WP_073546727.1|53343_55050_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.6	0.0e+00
WP_000038866.1|55275_56277_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_001285362.1|56293_57490_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_001154687.1|57658_58468_-	GIY-YIG nuclease family protein	NA	A0A077SK46	Escherichia_phage	97.8	7.1e-156
WP_001113742.1|58760_59645_-	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001281115.1|59980_60373_-	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_000336812.1|60382_60523_-	hypothetical protein	NA	Q71TL6	Escherichia_phage	100.0	6.3e-20
WP_000948429.1|60875_62075_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_050858643.1|62417_62657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050858642.1|62706_63963_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_073546728.1|64329_65598_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.0	6.9e-81
WP_000611142.1|66169_66787_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000999546.1|66783_67386_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_050858669.1|67398_71013_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_050858670.1|71061_74709_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_050858671.1|74708_75830_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_050858672.1|75823_76393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050858673.1|76392_78990_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001187275.1|79000_81076_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_162780438.1|83060_84029_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.4	1.1e-184
WP_001067855.1|84111_84816_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_133301135.1|84792_85002_+	hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	64.1	1.3e-05
WP_073546730.1|87971_90077_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_001351999.1|90140_92291_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_073546731.1|94253_97727_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_114142437.1|98113_99387_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	6.8e-169
98103:99433	attR	TGGATTTGCCCCTATATTTCCAGACACCTGTTATCACTTAACCCATTACTGGCCTGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGTGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTAGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATGCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGCCCCAACATCCGGGCAAACTGCCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCTACTGGAGACGCCGGAAGCTCGTTGCCGAAGCGGCGTTCCACCGCTCCCGGCATTACGTCCTGTACTGTTTCACTGTCGAAGCCGCCCGTAGTGACTGCCCAGTGCAGTGCCTCACGGTCACAGCAGTCCAGCGCGAACGTGACTCGCAGTTTTTCTCCGTTATCACAGCGGAACTCGAACCCGTCAGAGCACCATTGTTGATTGCTTTCTTTCACGGCCACTTTGCCAGTATGTGCCCGTTTCGATGGCGGTACAGCGGTTTTTCGCTCAAGCAACAGCGCATTCTGGCGCATGATCCGGTAAACACGTTTGGCATTGATCGCAGGCATACCATCAAGTTCGGCCTGTCTGCGAAGCAGCGCCCATACCCGACGATAACCATACGTGGGCAGCTCTCCGATAACATGGTGTATACGGAGAAGCACATCCGTATCATCTGAGTGACGGCTGCGGCGACCATCTTTCCAGTCATCGGTTCGTCTGAGAATTACGTGCAACTGCGCACGCGACACCCGGAGACAACGGCTGACTAAGCTTACTCCCCATCCCCGGGCAATAAGGGCGCGTGCGCTATCCACTTTTTTGCACGCCCGTATTCAACGGCTTCTTTAAGGAGTTCATTTTCCATCGTTTTTTTGCCGAGCAGGCGCTGGAGTTCTTTAATCTGCTTCATGGCAGCAGCAAGTTCAGAGGCAGGAACGACCTGCTCTCCTGCGGCCACAGCAGTAAGACTTCCCTCCTGGTATTGCTTGCGCCAGAGAAATAACTGGCTGGCTGCCACACCGTGTTGCCGGGCAACAAGGGAGACCGTCATTCCCGGTTCAAAACTCTGCTGAACAATAGCGATCTTTTCCTGTGTAGTACGCCGTCTGCGTTTCTCCGGTCCTAAGACATCAATCATCTGCTCTCCAATGACTAGTCTAAAAACTAGTATTAAGACTATCACTTATTTAAGTGATATTGGTTGTCTGGAGATTCAGGGGGCCAGTCTA	NA	NA	NA	NA
