The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	556416	569599	4702107		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|556416_557178_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|557171_557798_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|557937_559077_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|559139_560132_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|560225_561590_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|561678_562455_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|562459_563098_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|563094_564357_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|564353_565262_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|565457_566225_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|566275_566932_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272928.1|567037_569599_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 2
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	604680	667778	4702107	holin,plate,tRNA,transposase,lysis,capsid,head,tail,integrase,terminase,portal	Salmonella_phage(71.43%)	70	622336:622382	656505:656551
WP_000047184.1|604680_607311_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|607545_607731_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273290.1|609054_609621_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287454.1|609617_610046_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|610118_611675_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130211.1|611824_612340_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_032174087.1|614668_615640_+	toprim domain-containing protein	NA	A0A1B5FPA8	Escherichia_phage	87.3	1.3e-164
WP_032174088.1|615636_616440_+	antitermination protein	NA	F1C595	Cronobacter_phage	71.1	1.9e-108
WP_157920502.1|616683_617589_-	helix-turn-helix domain-containing protein	NA	A0A077SL42	Escherichia_phage	40.3	1.1e-61
WP_073527265.1|618521_619592_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_094338358.1|620042_620390_+|holin	phage holin family protein	holin	A0A2L1IV26	Escherichia_phage	62.2	2.6e-06
622336:622382	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_001744228.1|622499_623525_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	95.0	8.4e-194
WP_024221518.1|623526_624159_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	89.5	3.8e-104
WP_001744227.1|624278_624527_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	67.9	4.9e-23
WP_073527267.1|624559_625069_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	95.3	7.1e-85
WP_072133946.1|625076_625277_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	87.9	2.8e-29
WP_001744224.1|625240_625582_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	85.8	2.9e-50
WP_001744223.1|625649_625883_+	DUF2732 domain-containing protein	NA	E5G6L6	Salmonella_phage	80.5	5.4e-24
WP_001744222.1|625882_626110_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	93.3	3.0e-35
WP_001744221.1|626106_626967_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	82.5	3.4e-132
WP_072754532.1|626957_629366_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	96.9	0.0e+00
WP_001154443.1|629527_629716_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	98.4	6.1e-26
WP_001217561.1|629727_629961_+	DinI family protein	NA	A0A1S6L014	Salmonella_phage	92.2	2.2e-33
WP_024221516.1|630468_630738_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	43.5	1.4e-15
WP_053264393.1|630800_631847_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	91.3	4.0e-183
WP_001744215.1|631846_633613_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	96.4	0.0e+00
WP_053264394.1|633755_634589_+|capsid	GPO family capsid scaffolding protein	capsid	E5G6M5	Salmonella_phage	92.1	5.5e-119
WP_001744212.1|634605_635673_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	97.4	1.4e-191
WP_001744211.1|635676_636327_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	98.6	2.7e-113
WP_001744210.1|636420_636885_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	96.1	8.7e-82
WP_053264395.1|636884_637088_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	97.0	1.9e-33
WP_001397650.1|637091_637307_+	membrane protein	NA	E5G6N0	Salmonella_phage	97.2	8.5e-32
WP_001744208.1|637287_637800_+	lysozyme	NA	E5G6N1	Salmonella_phage	78.1	4.8e-73
WP_001744207.1|637801_638176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264396.1|638172_638601_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	91.4	8.3e-63
WP_001744205.1|638696_639137_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	93.0	6.5e-71
WP_053264397.1|639120_639567_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.7	2.1e-53
WP_001744203.1|639623_640481_-	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001744202.1|640470_641724_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_053264398.1|641832_642411_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	94.3	5.9e-104
WP_001744200.1|642407_642767_+	GPW/gp25 family protein	NA	E5G6N7	Salmonella_phage	94.1	4.4e-57
WP_001744199.1|642753_643662_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	92.7	6.1e-148
WP_001744198.1|643654_644260_+|tail	phage tail protein I	tail	E5G6N9	Salmonella_phage	96.0	2.5e-113
WP_001300563.1|645416_646529_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_073527268.1|646607_647126_+|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	70.4	4.5e-55
WP_073527269.1|647125_647728_+|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	91.8	7.3e-97
WP_073527270.1|647699_648143_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.3	2.0e-80
WP_073527271.1|648163_648565_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.0	2.4e-64
WP_053264365.1|648634_649192_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	85.2	2.9e-84
WP_053264364.1|649275_650448_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.6	2.5e-210
WP_001744190.1|650458_650974_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	97.7	3.0e-91
WP_001744189.1|651028_651331_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	97.0	6.1e-44
WP_001397628.1|651345_651465_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	97.4	6.7e-15
WP_053264363.1|651457_654523_+|tail	phage tail tape measure protein	tail	A0A1S6L010	Salmonella_phage	84.5	0.0e+00
WP_073527272.1|654519_655005_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	97.7	4.1e-66
WP_001744186.1|655001_656102_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	94.8	4.6e-190
WP_000980498.1|656170_656389_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	100.0	2.1e-38
WP_000162574.1|657083_657566_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
656505:656551	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600189.1|657697_658174_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|658163_658454_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|658515_658857_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880910.1|659005_660667_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|660752_661631_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|661753_662347_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_010723175.1|662401_663688_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|663708_664500_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|664666_666028_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|666164_666413_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|666431_666980_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|667010_667778_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	923537	933220	4702107		Enterobacteria_phage(81.82%)	11	NA	NA
WP_001163428.1|923537_923738_-	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_073527280.1|924620_924812_-	Eag protein	NA	A0A088CQ59	Enterobacteria_phage	96.5	5.0e-28
WP_073527281.1|924908_925559_-	DUF551 domain-containing protein	NA	K7PK20	Enterobacteria_phage	83.9	5.4e-37
WP_073527282.1|925560_926283_-	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	89.3	6.5e-84
WP_001595494.1|926284_926584_-	hypothetical protein	NA	G8C7K8	Escherichia_phage	98.0	9.6e-58
WP_046076630.1|926580_927030_-	hypothetical protein	NA	K7PMI0	Enterobacteria_phage	85.2	1.8e-63
WP_001214446.1|927026_927191_-	DUF2737 family protein	NA	K7P716	Enterobacteria_phage	100.0	6.5e-24
WP_073527283.1|927201_927495_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	97.9	9.4e-50
WP_016063330.1|927518_927902_-	hypothetical protein	NA	K7P6N5	Enterobacteria_phage	100.0	2.2e-67
WP_033810842.1|930468_930729_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.6	3.1e-36
WP_073527284.1|930850_933220_+	hypothetical protein	NA	A0A088CQ58	Enterobacteria_phage	82.6	6.9e-58
>prophage 4
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	1283724	1301489	4702107		Bacillus_phage(16.67%)	16	NA	NA
WP_032177796.1|1283724_1285119_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.9	2.8e-19
WP_000999466.1|1285276_1286272_+	N-acetyl-alpha-D-glucosaminyl-diphospho-ditrans, octacis-undecaprenol 4-epimerase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_025492082.1|1286514_1287408_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_032238535.1|1287717_1288737_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	47.7	2.9e-85
WP_032177799.1|1288755_1289772_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_032177801.1|1289798_1290920_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.2	2.0e-132
WP_000043590.1|1290922_1291888_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.3e-87
WP_032177846.1|1291890_1292391_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_032177847.1|1292383_1293832_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.1	1.2e-57
WP_000736844.1|1293835_1295209_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	28.4	1.1e-31
WP_001403120.1|1295221_1296493_+	O90/O127 family O-antigen flippase	NA	NA	NA	NA	NA
WP_072003680.1|1296489_1297143_+	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	39.0	4.2e-13
WP_073527310.1|1297150_1298317_+	O90/O127 family O-antigen polymerase	NA	NA	NA	NA	NA
WP_000626462.1|1298317_1299055_+	glycosyltransferase	NA	F2Y1U7	Organic_Lake_phycodnavirus	28.2	1.5e-11
WP_000271561.1|1299065_1299962_+	alpha-1,2-fucosyltransferase	NA	A0A2H4UUT1	Bodo_saltans_virus	32.3	1.5e-29
WP_000043472.1|1300082_1301489_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	8.0e-38
>prophage 5
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	1320198	1362485	4702107	holin,plate,lysis,capsid,protease,tail,integrase,terminase	Enterobacteria_phage(38.1%)	67	1314639:1314653	1324517:1324531
1314639:1314653	attL	TCGCCGGTGTTTATG	NA	NA	NA	NA
WP_025404398.1|1320198_1321377_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.7	1.5e-231
WP_000132739.1|1321357_1321549_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001570156.1|1321626_1321971_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	1.7e-58
WP_073527311.1|1322071_1322851_-	DUF551 domain-containing protein	NA	Q76H45	Enterobacteria_phage	61.9	2.1e-35
WP_073527312.1|1322852_1323044_-	hypothetical protein	NA	K7PKJ7	Enterobacteria_phage	96.8	3.6e-26
WP_073527313.1|1323045_1323759_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	94.1	2.5e-120
WP_073527314.1|1323755_1324400_-	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	97.2	4.5e-129
WP_073527315.1|1324392_1324656_-	hypothetical protein	NA	Q1MVG1	Enterobacteria_phage	55.2	5.0e-18
1324517:1324531	attR	TCGCCGGTGTTTATG	NA	NA	NA	NA
WP_001214454.1|1324652_1324820_-	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	8.6e-24
WP_001111303.1|1324830_1325124_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000168274.1|1325137_1325644_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_000365280.1|1325644_1326352_-	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_073527316.1|1326360_1326549_-	hypothetical protein	NA	G9L668	Escherichia_phage	98.4	1.9e-27
WP_122986066.1|1326545_1326659_-	host cell division inhibitory peptide Kil	NA	G9L669	Escherichia_phage	97.3	1.0e-12
WP_001198866.1|1326651_1326792_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q9AZ26	Salmonella_phage	100.0	3.3e-21
WP_032353701.1|1327022_1327493_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	98.7	4.1e-87
WP_000198446.1|1327551_1327935_-	hypothetical protein	NA	A4KWV5	Enterobacteria_phage	100.0	3.9e-64
WP_015980176.1|1328429_1329080_-	hypothetical protein	NA	K7P6H4	Enterobacteria_phage	100.0	1.3e-107
WP_015980177.1|1329067_1329334_-	hypothetical protein	NA	Q9MCQ3	Enterobacteria_phage	100.0	7.7e-43
WP_001274760.1|1329759_1330473_-	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	100.0	1.8e-131
WP_000437876.1|1330573_1330774_+	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	100.0	3.3e-30
WP_000189606.1|1330911_1331208_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_000166961.1|1331240_1331402_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_015980178.1|1331388_1332210_+	replication protein	NA	K7PJZ3	Enterobacterial_phage	100.0	1.2e-153
WP_023351782.1|1332206_1333583_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	3.7e-253
WP_073527318.1|1333656_1334097_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	99.3	4.5e-80
WP_000153280.1|1334093_1334621_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_073527319.1|1334617_1334794_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	98.3	5.1e-27
WP_000386659.1|1334796_1335174_+	DUF2591 family protein	NA	K7P7P1	Enterobacteria_phage	97.5	5.6e-63
WP_000950960.1|1335173_1335350_+	protein ninF	NA	A0A088CPS6	Enterobacteria_phage	100.0	8.8e-27
WP_063080447.1|1335342_1335954_+	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	97.5	1.3e-98
WP_000144614.1|1335950_1336157_+	phage NinH family protein	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_073527320.1|1336134_1336806_+	serine/threonine protein phosphatase	NA	A0A088CPU5	Enterobacteria_phage	98.2	5.6e-130
WP_061353364.1|1336796_1337315_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.3	1.0e-94
WP_000783734.1|1337777_1338101_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229390.1|1338084_1338561_+	glycoside hydrolase family protein	NA	G5DA94	Enterobacteria_phage	100.0	9.8e-89
WP_073527321.1|1338557_1339025_+|lysis	lysis protein	lysis	A0A2I6TCF9	Escherichia_phage	96.7	8.8e-74
WP_032315288.1|1339012_1339165_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	6.8e-20
WP_053903633.1|1339276_1339525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053903632.1|1339915_1340134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001218991.1|1340156_1340708_+|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
WP_073527322.1|1340710_1342333_+	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	96.3	0.0e+00
WP_073527323.1|1342332_1343802_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	94.7	1.5e-268
WP_113772720.1|1343686_1344424_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	95.5	2.3e-108
WP_029403916.1|1344438_1345671_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	96.8	8.7e-222
WP_000128056.1|1345675_1346179_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	83.8	7.2e-74
WP_000627486.1|1346190_1347132_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	96.8	6.1e-175
WP_001040703.1|1347173_1347563_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	57.4	6.5e-30
WP_073527324.1|1347528_1347936_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	3.3e-69
WP_073527325.1|1347932_1348487_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	84.2	1.8e-81
WP_001619353.1|1348473_1348863_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.3e-67
WP_032301010.1|1348837_1349401_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.1	4.1e-78
WP_048239711.1|1349404_1350565_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	74.1	8.4e-158
WP_047629380.1|1350575_1351016_+	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	76.7	2.2e-58
WP_000393957.1|1351019_1351445_+	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	57.5	1.6e-37
WP_073527326.1|1351622_1353704_+	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	57.2	1.9e-208
WP_073527327.1|1353703_1354306_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	69.5	1.6e-64
WP_001160174.1|1354307_1354613_+	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	53.5	9.2e-24
WP_073527328.1|1354615_1355680_+	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	67.0	1.2e-137
WP_001567586.1|1355692_1356037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000506880.1|1356060_1356351_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_073527329.1|1356562_1357303_+|plate	phage baseplate assembly protein V	plate	A0A0M5M1K7	Salmonella_phage	62.4	4.5e-72
WP_016239889.1|1357302_1357656_+	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	76.1	1.1e-44
WP_073527330.1|1357656_1358856_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	82.5	2.6e-178
WP_073527331.1|1358852_1359533_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	81.4	5.0e-110
WP_073527332.1|1360308_1360731_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	76.0	1.2e-24
WP_001310935.1|1361318_1362485_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	1.5e-226
>prophage 6
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	1798288	1848961	4702107	protease,integrase,transposase,bacteriocin	Escherichia_phage(35.71%)	45	1801656:1801673	1854536:1854553
WP_001260865.1|1798288_1799110_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1799209_1799293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|1799385_1799721_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1800117_1801371_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|1801477_1802371_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
1801656:1801673	attL	CGGCAGCAGGAAAACAGT	NA	NA	NA	NA
WP_000225262.1|1802505_1803726_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1803850_1804546_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|1804498_1805791_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|1805949_1806564_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|1806606_1807461_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1807462_1808080_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_073527564.1|1808090_1810514_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.5	3.7e-208
WP_073527370.1|1810574_1813001_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
WP_001300836.1|1813199_1813505_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1813612_1814323_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1814325_1814886_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1814920_1815262_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1815396_1815723_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_073527371.1|1815928_1817143_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	2.6e-45
WP_065786665.1|1820402_1822379_+	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_032238615.1|1824897_1825383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010431201.1|1825379_1825829_+	response regulator	NA	NA	NA	NA	NA
WP_032238613.1|1825825_1826998_+	response regulator	NA	NA	NA	NA	NA
WP_016237041.1|1827098_1827581_+	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_105966283.1|1827618_1828350_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.1	2.5e-43
WP_001061054.1|1828401_1829208_-|bacteriocin	bacteriocin family protein	bacteriocin	NA	NA	NA	NA
WP_001493054.1|1829209_1830265_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_000362423.1|1830358_1831135_-	NAD-dependent formate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	29.3	2.0e-14
WP_000639434.1|1831994_1832276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160448951.1|1832424_1832670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001543756.1|1832727_1833516_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	91.1	1.6e-51
WP_000796235.1|1833535_1834207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048213821.1|1835138_1835384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073527372.1|1835388_1836393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048213819.1|1836477_1837008_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048213818.1|1837011_1837281_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_001189109.1|1838073_1839582_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
WP_077483231.1|1842005_1842974_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	5.5e-179
WP_022652303.1|1843132_1844338_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_073527375.1|1844339_1845050_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	1.7e-31
WP_003056106.1|1845078_1845552_+	cytochrome c	NA	NA	NA	NA	NA
WP_042201119.1|1845538_1847026_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_001162010.1|1847156_1847714_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	3.4e-48
WP_073527376.1|1847785_1848490_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	2.2e-137
WP_013036336.1|1848880_1848961_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
1854536:1854553	attR	ACTGTTTTCCTGCTGCCG	NA	NA	NA	NA
>prophage 7
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	1903655	1930563	4702107	terminase,lysis,portal,transposase	Enterobacteria_phage(32.0%)	39	NA	NA
WP_000527800.1|1903655_1905116_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
WP_120795384.1|1907092_1907206_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1907274_1907508_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|1907824_1908415_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_073527384.1|1908906_1909587_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.6	4.1e-120
WP_000198149.1|1909583_1909790_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|1909786_1911712_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453611.1|1911686_1912232_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001368374.1|1912620_1912854_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1912911_1913322_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1913473_1913647_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1913818_1913974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1914052_1914118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|1914120_1914309_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1914319_1914532_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001515369.1|1915388_1915922_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_001515370.1|1915977_1916292_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	97.1	1.6e-50
WP_073527385.1|1916296_1916512_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	3.8e-32
WP_001146314.1|1916702_1917416_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|1917822_1918782_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780584.1|1918974_1919499_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|1919654_1920032_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001515372.1|1920049_1921099_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.7e-112
WP_001515373.1|1921100_1921379_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001463433.1|1921445_1921697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1921913_1922069_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1922140_1922428_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1922427_1922667_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_071593935.1|1922691_1922997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1923199_1923532_+	protein FlxA	NA	NA	NA	NA	NA
WP_187658858.1|1923968_1924121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|1924493_1925655_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_073527387.1|1925669_1925864_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1925944_1926352_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379588.1|1926520_1926676_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171952.1|1926835_1927054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1927621_1927810_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1927806_1927998_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001515375.1|1928091_1930563_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
>prophage 8
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	3121845	3182433	4702107	holin,tail,protease,transposase	Enterobacteria_phage(20.0%)	60	NA	NA
WP_000131044.1|3121845_3123879_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001335745.1|3124007_3124595_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_032238543.1|3124608_3126081_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3126094_3127765_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3127977_3128646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016241914.1|3128888_3129584_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_016241913.1|3129576_3131004_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000339587.1|3132721_3133576_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_032238544.1|3136012_3136249_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3136260_3136854_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_073527463.1|3138042_3139089_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.7	1.5e-33
WP_000081352.1|3139197_3140130_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_023157580.1|3140116_3141520_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_073527464.1|3141794_3143006_-	3-(3-hydroxy-phenyl)propionate transporter MhpT	NA	NA	NA	NA	NA
WP_001013515.1|3143075_3144089_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	30.8	1.2e-43
WP_073527465.1|3144085_3145036_-	acetaldehyde dehydrogenase (acetylating)	NA	E5EQ71	Micromonas_sp._RCC1109_virus	36.0	6.9e-33
WP_000184938.1|3145032_3145842_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_000222149.1|3145851_3146718_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_000543446.1|3146746_3147700_-	3-carboxyethylcatechol 2,3-dioxygenase	NA	NA	NA	NA	NA
WP_001247776.1|3150291_3150555_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001295708.1|3150569_3150833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073527467.1|3151062_3151344_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350437.1|3151378_3151948_+	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_073527468.1|3152053_3154936_+	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	1.2e-128
WP_001295707.1|3154935_3155127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000412528.1|3155187_3156915_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	C7U047	Ostreococcus_tauri_virus	37.7	4.4e-86
WP_001275372.1|3157002_3157461_+	small heat shock protein sHSP20-GI	NA	NA	NA	NA	NA
WP_001022485.1|3157483_3158398_+	heat resistance protein YfdX1	NA	NA	NA	NA	NA
WP_001005473.1|3158500_3159388_+	heat resistance protein YfdX2	NA	NA	NA	NA	NA
WP_001090787.1|3159477_3160089_+	heat resistance membrane protein HdeD-GI	NA	NA	NA	NA	NA
WP_001166995.1|3160168_3161314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786817.1|3161303_3161744_+	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	3.4e-11
WP_001295706.1|3161747_3163463_+	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000843382.1|3163459_3163957_+	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_016241903.1|3163934_3164900_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_000323727.1|3164924_3166076_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_001065555.1|3167991_3168855_+	GTPase family protein	NA	NA	NA	NA	NA
WP_000197387.1|3168946_3169768_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	2.1e-46
WP_000189411.1|3169984_3170686_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001144031.1|3170726_3170963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000649865.1|3170962_3171406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001385283.1|3171428_3171896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194654.1|3171972_3172212_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000211838.1|3172309_3172768_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000811693.1|3172783_3173260_+	RadC family protein	NA	NA	NA	NA	NA
WP_000691994.1|3173268_3173490_+	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000070396.1|3173508_3173826_+	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_032293845.1|3173846_3174188_+	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_032177817.1|3175104_3175848_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_073527469.1|3176235_3177147_-|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	98.3	2.5e-165
WP_072003692.1|3177499_3178564_+	acyltransferase	NA	NA	NA	NA	NA
WP_077758612.1|3178595_3178961_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	66.1	3.9e-37
WP_073527470.1|3178957_3179521_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000544528.1|3179715_3180021_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_073527471.1|3180342_3181032_-	antitermination protein	NA	I6PDF8	Cronobacter_phage	48.9	4.9e-57
WP_000971093.1|3181028_3181169_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_073527472.1|3181165_3181528_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	4.3e-60
WP_073527473.1|3181524_3181815_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	1.9e-47
WP_000224914.1|3181807_3181978_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_073527474.1|3181977_3182433_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	68.9	1.3e-61
>prophage 9
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	3185706	3199031	4702107	integrase	Enterobacteria_phage(47.37%)	19	3193484:3193497	3197708:3197721
WP_073527476.1|3185706_3186408_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.9	3.5e-127
WP_001446384.1|3186404_3187424_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_001566184.1|3187420_3187960_-	toxin YdaT domain-containing protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_000184665.1|3187990_3188218_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_024185289.1|3188328_3189021_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	85.7	2.5e-109
WP_000340376.1|3189087_3189951_+	hypothetical protein	NA	M9NYX6	Enterobacteria_phage	62.1	1.8e-93
WP_000233576.1|3190427_3190634_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995420.1|3190710_3191007_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	1.8e-48
WP_073527477.1|3191012_3191798_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	4.1e-148
WP_016246895.1|3191794_3192475_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	8.7e-131
WP_000682311.1|3192471_3192654_+	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	96.7	1.4e-27
WP_016246896.1|3192626_3192818_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188870.1|3192894_3193110_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	100.0	1.0e-32
WP_016246897.1|3193208_3193427_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	1.8e-34
WP_000488407.1|3193474_3193753_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
3193484:3193497	attL	ATCATTTTTCCTAA	NA	NA	NA	NA
WP_033868771.1|3193951_3195115_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	1.5e-228
WP_000893278.1|3195319_3196573_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001285288.1|3196584_3197688_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3197975_3199031_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
3197708:3197721	attR	TTAGGAAAAATGAT	NA	NA	NA	NA
>prophage 10
NZ_CP010226	Escherichia coli strain S1 chromosome, complete genome	4702107	3665322	3739228	4702107	holin,tRNA,transposase,protease,integrase	Vibrio_phage(25.0%)	57	3657008:3657067	3744497:3745251
3657008:3657067	attL	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_001232412.1|3665322_3666327_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|3666329_3667589_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|3667674_3668955_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|3669030_3669339_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|3669424_3670375_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_032238234.1|3670367_3672215_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	2.6e-60
WP_000990333.1|3672224_3673562_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|3673580_3674042_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_001295189.1|3674013_3675561_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_032238233.1|3675559_3676699_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|3676681_3676735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|3677477_3678023_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041964.1|3678117_3679170_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934920.1|3679266_3680235_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001236847.1|3680256_3683580_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276180.1|3683608_3683923_-	YjeO family protein	NA	NA	NA	NA	NA
WP_000342867.1|3683919_3684234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001742602.1|3684285_3685788_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_000004770.1|3686006_3686984_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
WP_001192973.1|3687308_3689117_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|3689109_3689844_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208757.1|3689854_3690250_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|3690260_3690620_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001300820.1|3690682_3691816_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001238369.1|3691904_3692438_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|3692434_3692752_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|3692933_3693080_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977757.1|3693190_3693316_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|3693367_3693934_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940526.1|3693975_3695004_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008049.1|3695397_3696267_+	YjeJ family protein	NA	NA	NA	NA	NA
WP_000558209.1|3696469_3696823_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|3696960_3698607_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|3698650_3698944_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015853.1|3699219_3700476_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267448.1|3700491_3700968_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|3701304_3702741_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|3702858_3704160_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
WP_000883400.1|3704275_3704614_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_000068902.1|3704589_3706287_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|3706323_3706899_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032170149.1|3707277_3708543_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	39.1	1.3e-79
WP_001548957.1|3709732_3709948_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073527510.1|3710195_3711473_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001548954.1|3711535_3713533_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_166783752.1|3713816_3714557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148989245.1|3715110_3715713_+	DUF1819 family protein	NA	NA	NA	NA	NA
WP_000566901.1|3715709_3716312_+	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_001548950.1|3716323_3719965_+	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_001548949.1|3720010_3723619_+	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_001548948.1|3723795_3726393_+	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_001193073.1|3726403_3728488_+|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_000609174.1|3730141_3730489_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	2.7e-59
WP_001548946.1|3731016_3733038_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001548945.1|3733038_3734499_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_032148176.1|3736101_3737610_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.3	1.2e-44
WP_001548941.1|3738151_3739228_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
3744497:3745251	attR	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGAGAACGACAGCGACTTCCGTCCCAGCCGTGCCAGGTGCTGCCTCAGATTCAGGTTATGCCGCTCAATTCGCTGCGTATATCGCTTGCTGATTACGTGCAGCTTTCCCTTCAGGCGGGATTCATACAGCGGCCAGCCATCACCACGTCAAAGGGTGACAGCAGGCTCATAAGACGCCCCAGCGTCGCCATAGTGCGTTCCCGAATACGTGCGCAACAACCGTCTTCCGGAGCCTGTCATACGCGTAAAACAGCCAGCGCTGGCGCGATTTAGCCCCGACATAGCCCCACTGTTCGTCCATTTCCGCGCAGACGATGACGTCACTGCCCGGCTGTATGCGCGAGGTTACCGACTGCGGCCTGAGTTTTTTAAGTGACGTAAAATCGTGTTGAGGCCAACGCCCATAATGCGGGCTGTTGCCCGGCATCCAACGCCATTCATGGCCATATCAATGATTTTCTGGTGCGTACCGGGTTGAGAAGCGGTGTAAGTGAACTGCAGTTGCCATGTTTTACGGCAGTGAGAGCAGAGATAGCGCTGATGTCCGGCGGTGCTTTTGCCGTTACGCACCACCCCGTCAGTAGCTGAACAGGAGGGACAGCTGATAGAAACAGAAGCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACC	NA	NA	NA	NA
