The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	393265	400405	5102172		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|393265_393904_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|393900_395163_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|395159_396068_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|396263_397031_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141314.1|397081_397738_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001272898.1|397843_400405_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	783350	828291	5102172	terminase,holin,head,tail,plate,tRNA,integrase,portal,capsid	Enterobacteria_phage(86.36%)	55	786779:786802	832107:832130
WP_000683799.1|783350_785357_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000817178.1|785515_786736_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
786779:786802	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_000127781.1|787028_788207_+	MFS transporter	NA	NA	NA	NA	NA
WP_000615821.1|788203_789199_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_042094563.1|789428_790220_-	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	7.4e-65
WP_042094562.1|790164_790362_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000078920.1|790597_790738_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488107.1|790929_791190_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000060706.1|791274_792345_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000132808.1|792517_793627_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_073519570.1|793784_794969_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	6.4e-222
WP_000290450.1|794968_795481_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000665308.1|795535_795901_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333495.1|795909_796065_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_071685921.1|796051_798859_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	88.2	0.0e+00
WP_000979954.1|798871_799360_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_001100987.1|799456_800635_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_073519571.1|800729_801329_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	5.9e-99
WP_047084517.1|801328_803440_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	9.7e-112
WP_021293091.1|803442_803973_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_001512968.1|803965_804862_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.9e-155
WP_001067548.1|804865_805195_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_077631957.1|805212_805779_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-99
WP_001705834.1|805790_806426_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_000920594.1|806418_806886_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_021511916.1|807023_807431_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	7.7e-66
WP_000072335.1|807427_807820_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_000104350.1|807816_808140_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|808142_808343_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063094.1|808342_808837_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000632362.1|808938_809739_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_021533064.1|809784_810837_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	2.5e-193
WP_001262673.1|810860_811697_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613781.1|811851_813603_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001705841.1|813602_814649_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_001289966.1|815139_815730_-	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_000211289.1|815793_816105_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_000686499.1|816109_817069_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_021579107.1|817145_819968_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_073519572.1|819974_820340_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001326016.1|820336_820954_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_021579106.1|820965_821265_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	6.2e-41
WP_000153674.1|821261_821507_-	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_000985161.1|821503_821707_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000021652.1|821792_821906_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000514277.1|821902_822145_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_044788547.1|822156_822444_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_021579104.1|822454_822796_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	2.5e-54
WP_073519573.1|823048_823255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004249.1|823261_823549_-	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_001390705.1|823662_823983_+	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000023402.1|824079_825084_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_000004833.1|825242_826400_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_001289162.1|826465_827479_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001283590.1|827478_828291_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
832107:832130	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
>prophage 3
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	1035036	1044478	5102172		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|1035036_1035963_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1035967_1036699_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1036679_1036787_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1036846_1037578_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1037799_1039485_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1039481_1040201_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1040247_1040718_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1040758_1041220_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001317947.1|1041344_1043345_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001292774.1|1043341_1044478_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 4
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	1369432	1454125	5102172	terminase,holin,head,integrase,tail,tRNA,portal,lysis,capsid,protease,transposase	Escherichia_phage(44.07%)	100	1371187:1371202	1403840:1403855
WP_000916763.1|1369432_1369663_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|1369801_1370176_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879280.1|1370179_1371052_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|1371064_1371406_+	YebY family protein	NA	NA	NA	NA	NA
1371187:1371202	attL	CGAAGAGGTGATGCTG	NA	NA	NA	NA
WP_001189091.1|1371798_1372875_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_001311878.1|1372840_1373122_-	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001356607.1|1373228_1373417_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|1373409_1373604_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166317.1|1373660_1374470_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_021527613.1|1374462_1377096_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	58.1	2.9e-206
WP_001452559.1|1377194_1377470_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_000245528.1|1377544_1377721_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_073519610.1|1377714_1377936_-	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	93.2	1.3e-35
WP_001419881.1|1378465_1378660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000232638.1|1378625_1378844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410105.1|1379143_1379563_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|1379659_1379902_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702025.1|1379898_1380321_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_073519611.1|1380398_1381529_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.5	2.5e-42
WP_073519612.1|1381535_1382282_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.1e-114
WP_073519613.1|1382304_1383066_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	2.8e-117
WP_073519614.1|1383081_1383504_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	6.3e-63
WP_073519615.1|1383500_1383701_+	hypothetical protein	NA	K7P729	Enterobacteria_phage	71.2	7.9e-16
WP_073528026.1|1384222_1384480_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.8e-28
WP_073519448.1|1384584_1385604_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_073519617.1|1385884_1386403_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	48.8	6.8e-35
WP_073519618.1|1386399_1386795_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.8	2.3e-38
WP_000018421.1|1387028_1387241_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_000119355.1|1387449_1387629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818163.1|1387647_1388133_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000411312.1|1388356_1388569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061892354.1|1388640_1389240_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.7e-106
WP_073519620.1|1389239_1389530_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	1.3e-46
WP_073519621.1|1389526_1390069_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	6.4e-76
WP_073519622.1|1391643_1392072_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_064768310.1|1393538_1393844_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000284506.1|1393921_1394137_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_073519623.1|1394140_1394692_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	58.9	1.1e-43
WP_073519624.1|1394639_1394900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061892325.1|1395014_1395548_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	6.4e-97
WP_061892324.1|1395544_1396012_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	98.7	7.2e-76
WP_061892323.1|1395999_1396152_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.2e-19
WP_073528025.1|1396463_1396856_-	DUF1398 family protein	NA	NA	NA	NA	NA
WP_061892169.1|1397571_1398120_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	6.5e-60
WP_073519627.1|1398091_1400020_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.1e-258
WP_061892171.1|1400003_1400207_+|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.7	9.5e-09
WP_061892172.1|1400203_1401796_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	3.4e-186
WP_073519628.1|1401785_1403291_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.4	2.9e-102
WP_061892174.1|1403327_1403675_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_073519629.1|1403732_1404761_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.9e-115
1403840:1403855	attR	CGAAGAGGTGATGCTG	NA	NA	NA	NA
WP_061892713.1|1404813_1405194_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	70.0	7.2e-34
WP_073519630.1|1405205_1405559_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	95.7	2.4e-60
WP_061892715.1|1405570_1406146_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	9.8e-51
WP_061892716.1|1406142_1406538_+|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	92.4	1.7e-65
WP_061892718.1|1406545_1407286_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_053294703.1|1407301_1407724_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	1.7e-60
WP_073519631.1|1407705_1408140_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	94.2	2.7e-61
WP_073519632.1|1408132_1410712_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.7	0.0e+00
WP_021528540.1|1410708_1411038_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_001152619.1|1411037_1411736_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_073519633.1|1411741_1412485_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_073521376.1|1413115_1416529_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	95.9	0.0e+00
WP_001233071.1|1416599_1417199_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_077898616.1|1417263_1418433_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	64.1	1.4e-32
WP_077897937.1|1418416_1418983_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	1.8e-28
WP_061892726.1|1418975_1419359_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	41.1	1.3e-14
WP_077897940.1|1419644_1419827_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_000812724.1|1421726_1422383_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_001296140.1|1422383_1422575_-	YebW family protein	NA	NA	NA	NA	NA
WP_001295499.1|1422679_1422916_-	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000057022.1|1423033_1424473_-	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001299674.1|1424552_1427186_-	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_001207284.1|1427154_1428438_-	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_073519635.1|1428567_1429065_+	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_000431370.1|1429161_1429860_+	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001326055.1|1429879_1431928_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
WP_000984517.1|1432119_1433001_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001127216.1|1433046_1434420_-	MFS transporter	NA	NA	NA	NA	NA
WP_001262174.1|1434596_1435388_+	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001211011.1|1435530_1435770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000714550.1|1435928_1436072_+	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001006865.1|1436146_1436434_+	YebO family protein	NA	NA	NA	NA	NA
WP_001295496.1|1437103_1437247_+	YobF family protein	NA	NA	NA	NA	NA
WP_001062678.1|1437259_1437469_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_000010129.1|1437634_1438444_+	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001296134.1|1438440_1439007_-	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_073519636.1|1439436_1439895_-	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_000228655.1|1439949_1440801_-	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000406926.1|1440813_1441614_-	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000150543.1|1441676_1442648_-	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_053898130.1|1443110_1444667_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.8	6.0e-42
WP_001295494.1|1444670_1446269_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000624298.1|1446399_1447764_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000456725.1|1447947_1448526_-	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000854972.1|1448529_1449891_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|1449964_1450144_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001307845.1|1450263_1450623_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|1450985_1451330_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128847.1|1451461_1453372_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220965.1|1453429_1454125_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	2260888	2308221	5102172	terminase,head,holin,tail,integrase,portal,lysis,capsid,protease	Escherichia_phage(52.08%)	63	2306075:2306090	2308906:2308921
WP_000003671.1|2260888_2261476_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_073519691.1|2261472_2262180_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_001504149.1|2262198_2263992_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001058323.1|2263988_2265107_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_073519868.1|2266673_2267057_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	42.1	3.4e-15
WP_077897937.1|2267049_2267616_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	1.8e-28
WP_073519693.1|2268834_2269434_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	9.4e-105
WP_073519694.1|2269501_2272885_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.0	0.0e+00
WP_073519695.1|2272945_2273581_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	74.9	1.7e-83
WP_073519869.1|2273478_2274222_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	6.8e-145
WP_073519696.1|2274227_2274926_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	2.4e-131
WP_001330090.1|2274925_2275282_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_073519697.1|2275259_2278487_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	93.5	0.0e+00
WP_059215648.1|2278533_2278812_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.7	1.8e-42
WP_016231754.1|2278835_2279207_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	95.9	5.2e-61
WP_059215647.1|2279221_2279926_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	95.7	1.9e-117
WP_073519698.1|2279986_2280331_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	8.8e-55
WP_172944233.1|2280327_2280774_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.7	8.7e-63
WP_001147815.1|2280773_2281112_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	91.1	1.2e-51
WP_065228207.1|2281120_2281438_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.5	4.8e-23
WP_073519700.1|2281482_2282709_-|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	99.1	1.1e-187
WP_001193625.1|2282722_2283373_-|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_073519701.1|2283350_2284592_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	3.6e-231
WP_069904030.1|2284591_2284774_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	4.8e-20
WP_001140897.1|2284785_2286543_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_038354741.1|2286542_2287025_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	2.7e-86
WP_001140099.1|2287171_2287522_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_073519702.1|2287529_2287730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519703.1|2287816_2288119_-	hypothetical protein	NA	Q8HA83	Salmonella_phage	86.0	3.8e-46
WP_001542813.1|2288201_2288498_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	1.5e-50
WP_164997238.1|2288672_2288828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519704.1|2288869_2289247_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
WP_073519705.1|2289249_2289525_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	92.3	1.7e-40
WP_001351476.1|2289514_2289907_-|holin	holin	holin	Q8W636	Enterobacteria_phage	96.9	1.0e-54
WP_073519706.1|2291184_2291874_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	1.4e-59
WP_073519707.1|2291870_2292230_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.4e-39
WP_073519708.1|2292242_2293289_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.0e-109
WP_073519709.1|2293581_2293842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519710.1|2294062_2294275_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	5.1e-21
WP_073519711.1|2294486_2294882_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.6e-36
WP_073519712.1|2294881_2295547_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	48.9	1.0e-51
WP_073519713.1|2295543_2295753_-	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.3	3.7e-32
WP_172944234.1|2295754_2296060_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.9	4.3e-37
WP_073519714.1|2296268_2296871_-	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	72.3	3.1e-55
WP_000753060.1|2296867_2297044_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_172944232.1|2297045_2297219_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	94.7	5.2e-24
WP_077897935.1|2297311_2297668_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_073519871.1|2297725_2298121_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	54.3	2.4e-32
WP_157896686.1|2298150_2298693_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_123006575.1|2298604_2299645_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_073519717.1|2299616_2300168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|2300151_2300379_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|2300456_2300864_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_073519718.1|2301114_2301414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2301485_2301704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519719.1|2301726_2302134_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.0	3.0e-09
WP_000920491.1|2302111_2302345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449196.1|2302906_2303095_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_073519720.1|2303091_2303283_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_073519721.1|2303376_2305848_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.1	2.2e-59
WP_021564129.1|2305914_2306166_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
2306075:2306090	attL	CAGCAATGTCGAAAGT	NA	NA	NA	NA
WP_073519722.1|2306134_2307154_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	4.9e-85
WP_000375136.1|2307561_2308221_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
2308906:2308921	attR	ACTTTCGACATTGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	3074024	3079338	5102172	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_073519772.1|3074024_3075596_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	2.4e-168
WP_000624622.1|3075615_3075963_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_073519873.1|3075962_3076610_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	3.5e-20
WP_000410600.1|3076677_3077184_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	2.5e-10
WP_172944258.1|3077159_3078023_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.0e-75
WP_049590476.1|3078546_3079338_-	BRO family, N-terminal domain protein	NA	Q6J1W3	Lactobacillus_phage	31.3	3.7e-08
>prophage 7
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	3769449	3827822	5102172	protease,transposase	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|3769449_3770709_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|3770711_3771716_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|3771797_3771995_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|3772098_3773397_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|3773601_3774027_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|3774065_3776507_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|3776686_3777418_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|3777544_3777946_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|3777964_3778663_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|3778713_3779373_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|3779390_3779789_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101649.1|3779798_3780437_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943987.1|3780439_3781603_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_001339483.1|3781686_3783312_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|3783428_3783704_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|3783852_3784182_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|3784363_3785113_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|3785109_3785865_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|3785972_3787037_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|3787391_3788789_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218358.1|3788804_3789110_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|3789119_3789584_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|3789597_3790248_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|3790257_3791112_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|3791111_3791798_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|3791894_3792446_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|3792520_3792796_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|3793122_3793518_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|3793524_3793839_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|3793843_3794071_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|3794112_3794562_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|3794632_3795427_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|3796049_3796481_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_000826425.1|3796488_3797697_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|3797831_3798470_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|3798688_3799309_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|3799617_3801030_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|3801074_3801737_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_073519817.1|3801844_3802810_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|3802917_3803778_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_073519816.1|3803866_3804247_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000886909.1|3806507_3807248_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|3807237_3807795_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|3808119_3808326_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|3808387_3809731_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|3810053_3810692_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|3810897_3812631_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060945.1|3812627_3816407_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|3816409_3816751_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|3816962_3817214_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|3817207_3817558_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|3817637_3818168_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|3818477_3819434_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|3819573_3821076_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|3821089_3822112_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|3822098_3823094_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|3823126_3824125_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|3824300_3825674_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|3825824_3826376_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|3826469_3827822_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 8
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	3871207	3881688	5102172	integrase	Enterobacteria_phage(80.0%)	12	3862817:3862831	3891802:3891816
3862817:3862831	attL	CTTAGAAAACAAGCT	NA	NA	NA	NA
WP_000446132.1|3871207_3871780_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|3871853_3872354_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024215847.1|3872350_3873085_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.1	7.4e-128
WP_001149160.1|3873637_3873904_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032226384.1|3873900_3874455_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001244665.1|3874447_3874735_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459291.1|3874727_3875183_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_073519814.1|3875318_3875639_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001544037.1|3875653_3877987_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_170979708.1|3878312_3878537_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	9.8e-23
WP_001218329.1|3878752_3880018_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_001022619.1|3880218_3881688_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
3891802:3891816	attR	AGCTTGTTTTCTAAG	NA	NA	NA	NA
>prophage 9
NZ_CP010221	Escherichia coli strain M19 chromosome, complete genome	5102172	4286600	4353498	5102172	tRNA,integrase,protease,transposase	Stx2-converting_phage(38.89%)	44	4339182:4339197	4365694:4365709
WP_001445629.1|4286600_4287029_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_073519782.1|4287371_4287830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001298267.1|4289368_4290151_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000350265.1|4290455_4291376_+	ribokinase	NA	NA	NA	NA	NA
WP_000998352.1|4291403_4292720_+	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_001533773.1|4294167_4294452_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	1.0e-24
WP_000345349.1|4294667_4295924_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000705927.1|4295936_4296224_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000916811.1|4296239_4296683_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000416158.1|4296953_4297985_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_073519781.1|4298739_4299363_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_073519780.1|4299584_4301357_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_073521398.1|4301369_4311146_+|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	36.9	7.3e-29
WP_000826005.1|4311142_4311376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519403.1|4312479_4314051_-|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.2e-167
WP_012904570.1|4314070_4314418_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_073519844.1|4314417_4315065_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
WP_000410600.1|4315132_4315639_+	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	2.5e-10
WP_172944258.1|4315614_4316478_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.0e-75
WP_077897958.1|4316559_4316787_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.4	2.8e-17
WP_073519404.1|4316940_4318239_-	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_073519405.1|4318300_4319020_-	amino acid racemase	NA	NA	NA	NA	NA
WP_073519406.1|4319360_4320293_+	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_172944248.1|4320295_4320559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519407.1|4320927_4321197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149025688.1|4321549_4322712_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_077897957.1|4326431_4327187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519410.1|4327150_4327504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519411.1|4327564_4327951_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323403.1|4329698_4330478_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	100.0	1.5e-139
WP_061892120.1|4332582_4332930_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_073519847.1|4332926_4333307_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	1.9e-58
WP_077875792.1|4333744_4335400_+	YadA-like family protein	NA	NA	NA	NA	NA
WP_061892122.1|4335670_4335895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519414.1|4336366_4336882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897956.1|4337168_4341950_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	39.7	9.4e-155
4339182:4339197	attL	TCCGGTGCTGGCGAAA	NA	NA	NA	NA
WP_073542044.1|4342237_4342588_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	86.1	4.7e-48
WP_172944249.1|4342613_4342814_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	83.1	2.1e-24
WP_073519416.1|4343543_4344320_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_073519417.1|4344656_4344890_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_061892129.1|4346330_4346762_-	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_077875793.1|4347876_4348134_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_073519419.1|4349944_4350781_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_021537648.1|4352316_4353498_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.7	1.1e-162
4365694:4365709	attR	TTTCGCCAGCACCGGA	NA	NA	NA	NA
>prophage 1
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	0	1501	146552		Morganella_phage(50.0%)	2	NA	NA
WP_073519984.1|818_1256_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
WP_073519983.1|1252_1501_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
>prophage 2
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	9479	17968	146552		Pectobacterium_phage(16.67%)	12	NA	NA
WP_160537948.1|9479_9734_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	47.5	1.5e-11
WP_154813206.1|9910_10132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157920373.1|10196_10346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519975.1|10416_10974_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	4.3e-51
WP_073519974.1|11025_11268_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_073519973.1|11337_13335_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.1e-21
WP_097455818.1|13375_13810_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_073519971.1|14532_14847_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	35.7	6.4e-12
WP_073519970.1|15056_15218_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_171769349.1|15391_15766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519969.1|16658_17003_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	51.5	9.1e-20
WP_073519968.1|17146_17968_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.4	2.0e-44
>prophage 3
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	25757	25979	146552		Escherichia_phage(100.0%)	1	NA	NA
WP_073519957.1|25757_25979_+	conjugal transfer protein TraR	NA	A0A0F7LDI3	Escherichia_phage	38.9	1.7e-06
>prophage 4
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	52409	53144	146552		Xanthomonas_phage(100.0%)	1	NA	NA
WP_073519934.1|52409_53144_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.3	5.9e-08
>prophage 5
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	56327	57413	146552		Escherichia_phage(100.0%)	1	NA	NA
WP_077897982.1|56327_57413_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	58.5	5.0e-112
>prophage 6
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	66789	69721	146552		Bacillus_phage(50.0%)	2	NA	NA
WP_073519925.1|66789_68943_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.0	3.4e-27
WP_073519924.1|68986_69721_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	28.1	3.2e-06
>prophage 7
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	79991	82181	146552		Bacillus_phage(100.0%)	1	NA	NA
WP_073519912.1|79991_82181_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	5.8e-27
>prophage 8
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	85889	86468	146552		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001400936.1|85889_86468_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.2	1.2e-27
>prophage 9
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	91681	100398	146552		Enterobacteria_phage(33.33%)	4	NA	NA
WP_073519907.1|91681_95785_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.1	0.0e+00
WP_095374788.1|97124_98318_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_073519905.1|98542_99181_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	2.8e-54
WP_073519904.1|99165_100398_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.4	6.3e-63
>prophage 10
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	114708	118638	146552		Enterobacteria_phage(100.0%)	1	NA	NA
WP_073519890.1|114708_118638_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.0	5.3e-212
>prophage 11
NZ_CP010222	Escherichia coli strain M19 plasmid A, complete sequence	146552	124603	134049	146552	integrase,transposase	Enterobacteria_phage(50.0%)	8	113369:113382	130534:130547
113369:113382	attL	GCATCTCTCCGGCA	NA	NA	NA	NA
WP_073519885.1|124603_125344_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	1.7e-23
WP_000361618.1|125628_126606_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.0e-100
WP_001270417.1|127534_127822_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_001132895.1|127818_128070_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032334873.1|128234_128447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817644.1|128820_130026_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000756325.1|130022_130985_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.6	6.1e-114
130534:130547	attR	GCATCTCTCCGGCA	NA	NA	NA	NA
WP_073519881.1|132903_134049_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	96.2	3.8e-219
