The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	243391	303002	4821620	transposase,terminase,portal,plate,integrase,holin,tail,head,tRNA,capsid	Enterobacteria_phage(77.08%)	72	245794:245818	280897:280921
WP_000029466.1|243391_244141_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_033560800.1|244140_244692_-	glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|244754_245735_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
245794:245818	attL	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_072135257.1|245943_246381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032186672.1|246380_246713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053285677.1|246745_247684_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	8.7e-81
WP_053285678.1|247772_248084_-	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	49.5	1.4e-19
WP_001151412.1|248179_248458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917795.1|248472_248811_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	86.2	8.9e-52
WP_000158971.1|248821_249109_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000514277.1|249120_249363_+	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021668.1|249359_249473_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	1.2e-08
WP_000985159.1|249559_249763_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_001761886.1|249759_250005_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	85.2	5.1e-33
WP_000599382.1|250146_250512_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_149026514.1|250518_253341_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.1	0.0e+00
WP_000686539.1|253417_254377_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	5.8e-181
WP_000211289.1|254381_254693_+	chromosome partitioning protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_021526793.1|254756_255347_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.0	6.8e-31
WP_073553355.1|255837_256884_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	1.7e-205
WP_057080988.1|256883_258635_-	oxidoreductase	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_001262670.1|258789_259626_+|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	98.9	8.7e-149
WP_001055112.1|259649_260702_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.4	2.9e-194
WP_000632366.1|260747_261548_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	4.6e-131
WP_057080987.1|261649_262144_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.6	3.9e-88
WP_000864897.1|262143_262344_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|262346_262670_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|262666_263059_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000780572.1|263055_263463_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_024132949.1|263434_263614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920602.1|263600_264068_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	99.4	5.9e-86
WP_000356347.1|264060_264696_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_046788699.1|264692_265274_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	100.0	5.9e-104
WP_000213447.1|265270_265621_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	100.0	9.2e-60
WP_001111925.1|265624_266521_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	99.3	7.1e-157
WP_000071739.1|266513_267044_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	1.1e-93
WP_073553357.1|267046_269197_+|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	83.2	3.5e-303
WP_073553359.1|269200_269728_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	95.4	1.8e-91
WP_073553361.1|269756_270290_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	98.9	7.1e-96
WP_032152428.1|270292_270850_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	89.1	1.3e-84
WP_000905061.1|271068_271668_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|271697_272186_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_073553363.1|272198_275006_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	96.9	0.0e+00
WP_000333503.1|274992_275148_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|275156_275531_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|275586_276099_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_046123485.1|276098_277283_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.5	1.2e-223
WP_073553365.1|277440_278541_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.6	2.5e-204
WP_063103710.1|278765_279326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057780902.1|279312_279717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000488102.1|280041_280302_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|280492_280633_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001229265.1|280938_281238_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
280897:280921	attR	AAAGAAAAAAGGCCGCAGAGCGGCC	NA	NA	NA	NA
WP_000672356.1|281242_283630_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|283644_284628_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|284911_284956_-|tRNA	phenylalanyl--tRNA ligase operon leader peptide	tRNA	NA	NA	NA	NA
WP_000124850.1|285078_285435_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|285487_285685_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|285781_286324_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|286327_288256_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_000771396.1|290983_291742_-	YdiY family protein	NA	NA	NA	NA	NA
WP_000251735.1|292028_292958_+	6-phosphofructokinase II	NA	NA	NA	NA	NA
WP_000146159.1|293058_293349_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_000267654.1|293454_294315_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_000222172.1|294355_294892_-	membrane protein	NA	NA	NA	NA	NA
WP_000106834.1|295038_295707_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_001295408.1|295869_296460_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001010707.1|296592_297984_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_000493141.1|298434_298791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001241561.1|299079_299343_-	cell division activator CedA	NA	NA	NA	NA	NA
WP_000077848.1|299525_301787_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
WP_004022510.1|302021_303002_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	699420	708862	4821620		Enterobacteria_phage(85.71%)	10	NA	NA
WP_073553417.1|699420_700557_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	9.4e-162
WP_001326004.1|700553_702554_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|702678_703140_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|703180_703651_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|703697_704417_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|704413_706099_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|706320_707052_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|707111_707219_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|707199_707931_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|707935_708862_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 3
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	908392	988839	4821620	terminase,lysis,coat,integrase,tail,tRNA,head	Cronobacter_phage(33.96%)	98	936916:936932	992531:992547
WP_001283585.1|908392_909205_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|909204_910218_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699121.1|910283_911420_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
WP_000615813.1|911518_912514_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127756.1|912510_913689_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|913981_915202_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_047660681.1|915360_917367_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559764.1|917487_917766_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089235.1|917799_918348_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447361.1|918347_919157_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043819.1|919156_919981_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918470.1|919984_921070_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
WP_001295704.1|921104_922037_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|922202_922754_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_000698770.1|922825_923683_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_073553429.1|923684_924224_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000714137.1|924220_924709_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000018448.1|924705_925215_-	fimbrial protein	NA	NA	NA	NA	NA
WP_073553431.1|925230_925983_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_073553433.1|926002_928648_-	fimbrial usher protein YfcU	NA	NA	NA	NA	NA
WP_000033319.1|928729_929293_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001195819.1|929967_930453_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000426164.1|930655_932800_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531953.1|932799_934110_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296869.1|934289_934574_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001296861.1|934945_936286_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_073553435.1|936652_937711_+	hypothetical protein	NA	NA	NA	NA	NA
936916:936932	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000776768.1|937892_938648_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_033560971.1|938941_939874_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	7.9e-167
WP_032141915.1|940188_941358_+|integrase	tyrosine-type recombinase/integrase	integrase	C6ZR22	Salmonella_phage	88.4	6.8e-208
WP_032141916.1|941364_941754_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	67.4	5.8e-47
WP_073553437.1|941925_942990_+	acyltransferase	NA	NA	NA	NA	NA
WP_032141918.1|943006_944011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141919.1|944010_944880_+	acyltransferase	NA	NA	NA	NA	NA
WP_032141921.1|947083_949561_-|tail	phage tail protein	tail	F1C5A7	Cronobacter_phage	88.2	0.0e+00
WP_050488448.1|949547_949964_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	83.8	1.6e-66
WP_032141923.1|949926_950397_-	hypothetical protein	NA	F1C5F1	Cronobacter_phage	92.9	7.0e-79
WP_032141924.1|950396_950894_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	90.9	7.9e-89
WP_073553439.1|950893_953824_-|tail	tail protein (tape measure)	tail	F1C5E9	Cronobacter_phage	43.3	2.3e-140
WP_032141926.1|953878_954235_-	hypothetical protein	NA	A0A0P0IE45	Acinetobacter_phage	41.2	2.7e-14
WP_032141927.1|954234_954615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141928.1|954662_955355_-	hypothetical protein	NA	G0ZNE7	Cronobacter_phage	50.7	2.1e-55
WP_032141929.1|955412_956156_-	Ig domain-containing protein	NA	F1C5E5	Cronobacter_phage	83.1	6.5e-71
WP_032141930.1|956219_956603_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	63.0	1.2e-39
WP_032141931.1|956599_957064_-	hypothetical protein	NA	A0A2P1MXA4	Escherichia_phage	43.5	3.8e-29
WP_032141932.1|957066_957423_-	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.4	2.1e-27
WP_032141933.1|957422_957596_-	hypothetical protein	NA	Q5G8X7	Enterobacteria_phage	50.9	1.6e-12
WP_032141934.1|957595_957976_-	hypothetical protein	NA	F1C5E2	Cronobacter_phage	55.3	3.7e-30
WP_032141935.1|957978_958158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141936.1|958167_959253_-|coat	phage coat protein	coat	F1C5E1	Cronobacter_phage	71.5	4.9e-144
WP_032141937.1|959264_959696_-	hypothetical protein	NA	F1C5E0	Cronobacter_phage	65.0	3.9e-44
WP_032141939.1|959699_961085_-	DUF2213 domain-containing protein	NA	F1C5D9	Cronobacter_phage	63.6	4.9e-165
WP_077757464.1|961147_962002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064735412.1|962053_963061_-|head	phage head morphogenesis protein	head	F1C5D8	Cronobacter_phage	65.8	1.4e-105
WP_073553441.1|962987_964457_-	DUF1073 domain-containing protein	NA	F1C5D7	Cronobacter_phage	57.0	8.1e-150
WP_032141943.1|964469_965768_-|terminase	terminase	terminase	Q5G8Y7	Enterobacteria_phage	96.5	3.1e-246
WP_032141944.1|965751_966219_-	DUF2280 domain-containing protein	NA	I6S1P9	Salmonella_phage	80.5	7.0e-63
WP_032141945.1|966251_966890_-	hypothetical protein	NA	I6S676	Salmonella_phage	90.1	2.9e-112
WP_032141946.1|967008_967347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141947.1|967402_967612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141948.1|967727_968135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141949.1|968183_968645_-|lysis	lysis protein	lysis	M9NYX9	Enterobacteria_phage	65.6	5.3e-47
WP_077757465.1|968641_969172_-	lysozyme	NA	I6PBN2	Cronobacter_phage	62.7	1.0e-49
WP_032141950.1|969149_969470_-	hypothetical protein	NA	H6WRZ3	Salmonella_phage	79.0	3.7e-39
WP_032141951.1|969765_970455_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	5.1e-54
WP_089604614.1|970451_970568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141952.1|970564_970948_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	44.6	2.7e-20
WP_032141953.1|970944_971556_-	protein ninG	NA	A0A0M4RU10	Salmonella_phage	71.9	3.8e-61
WP_032141954.1|971548_971719_-	hypothetical protein	NA	G8C7V4	Escherichia_phage	87.3	1.5e-20
WP_032141955.1|971718_972174_-	hypothetical protein	NA	K7P7B8	Enterobacteria_phage	72.2	9.2e-60
WP_032141956.1|972347_972998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141957.1|972994_973243_-	DNA polymerase III subunit theta	NA	G8C7V1	Escherichia_phage	92.5	1.9e-35
WP_032141958.1|973242_973569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123282430.1|974123_974408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071961367.1|974559_974814_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	45.3	4.4e-11
WP_032141960.1|974844_975144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032141961.1|975143_976577_-	AAA family ATPase	NA	Q716D2	Shigella_phage	84.7	2.0e-233
WP_032141962.1|976566_977463_-	hypothetical protein	NA	F1C5C3	Cronobacter_phage	58.1	3.5e-95
WP_032141964.1|977685_978228_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	78.3	1.0e-73
WP_032141965.1|978257_978479_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	57.8	5.3e-13
WP_032142107.1|978632_979265_+	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	38.3	7.5e-36
WP_149026520.1|980013_980292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022651077.1|980764_980974_+	hypothetical protein	NA	M9NZE2	Enterobacteria_phage	92.8	9.7e-33
WP_032141967.1|981044_982013_+	hypothetical protein	NA	M9P0E1	Enterobacteria_phage	86.0	1.1e-70
WP_032141968.1|982020_982305_+	host nuclease inhibitor GamL	NA	G8C7T1	Escherichia_phage	91.5	1.2e-46
WP_032141969.1|982323_983169_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	61.2	2.8e-70
WP_032141970.1|983165_983846_+	YqaJ viral recombinase family protein	NA	M9NZE1	Enterobacteria_phage	94.2	1.1e-125
WP_073553443.1|983842_984271_+	regulator	NA	M9NYX4	Enterobacteria_phage	95.1	7.5e-72
WP_032141972.1|984431_985493_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	90.1	1.5e-185
WP_032141973.1|985495_985960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141974.1|985956_986616_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	94.5	1.9e-122
WP_032141975.1|986612_986831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141976.1|986827_987169_+	DUF551 domain-containing protein	NA	U5P092	Shigella_phage	51.9	3.2e-17
WP_032141978.1|987260_987479_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	66.7	3.7e-19
WP_032141979.1|987566_987839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141980.1|987927_988227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141981.1|988423_988624_+	hypothetical protein	NA	G8C7S1	Escherichia_phage	62.1	5.3e-20
WP_032141982.1|988635_988839_+	hypothetical protein	NA	I6RSG8	Salmonella_phage	61.2	6.6e-18
992531:992547	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 4
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	1210846	1306094	4821620	transposase,terminase,protease,portal,lysis,integrase,tail,tRNA	Enterobacteria_phage(43.55%)	97	1287813:1287827	1307931:1307945
WP_001297411.1|1210846_1211584_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|1211715_1213050_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001307344.1|1213258_1214140_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1214242_1214830_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1214885_1215269_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1215573_1216263_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1216310_1217348_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1217554_1217974_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001307345.1|1218042_1218741_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082949.1|1218772_1221433_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949252.1|1221546_1222902_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|1222947_1223271_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1223267_1224566_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|1230436_1233010_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040115.1|1233139_1233871_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|1233867_1234848_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1234982_1235720_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1235990_1236332_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001700969.1|1236435_1236483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200100.1|1236581_1237742_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|1237784_1238906_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|1238916_1239987_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|1240196_1240562_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|1240711_1241230_+	DUF4154 domain-containing protein	NA	NA	NA	NA	NA
WP_000969032.1|1241219_1242446_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|1242461_1242944_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1243020_1243368_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1243409_1244177_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1244207_1244756_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1244774_1245023_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1245271_1246633_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1246799_1247591_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077221315.1|1247611_1248898_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|1248952_1249546_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|1249668_1250547_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|1250632_1252294_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1252442_1252784_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|1252845_1253136_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|1253125_1253602_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1253733_1254216_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|1255021_1256236_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_001288444.1|1256270_1257704_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.1e-106
WP_000355482.1|1258110_1258884_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_016242595.1|1258953_1259538_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.8	5.0e-103
WP_073553456.1|1259537_1262936_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	36.4	1.1e-11
WP_001230336.1|1263000_1263600_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_073553458.1|1263666_1267065_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.3	0.0e+00
WP_003887348.1|1267125_1267773_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	8.6e-112
WP_001619743.1|1267670_1268414_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	8.0e-146
WP_001152385.1|1268419_1269118_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_001610655.1|1269127_1269457_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	99.1	5.1e-60
WP_073553460.1|1269456_1272513_-|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	97.9	0.0e+00
WP_001161009.1|1272484_1272814_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001429942.1|1272822_1273209_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	99.2	2.8e-65
WP_000211105.1|1273269_1274013_-|tail	phage tail protein	tail	K7PGT7	Enterobacteria_phage	98.0	5.6e-131
WP_001079408.1|1274023_1274425_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	7.0e-72
WP_073553462.1|1274421_1275000_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|1275011_1275287_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|1275279_1275603_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077898567.1|1275689_1277717_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.5	0.0e+00
WP_061349732.1|1277661_1279170_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.0	1.5e-287
WP_001072975.1|1279169_1279382_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934130.1|1279378_1281481_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_000373425.1|1281480_1281975_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_032195724.1|1282133_1282334_-	hypothetical protein	NA	K7PJR7	Enterobacteria_phage	95.5	6.0e-32
WP_001139680.1|1282650_1282803_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001442864.1|1282790_1283258_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	99.4	2.9e-77
WP_001135251.1|1283254_1283752_-	lysozyme	NA	A0A291AWW2	Escherichia_phage	99.4	1.7e-91
WP_000839596.1|1283751_1283967_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|1284033_1285086_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|1285236_1285440_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_001038607.1|1285710_1286157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204819.1|1286241_1286607_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_073553466.1|1286624_1287614_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.1	1.1e-193
WP_001061404.1|1287621_1288419_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
1287813:1287827	attL	CCAGCTTCACCATCT	NA	NA	NA	NA
WP_073553468.1|1288438_1288828_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	97.7	1.7e-67
WP_061103949.1|1288824_1289151_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	5.0e-52
WP_072275934.1|1289150_1289645_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	96.3	8.1e-86
WP_000104942.1|1289641_1290583_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|1290572_1290752_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515829.1|1290927_1291485_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.1e-96
WP_000649477.1|1291528_1291729_-	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1291819_1292494_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000196297.1|1292901_1293381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026523.1|1293742_1293964_+	hypothetical protein	NA	S5FNS4	Shigella_phage	91.8	9.9e-36
WP_001610672.1|1294019_1294556_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	2.4e-99
WP_001242730.1|1294546_1294909_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_001331173.1|1294905_1295121_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|1295180_1295387_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_073553470.1|1295347_1296514_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.2	2.3e-147
WP_001596855.1|1296572_1298306_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023363292.1|1298385_1299285_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	23.2	2.5e-08
WP_001341819.1|1299555_1300785_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	100.0	1.5e-234
WP_000448925.1|1300823_1301240_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	100.0	1.1e-72
WP_000214996.1|1301311_1303060_-	hypothetical protein	NA	A0A1B5FPH1	Escherichia_phage	99.7	0.0e+00
WP_000577254.1|1303061_1304780_-	ATP-binding protein	NA	A0A1B5FPD5	Escherichia_phage	99.8	3.2e-307
WP_085948466.1|1304931_1306094_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
1307931:1307945	attR	AGATGGTGAAGCTGG	NA	NA	NA	NA
>prophage 5
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	1378682	1385822	4821620		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|1378682_1381244_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|1381349_1382006_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|1382056_1382824_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|1383019_1383928_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|1383924_1385187_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|1385183_1385822_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	2381815	2394128	4821620	integrase	Enterobacteria_phage(100.0%)	13	2377032:2377045	2391569:2391582
2377032:2377045	attL	CCAACCTGACGCTG	NA	NA	NA	NA
WP_053285657.1|2381815_2382982_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	100.0	2.1e-225
WP_032254743.1|2383004_2384030_+	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	100.0	4.7e-197
WP_087897310.1|2384102_2384741_-	hypothetical protein	NA	Q7M296	Enterobacteria_phage	100.0	8.0e-94
WP_001415469.1|2385137_2385710_-	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	100.0	1.4e-97
WP_000984201.1|2385724_2385970_-	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	100.0	1.8e-41
WP_032254747.1|2385966_2386701_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	100.0	1.9e-131
WP_001149160.1|2387253_2387520_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_000980262.1|2387516_2388107_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	100.0	8.8e-71
WP_001244664.1|2388099_2388387_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_000856729.1|2388970_2389291_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_032254748.1|2389305_2391639_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	100.0	0.0e+00
2391569:2391582	attR	CCAACCTGACGCTG	NA	NA	NA	NA
WP_032254750.1|2392240_2393191_+	hypothetical protein	NA	Q7M295	Enterobacteria_phage	100.0	8.6e-177
WP_032254751.1|2393177_2394128_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	100.0	4.4e-181
>prophage 7
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	2638801	2736686	4821620	transposase,terminase,protease,portal,lysis,plate,integrase,holin,tRNA,head,tail,capsid	Escherichia_phage(53.19%)	105	2669396:2669442	2701269:2701315
WP_000560983.1|2638801_2639239_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_000080784.1|2639235_2640225_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001299484.1|2640288_2641197_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897305.1|2641425_2641737_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|2641737_2642028_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001295676.1|2642632_2642851_+	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_001087409.1|2643069_2643312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027708.1|2643641_2644571_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2644567_2645203_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331377.1|2645199_2646102_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_011310337.1|2646114_2649165_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|2649358_2650192_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_001307491.1|2650344_2651385_+	YiiG family protein	NA	NA	NA	NA	NA
WP_000931315.1|2651434_2653183_-	PTS transporter subunit EIIA	NA	NA	NA	NA	NA
WP_073553567.1|2653182_2654253_-	aminopeptidase	NA	NA	NA	NA	NA
WP_000446023.1|2654242_2655694_-	PTS fructose-like transporter subunit IIBC	NA	NA	NA	NA	NA
WP_000729597.1|2655704_2656151_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000619503.1|2656451_2656766_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179764.1|2656775_2657600_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001325794.1|2657774_2659034_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144052.1|2659030_2660500_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217139.1|2660787_2661624_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|2661607_2662546_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063489.1|2662542_2663577_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001297064.1|2663861_2664482_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
WP_001166063.1|2664741_2665725_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|2665873_2666548_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2666653_2668027_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|2668023_2668722_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2668871_2669372_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2669396:2669442	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985246.1|2669558_2670539_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_000777029.1|2670608_2670902_-	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_001308179.1|2671038_2671311_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|2671480_2671981_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_006777998.1|2672044_2672269_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.8e-32
WP_001277898.1|2672268_2672568_+	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113270.1|2672570_2672795_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|2672791_2673067_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_073553569.1|2673056_2675336_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.1	0.0e+00
WP_000012516.1|2675575_2678059_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_073553573.1|2678429_2679464_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	3.5e-200
WP_000156872.1|2679463_2681236_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_073553575.1|2681440_2682265_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.7	3.9e-133
WP_073553577.1|2682323_2683397_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	1.6e-200
WP_024261710.1|2683400_2684144_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.3e-127
WP_000988633.1|2684243_2684753_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001668220.1|2684752_2684956_+	phage Tail protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123124.1|2684959_2685241_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|2685240_2685738_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_073553578.1|2685752_2686178_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	97.2	1.7e-60
WP_021561347.1|2686165_2686591_+|lysis	LysB family phage lysis regulatory protein	lysis	Q7Y4E2	Escherichia_virus	96.5	6.1e-66
WP_001440152.1|2686562_2686736_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_032263607.1|2686698_2687166_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001001780.1|2687158_2687611_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_073553580.1|2687677_2688313_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	1.6e-110
WP_000127163.1|2688309_2688657_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121475.1|2688661_2689570_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	100.0	3.4e-162
WP_001285340.1|2689562_2690174_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_073553582.1|2690170_2691592_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	77.6	5.6e-196
WP_001008242.1|2691612_2692056_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_073553584.1|2692027_2692630_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	92.0	5.4e-100
WP_001145598.1|2692629_2693118_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	99.3	3.7e-83
WP_073553586.1|2693148_2693742_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	2.5e-102
WP_023156267.1|2693801_2694992_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	4.8e-225
WP_001251408.1|2695004_2695523_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2695579_2695855_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2695887_2696007_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_073553588.1|2695999_2698447_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.2	0.0e+00
WP_000978919.1|2698461_2698941_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	97.5	2.8e-83
WP_073553590.1|2698940_2700104_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.5	3.1e-205
WP_000468308.1|2700185_2700404_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|2700673_2701186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076742.1|2701393_2702296_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2701269:2701315	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|2702476_2703439_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_001045689.1|2703758_2704748_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000708994.1|2704854_2705610_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|2705664_2706432_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802226.1|2706539_2707139_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155254.1|2707239_2707680_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|2707891_2708191_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323556.1|2708217_2708646_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796320.1|2708650_2709397_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|2709493_2710504_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136788.1|2710638_2712147_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2712169_2713015_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2713439_2713685_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2713769_2714255_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|2714347_2715274_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|2715340_2716672_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|2716681_2717212_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_000068828.1|2717304_2718264_-	cell division protein FtsN	NA	NA	NA	NA	NA
WP_000644904.1|2718355_2719381_-	DNA-binding transcriptional regulator CytR	NA	NA	NA	NA	NA
WP_001298972.1|2719536_2721735_-	primosomal protein N'	NA	NA	NA	NA	NA
WP_000710769.1|2721937_2722150_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_053884370.1|2722210_2722819_-	YiiX family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000852812.1|2723002_2723320_-	met regulon transcriptional regulator MetJ	NA	NA	NA	NA	NA
WP_001352864.1|2723596_2724757_+	cystathionine gamma-synthase	NA	NA	NA	NA	NA
WP_000110772.1|2724759_2727192_+	bifunctional aspartate kinase/homoserine dehydrogenase II	NA	NA	NA	NA	NA
WP_024166588.1|2727155_2728286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073535635.1|2728418_2729972_+	bifunctional metallophosphatase/5'-nucleotidase	NA	A0A0B5J7T1	Pandoravirus	23.8	3.0e-09
WP_000007523.1|2730353_2731244_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_001296626.1|2731572_2733753_+	catalase/peroxidase HPI	NA	NA	NA	NA	NA
WP_001271242.1|2733846_2734752_+	cystine transporter YijE	NA	NA	NA	NA	NA
WP_040072216.1|2734778_2735396_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_000399589.1|2735705_2736686_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	3415110	3488247	4821620	protease,transposase,tRNA,plate	uncultured_Caudovirales_phage(20.0%)	58	NA	NA
WP_001346129.1|3415110_3416463_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|3416492_3418925_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|3419046_3419532_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139279.1|3419535_3420561_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|3420665_3421121_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|3421124_3421913_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139659.1|3421912_3423061_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569430.1|3423057_3423654_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294774.1|3423690_3427173_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000055741.1|3427185_3428145_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|3428243_3430385_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|3430441_3430831_+	VOC family protein	NA	NA	NA	NA	NA
WP_073553628.1|3430895_3432194_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062312.1|3432242_3432503_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|3432489_3432690_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185290.1|3432855_3433401_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635545.1|3433397_3433820_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239192.1|3433833_3434544_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_001260712.1|3435575_3437294_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094011.1|3437405_3438113_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|3438109_3438514_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|3438631_3439447_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|3439486_3440140_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|3440132_3441164_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140175.1|3441351_3441927_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997049.1|3447685_3448489_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.2e-38
WP_000648576.1|3448485_3449400_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|3449640_3450441_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211726.1|3450518_3451289_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|3451336_3452695_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052707.1|3452766_3453522_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|3453555_3454278_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|3454274_3454742_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|3454806_3455538_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_001086143.1|3456073_3456859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|3456995_3457475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|3457484_3458399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|3458442_3458925_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087588.1|3458948_3460301_-	membrane protein	NA	NA	NA	NA	NA
WP_122985860.1|3460311_3463746_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240530.1|3463854_3465267_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088862.1|3465271_3466015_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_000614366.1|3466011_3468777_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.9	1.4e-81
WP_000343298.1|3468785_3469547_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073553630.1|3469551_3470883_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|3470885_3471410_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113721.1|3471406_3472687_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|3472711_3473794_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|3473757_3475608_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611742.1|3475611_3476025_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|3476031_3477507_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|3477557_3477782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037391.1|3477816_3478317_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|3479013_3479532_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103361.1|3479741_3481883_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_000508713.1|3481958_3486452_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.0e-22
WP_000786991.1|3486453_3486711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053264715.1|3487110_3488247_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	3512724	3532433	4821620	integrase	Enterobacteria_phage(33.33%)	21	3513331:3513345	3520265:3520279
WP_000749881.1|3512724_3513780_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
3513331:3513345	attL	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_001285288.1|3514067_3515171_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|3515182_3516436_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_000772644.1|3516791_3518006_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.7	5.7e-133
WP_000035054.1|3518657_3518861_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412541.1|3518860_3519292_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	5.1e-28
WP_001019368.1|3519304_3520138_+	anti-repressor protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000042977.1|3520130_3520313_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
3520265:3520279	attR	ACCGCTGGCGCGTTT	NA	NA	NA	NA
WP_024190170.1|3520306_3521374_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	36.8	8.9e-13
WP_001065738.1|3521366_3521561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001024675.1|3521557_3521821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|3521817_3522039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058739.1|3522031_3522634_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	34.7	5.3e-23
WP_001244110.1|3522646_3525403_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.2	3.0e-299
WP_071597943.1|3525469_3525721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405141.1|3526165_3527632_+	DNA transfer protein p33	NA	B6SCW4	Bacteriophage	52.0	5.7e-111
WP_063082037.1|3527631_3529737_+	hypothetical protein	NA	A0A2I7QQN9	Vibrio_phage	36.0	3.3e-88
WP_016231257.1|3529796_3530234_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	33.1	3.1e-12
WP_071779252.1|3530333_3530516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000098670.1|3531026_3531464_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	37.3	5.1e-15
WP_001528727.1|3531476_3532433_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	42.5	4.2e-62
>prophage 10
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	4155960	4267263	4821620	transposase,terminase,protease,portal,plate,integrase,holin,tRNA,head,tail,capsid	Escherichia_phage(35.0%)	97	4142234:4142252	4236653:4236671
4142234:4142252	attL	GCGCCCATTTTTTCCAGCA	NA	NA	NA	NA
WP_000188180.1|4155960_4157907_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|4157979_4158204_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|4158526_4158847_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|4158877_4161154_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097888.1|4162346_4163330_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.2	2.9e-42
WP_073553819.1|4163326_4166560_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.6	8.2e-62
WP_000415804.1|4166890_4168198_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_000120900.1|4168194_4169118_+	type I-F CRISPR-associated protein Csy2	NA	NA	NA	NA	NA
WP_033560840.1|4169128_4170130_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	39.6	4.0e-47
WP_000350179.1|4170140_4170695_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|4172458_4172677_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|4172961_4173666_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202179.1|4173707_4175429_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	6.4e-21
WP_001043619.1|4175429_4177196_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|4177318_4178284_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|4178828_4179323_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_047081202.1|4179457_4183603_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|4183757_4184369_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_073553829.1|4184379_4185723_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.1e-79
WP_000886683.1|4185813_4187106_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|4187344_4189789_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|4189799_4190417_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534645.1|4190418_4191282_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|4191317_4191944_-	hydrolase	NA	NA	NA	NA	NA
WP_073553830.1|4192258_4193407_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|4193616_4195047_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242678.1|4195047_4195956_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190380.1|4196055_4196646_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_073553831.1|4196727_4197525_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.2	2.3e-21
WP_000023391.1|4197556_4198552_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|4198645_4198957_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|4199061_4199418_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001446416.1|4199595_4200096_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.1e-90
WP_000557709.1|4200159_4200372_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	92.9	8.6e-29
WP_000185628.1|4200386_4200632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000789843.1|4200628_4200919_+	hypothetical protein	NA	M1RZ07	Escherichia_phage	81.7	5.5e-34
WP_053879358.1|4200918_4201143_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	97.3	5.5e-34
WP_032219063.1|4201139_4201415_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	98.9	1.1e-44
WP_073535283.1|4201404_4203690_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_033548893.1|4204049_4204985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|4205324_4206359_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156872.1|4206358_4208131_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_073553575.1|4208335_4209160_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.7	3.9e-133
WP_073553577.1|4209218_4210292_+|capsid	phage major capsid protein, P2 family	capsid	Q94MD1	Enterobacteria_phage	99.2	1.6e-200
WP_024261710.1|4210295_4211039_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	97.6	1.3e-127
WP_000988633.1|4211138_4211648_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_001668220.1|4211647_4211851_+	phage Tail protein X family protein	NA	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123124.1|4211854_4212136_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|4212135_4212633_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_073553578.1|4212647_4213073_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	97.2	1.7e-60
WP_001440152.1|4213458_4213632_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_032263607.1|4213594_4214062_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001001780.1|4214054_4214507_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_073553833.1|4214573_4215209_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.2e-112
WP_000127163.1|4215205_4215553_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_073535280.1|4215557_4216466_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.3e-161
WP_001285325.1|4216458_4216989_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_069904676.1|4216999_4219318_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	66.8	2.4e-212
WP_023281594.1|4219321_4219849_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	95.4	4.4e-90
WP_000382497.1|4219948_4221055_-	hypothetical protein	NA	U5N3F3	Enterobacteria_phage	99.5	3.1e-210
WP_001286716.1|4221355_4222546_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|4222558_4223077_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|4223134_4223410_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|4223442_4223562_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_073535279.1|4223554_4226002_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	98.5	0.0e+00
WP_000978907.1|4226016_4226496_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_073553834.1|4226495_4227659_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.2	1.6e-204
WP_000468308.1|4227740_4227959_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292822.1|4228277_4230560_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_000642546.1|4230614_4231472_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001307086.1|4231877_4233638_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642849.1|4233767_4234460_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|4234658_4235747_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000445231.1|4235817_4237101_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
4236653:4236671	attR	TGCTGGAAAAAATGGGCGC	NA	NA	NA	NA
WP_001295345.1|4237269_4238034_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000125016.1|4238206_4238890_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|4239000_4240674_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|4240833_4241118_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705710.1|4241324_4243589_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|4243625_4245374_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_073553835.1|4245370_4246357_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056503.1|4246393_4247626_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|4247677_4247860_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011590.1|4247856_4248603_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|4248756_4249650_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899591.1|4249626_4250406_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001297198.1|4250541_4251327_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|4251323_4252646_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|4252626_4253331_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572668.1|4253330_4257791_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925997.1|4258051_4259899_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|4260079_4260628_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|4260654_4261302_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000399589.1|4261538_4262519_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000462687.1|4262797_4263988_-	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_000977920.1|4264172_4265261_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|4265862_4267263_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 11
NZ_CP010200	Escherichia coli strain M10, complete genome	4821620	4663795	4725906	4821620	transposase,terminase,lysis,integrase,tRNA,tail	Escherichia_phage(40.38%)	69	4658179:4658195	4702464:4702480
4658179:4658195	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_000628065.1|4663795_4665028_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4665282_4666266_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123720.1|4666743_4668117_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	5.6e-52
WP_001676520.1|4668245_4669181_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|4669232_4670468_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|4670469_4670685_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|4670763_4670973_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|4670965_4671160_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|4671216_4672026_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_073553840.1|4672018_4674619_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|4674720_4674996_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|4675070_4675241_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|4675240_4675462_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|4675903_4676392_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4676388_4676544_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000233809.1|4676554_4676689_-	phage protein	NA	NA	NA	NA	NA
WP_000362155.1|4676943_4677363_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|4677463_4677745_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|4677728_4678154_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|4678225_4679296_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_001151151.1|4679336_4679759_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001676522.1|4680099_4682097_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_073553841.1|4682160_4683438_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019009.1|4683568_4684450_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957772.1|4684446_4685139_-	calcium transporter ChaC	NA	NA	NA	NA	NA
WP_001117227.1|4685150_4686350_-	MFS transporter	NA	NA	NA	NA	NA
WP_122986749.1|4686636_4686855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122056959.1|4686861_4686969_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	1.1e-08
WP_000882656.1|4687013_4687226_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	75.7	3.0e-21
WP_000940319.1|4687694_4688294_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|4688293_4688584_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|4688580_4689123_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_085948316.1|4689409_4690683_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000506936.1|4691503_4691932_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|4692103_4692478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|4692729_4692945_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001351713.1|4692944_4693442_+	lysozyme	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_001228688.1|4693658_4693844_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001097895.1|4694040_4695498_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291094.1|4695635_4696427_+	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|4696419_4697352_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|4697329_4697539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089447.1|4697542_4698637_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.5	5.9e-113
WP_000625348.1|4698617_4699919_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_073553843.1|4699921_4701328_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	2.6e-185
WP_001351715.1|4701311_4702424_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	4.2e-114
WP_000770042.1|4702528_4703293_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
4702464:4702480	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|4703391_4704531_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|4704753_4705149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073553844.1|4705148_4705532_+	glutamate 5-kinase	NA	A0A0P0I456	Acinetobacter_phage	39.4	1.7e-14
WP_025492053.1|4705532_4705913_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|4705909_4706302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073553845.1|4706328_4707291_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.8	2.2e-55
WP_012565075.1|4707441_4707801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|4707908_4708109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001722866.1|4708274_4711508_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	1.8e-112
WP_000024051.1|4711500_4711839_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_073553846.1|4711838_4712537_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	1.1e-133
WP_000194783.1|4712542_4713286_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_000090895.1|4713222_4713855_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_073553847.1|4713914_4717412_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	98.0	0.0e+00
WP_065203509.1|4717482_4718082_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	95.5	3.5e-107
WP_073553848.1|4718146_4721425_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_001351719.1|4721424_4722000_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.2e-101
WP_000078178.1|4722097_4722688_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4723004_4723238_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4723306_4723420_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001082294.1|4724197_4724632_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|4724772_4725906_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
