The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	82406	87719	5145749	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_049590476.1|82406_83198_+	BRO family, N-terminal domain protein	NA	Q6J1W3	Lactobacillus_phage	31.3	3.7e-08
WP_172944258.1|83720_84584_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.0e-75
WP_000410600.1|84559_85066_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	2.5e-10
WP_073519873.1|85133_85781_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	3.5e-20
WP_000624622.1|85780_86128_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_073527988.1|86147_87719_+|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	1.3e-169
>prophage 2
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	839302	959500	5145749	holin,coat,head,capsid,integrase,portal,lysis,protease,tail,terminase	Escherichia_phage(38.32%)	153	864049:864071	922223:922245
WP_000156526.1|839302_841063_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|841248_841701_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|841776_842817_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|843173_843683_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|843901_844531_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875044.1|844493_846656_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261231.1|846665_847112_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420533.1|847234_849289_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|849320_849779_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847783.1|849874_850537_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001301418.1|850709_851123_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001358373.1|851167_851485_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116297.1|851542_852733_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|852827_853106_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|853102_853432_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|853522_854182_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_073519722.1|854589_855609_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	4.9e-85
WP_021564129.1|855577_855829_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073519721.1|855895_858367_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.1	2.2e-59
WP_073519720.1|858460_858652_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000449196.1|858648_858837_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|859398_859632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519719.1|859609_860017_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.0	3.0e-09
WP_001171942.1|860039_860258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519718.1|860329_860629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003379.1|860879_861287_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|861364_861592_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_073519717.1|861575_862127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123006575.1|862098_863139_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_157896686.1|863050_863593_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_073519871.1|863622_864018_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	54.3	2.4e-32
864049:864071	attL	CTGGCATTCGCATCAAAGGAGAG	NA	NA	NA	NA
WP_077897935.1|864075_864432_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_172944232.1|864524_864698_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	94.7	5.2e-24
WP_000753060.1|864699_864876_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_073519714.1|864872_865475_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	72.3	3.1e-55
WP_172944234.1|865683_865989_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.9	4.3e-37
WP_073519713.1|865990_866200_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.3	3.7e-32
WP_073519712.1|866196_866862_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	48.9	1.0e-51
WP_073519711.1|866861_867257_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.6e-36
WP_073519710.1|867468_867681_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	5.1e-21
WP_073519709.1|867901_868162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519708.1|868454_869501_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.0e-109
WP_073519707.1|869513_869873_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.4e-39
WP_073519706.1|869869_870559_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	1.4e-59
WP_001351476.1|871836_872229_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.9	1.0e-54
WP_073519705.1|872218_872494_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	92.3	1.7e-40
WP_073519704.1|872496_872874_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
WP_164997238.1|872915_873071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542813.1|873245_873542_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	1.5e-50
WP_073519703.1|873624_873927_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	86.0	3.8e-46
WP_073519702.1|874013_874214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|874221_874572_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_038354741.1|874718_875201_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	2.7e-86
WP_001140897.1|875200_876958_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_069904030.1|876969_877152_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	4.8e-20
WP_073519701.1|877151_878393_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	3.6e-231
WP_001193625.1|878370_879021_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_073519700.1|879034_880261_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	99.1	1.1e-187
WP_065228207.1|880305_880623_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.5	4.8e-23
WP_001147815.1|880631_880970_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	91.1	1.2e-51
WP_172944233.1|880969_881416_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.7	8.7e-63
WP_073519698.1|881412_881757_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	8.8e-55
WP_059215647.1|881817_882522_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	95.7	1.9e-117
WP_016231754.1|882536_882908_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	95.9	5.2e-61
WP_059215648.1|882931_883210_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.7	1.8e-42
WP_073528046.1|883256_886484_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.4	0.0e+00
WP_001330090.1|886461_886818_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_073519696.1|886817_887516_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	2.4e-131
WP_073519869.1|887521_888265_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	6.8e-145
WP_073519695.1|888162_888798_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	74.9	1.7e-83
WP_073519694.1|888858_892242_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.0	0.0e+00
WP_073519693.1|892309_892909_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	9.4e-105
WP_073527995.1|892973_894143_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	64.1	1.9e-32
WP_077897937.1|894126_894693_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	1.8e-28
WP_073519868.1|894685_895069_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	42.1	3.4e-15
WP_001058323.1|896635_897754_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001504149.1|897750_899544_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_073519691.1|899562_900270_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|900266_900854_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063972.1|900850_901249_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|901245_902103_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|902236_903781_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_073519690.1|903792_904929_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|904941_905034_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|905113_906412_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208650.1|906526_908707_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|908726_909173_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000742334.1|910344_912441_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038079.1|912440_913187_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|913183_913828_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|913934_914240_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|914681_914894_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|915179_915392_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071597721.1|915402_915591_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|915565_915796_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|915785_915959_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829658.1|916006_917080_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_073527996.1|919990_921064_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.0	1.0e-197
WP_001303849.1|921041_921260_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_032320906.1|921299_921467_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	94.5	1.4e-26
WP_077897938.1|921567_922218_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	55.6	1.4e-53
WP_073527997.1|922219_922918_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	68.9	2.1e-79
922223:922245	attR	CTCTCCTTTGATGCGAATGCCAG	NA	NA	NA	NA
WP_073527998.1|922919_923219_-	hypothetical protein	NA	G8C7K8	Escherichia_phage	97.0	6.2e-57
WP_097737550.1|923215_923758_-	hypothetical protein	NA	A0A2H4FN96	Salmonella_phage	76.3	7.1e-59
WP_001214456.1|923754_923919_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_001111280.1|923929_924226_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_001016185.1|924242_924791_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.4	1.6e-103
WP_073527999.1|924799_925315_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	93.6	2.8e-73
WP_000018646.1|925311_925779_-	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_073528000.1|925779_926487_-	recombinase	NA	G5DA86	Enterobacteria_phage	99.1	8.5e-137
WP_000050554.1|926495_926666_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|926741_926894_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_073528001.1|926878_927010_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	97.7	1.8e-16
WP_000005785.1|927034_928003_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_073528002.1|928170_928413_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	57.1	7.1e-19
WP_073528003.1|928423_928723_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	94.9	1.6e-28
WP_073528004.1|929494_930145_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	99.5	7.1e-122
WP_000276886.1|930225_930411_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000424164.1|930519_930798_+	lambda phage CII family protein	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_073528005.1|930980_931871_+	DNA replication protein	NA	K7PH45	Enterobacterial_phage	97.3	9.3e-157
WP_149025958.1|931860_933297_+	AAA family ATPase	NA	A0A220NRL4	Escherichia_phage	99.4	3.0e-274
WP_000736903.1|933372_933813_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|933809_934337_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254220.1|934333_934510_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_073528007.1|934512_934914_+	hypothetical protein	NA	G9L690	Escherichia_phage	91.7	2.9e-65
WP_021514114.1|934873_935083_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.0e-30
WP_073528008.1|935075_935798_+	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	99.2	2.7e-130
WP_000002228.1|935797_936088_+	DUF1364 domain-containing protein	NA	K7P7N7	Enterobacteria_phage	100.0	3.4e-52
WP_001008200.1|936084_936447_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|936443_936632_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|936628_937252_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000286100.1|937687_937891_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_073528050.1|937868_938366_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	98.2	7.1e-90
WP_032217736.1|938362_938830_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	94.2	4.8e-72
WP_073528010.1|938880_939069_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	78.7	1.2e-18
WP_000342560.1|939414_939630_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
WP_073528011.1|940021_940201_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	94.9	5.4e-24
WP_000729922.1|940224_940713_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_001404864.1|940690_942190_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
WP_073528012.1|942190_944356_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
WP_000438545.1|944369_945281_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	4.9e-161
WP_073528013.1|945280_946576_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	1.0e-241
WP_073528014.1|946619_947225_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.3	2.7e-59
WP_073528015.1|947202_947703_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	1.1e-90
WP_073528016.1|947702_949121_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.4	1.9e-276
WP_073528017.1|949120_949969_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	4.3e-103
WP_000614037.1|949968_950424_+	DUF2824 family protein	NA	A0A088CQ57	Enterobacteria_phage	99.3	8.8e-87
WP_000964852.1|950426_951119_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.1	3.9e-110
WP_000246949.1|951128_952460_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_073528018.1|952460_954854_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_047667588.1|954943_955204_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.7	1.4e-36
WP_073528019.1|955339_957496_+|head	phage head-binding domain-containing protein	head	Q9AYY6	Salmonella_phage	67.4	2.0e-59
WP_052320192.1|957544_959500_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	30.9	1.5e-66
>prophage 3
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	1734431	1832180	5145749	transposase,holin,head,capsid,integrase,tRNA,portal,lysis,protease,tail,terminase	Escherichia_phage(44.26%)	112	1797758:1797773	1830411:1830426
WP_073519638.1|1734431_1735640_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.0	1.4e-203
WP_000513743.1|1736089_1736278_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|1736281_1736641_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457200.1|1736811_1737450_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|1737576_1738500_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978494.1|1738602_1739688_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_073519637.1|1739938_1741549_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067822.1|1741580_1742705_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001286999.1|1742760_1743726_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001303529.1|1743779_1744895_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|1744976_1746662_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1746866_1747448_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220965.1|1747487_1748183_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1748240_1750151_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1750282_1750627_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1750989_1751349_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1751468_1751648_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1751721_1753083_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|1753086_1753665_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|1753848_1755213_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|1755343_1756942_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_053898130.1|1756945_1758502_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.8	6.0e-42
WP_000150543.1|1758964_1759936_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|1759998_1760799_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|1760811_1761663_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_073519636.1|1761717_1762176_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|1762605_1763172_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010129.1|1763168_1763978_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1764143_1764353_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1764365_1764509_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006865.1|1765178_1765466_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|1765540_1765684_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|1765842_1766082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|1766224_1767016_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127216.1|1767192_1768566_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|1768611_1769493_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001326055.1|1769684_1771733_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
WP_000431370.1|1771752_1772451_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_073519635.1|1772547_1773045_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|1773174_1774458_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|1774426_1777060_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|1777139_1778579_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1778696_1778933_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1779037_1779229_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1779229_1779886_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_077897940.1|1781785_1781968_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_061892726.1|1782253_1782637_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	41.1	1.3e-14
WP_077897937.1|1782629_1783196_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	1.8e-28
WP_077897941.1|1783179_1784349_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	64.1	1.4e-32
WP_001233071.1|1784413_1785013_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_073519634.1|1785083_1788497_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.2	0.0e+00
WP_073519633.1|1789127_1789871_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152619.1|1789876_1790575_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_021528540.1|1790574_1790904_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_073519632.1|1790900_1793480_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.7	0.0e+00
WP_073519631.1|1793472_1793907_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	94.2	2.7e-61
WP_053294703.1|1793888_1794311_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	1.7e-60
WP_061892718.1|1794326_1795067_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_061892716.1|1795074_1795470_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	92.4	1.7e-65
WP_061892715.1|1795466_1796042_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	9.8e-51
WP_073519630.1|1796053_1796407_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	95.7	2.4e-60
WP_061892713.1|1796418_1796799_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	70.0	7.2e-34
WP_073519629.1|1796851_1797880_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.9e-115
1797758:1797773	attL	CAGCATCACCTCTTCG	NA	NA	NA	NA
WP_061892174.1|1797937_1798285_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_073519628.1|1798321_1799827_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.4	2.9e-102
WP_061892172.1|1799816_1801409_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	3.4e-186
WP_061892171.1|1801405_1801609_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.7	9.5e-09
WP_073519627.1|1801592_1803521_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.1e-258
WP_061892169.1|1803492_1804041_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	6.5e-60
WP_073528025.1|1804756_1805149_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_061892323.1|1805460_1805613_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.2e-19
WP_061892324.1|1805600_1806068_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	98.7	7.2e-76
WP_061892325.1|1806064_1806598_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	6.4e-97
WP_073519624.1|1806712_1806973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519623.1|1806920_1807472_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	58.9	1.1e-43
WP_000284506.1|1807475_1807691_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064768310.1|1807768_1808074_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_073519622.1|1809540_1809969_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_073519621.1|1811543_1812086_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	6.4e-76
WP_073519620.1|1812082_1812373_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	1.3e-46
WP_061892354.1|1812372_1812972_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.7e-106
WP_000411312.1|1813043_1813256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818163.1|1813479_1813965_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119355.1|1813983_1814163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1814371_1814584_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_073519618.1|1814817_1815213_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.8	2.3e-38
WP_073519617.1|1815209_1815728_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	48.8	6.8e-35
WP_073519448.1|1816008_1817028_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_073528026.1|1817132_1817390_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.8e-28
WP_073519615.1|1817911_1818112_-	hypothetical protein	NA	K7P729	Enterobacteria_phage	71.2	7.9e-16
WP_073519614.1|1818108_1818531_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	6.3e-63
WP_073519613.1|1818546_1819308_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	2.8e-117
WP_073519612.1|1819330_1820077_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.1e-114
WP_073519611.1|1820083_1821214_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.5	2.5e-42
WP_000702025.1|1821291_1821714_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001033914.1|1821710_1821953_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|1822049_1822469_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000232638.1|1822768_1822987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001419881.1|1822952_1823147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519610.1|1823676_1823898_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	93.2	1.3e-35
WP_000245528.1|1823891_1824068_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_001452559.1|1824142_1824418_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_021527613.1|1824516_1827150_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	58.1	2.9e-206
WP_000166317.1|1827142_1827952_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1828008_1828203_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1828195_1828384_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001311878.1|1828490_1828772_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|1828737_1829814_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|1830206_1830548_-	YebY family protein	NA	NA	NA	NA	NA
1830411:1830426	attR	CAGCATCACCTCTTCG	NA	NA	NA	NA
WP_000879280.1|1830560_1831433_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1831436_1831811_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1831949_1832180_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 4
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	2158274	2166583	5145749		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001317947.1|2158274_2160275_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2160399_2160861_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2160901_2161372_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2161418_2162138_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2162134_2163820_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2164041_2164773_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2164832_2164940_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2164920_2165652_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|2165656_2166583_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 5
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	2373328	2418269	5145749	holin,head,capsid,integrase,tRNA,portal,plate,tail,terminase	Enterobacteria_phage(86.36%)	55	2369490:2369513	2414818:2414841
2369490:2369513	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_001283590.1|2373328_2374141_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2374140_2375154_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|2375219_2376377_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_000023402.1|2376535_2377540_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|2377636_2377957_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|2378070_2378358_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_073519573.1|2378364_2378571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021579104.1|2378823_2379165_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	2.5e-54
WP_044788547.1|2379175_2379463_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000514277.1|2379474_2379717_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2379713_2379827_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2379912_2380116_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2380112_2380358_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_021579106.1|2380354_2380654_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	6.2e-41
WP_001326016.1|2380665_2381283_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_073519572.1|2381279_2381645_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_021579107.1|2381651_2384474_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_000686499.1|2384550_2385510_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|2385514_2385826_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289966.1|2385889_2386480_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_001705841.1|2386970_2388017_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_000613781.1|2388016_2389768_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262673.1|2389922_2390759_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_021533064.1|2390782_2391835_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	2.5e-193
WP_000632362.1|2391880_2392681_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_000063094.1|2392782_2393277_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000864897.1|2393276_2393477_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2393479_2393803_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072335.1|2393799_2394192_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_021511916.1|2394188_2394596_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	7.7e-66
WP_000920594.1|2394733_2395201_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_001705834.1|2395193_2395829_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_077631957.1|2395840_2396407_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-99
WP_001067548.1|2396424_2396754_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001512968.1|2396757_2397654_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.9e-155
WP_021293091.1|2397646_2398177_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_047084517.1|2398179_2400291_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	9.7e-112
WP_073519571.1|2400290_2400890_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	5.9e-99
WP_001100987.1|2400984_2402163_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979954.1|2402259_2402748_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_071685921.1|2402760_2405568_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	88.2	0.0e+00
WP_000333495.1|2405554_2405710_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|2405718_2406084_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2406138_2406651_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_073519570.1|2406650_2407835_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	6.4e-222
WP_000132808.1|2407992_2409102_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_000060706.1|2409274_2410345_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2410429_2410690_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2410881_2411022_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_042094562.1|2411257_2411455_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042094563.1|2411399_2412191_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	7.4e-65
WP_000615821.1|2412420_2413416_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2413412_2414591_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2414883_2416104_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
2414818:2414841	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000683799.1|2416262_2418269_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	2801693	2808833	5145749		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2801693_2804255_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141314.1|2804360_2805017_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001297141.1|2805067_2805835_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2806030_2806939_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2806935_2808198_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2808194_2808833_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	3941315	4020938	5145749	integrase,protease,tRNA,transposase	Stx2-converting_phage(36.84%)	52	3941891:3941906	3968403:3968418
WP_052979121.1|3941315_3942005_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
3941891:3941906	attL	TCCGGTGCTGGCGAAA	NA	NA	NA	NA
WP_000678446.1|3942010_3944092_+	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_000747337.1|3944076_3944943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468836.1|3944945_3946151_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001295238.1|3946430_3947822_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
WP_073519421.1|3947942_3949652_+	AsmA family protein	NA	NA	NA	NA	NA
WP_000702901.1|3949704_3952023_-	alpha-xylosidase	NA	NA	NA	NA	NA
WP_000834439.1|3952032_3953415_-	glycoside-pentoside-hexuronide family transporter	NA	NA	NA	NA	NA
WP_021537648.1|3954101_3955283_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.7	1.1e-162
WP_073519419.1|3956818_3957655_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077875793.1|3959465_3959723_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_061892129.1|3960837_3961269_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_073519417.1|3962709_3962943_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_073519416.1|3963279_3964056_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172944249.1|3964785_3964986_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	83.1	2.1e-24
WP_073519415.1|3965011_3965371_-	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	85.6	2.6e-49
WP_077897956.1|3965649_3970431_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	39.7	9.4e-155
3968403:3968418	attR	TTTCGCCAGCACCGGA	NA	NA	NA	NA
WP_073519414.1|3970717_3971233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061892122.1|3971704_3971929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077875792.1|3972199_3973855_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_073519847.1|3974292_3974673_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	90.5	1.9e-58
WP_061892120.1|3974669_3975017_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	8.2e-61
WP_149025689.1|3977120_3977900_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.2	6.5e-138
WP_073519411.1|3979647_3980034_-	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_073519410.1|3980094_3980448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897957.1|3980411_3981167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149025688.1|3984886_3986048_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_073519407.1|3986401_3986671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172944248.1|3987039_3987303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519406.1|3987305_3988238_-	hypochlorite stress DNA-binding transcriptional regulator HypT	NA	NA	NA	NA	NA
WP_073519405.1|3988578_3989298_+	amino acid racemase	NA	NA	NA	NA	NA
WP_073519404.1|3989359_3990658_+	anaerobic C4-dicarboxylate transporter	NA	NA	NA	NA	NA
WP_077897958.1|3990811_3991039_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.4	2.8e-17
WP_172944258.1|3991120_3991984_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.0e-75
WP_000410600.1|3991959_3992466_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	2.5e-10
WP_073519873.1|3992533_3993181_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	3.5e-20
WP_000624622.1|3993180_3993528_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_073528038.1|3993547_3995119_+|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	2.1e-167
WP_000826005.1|3996222_3996456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073528039.1|3996452_4006169_-|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	33.8	1.9e-29
WP_073519780.1|4006181_4007954_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_073528040.1|4008175_4008799_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000416158.1|4009553_4010585_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	27.0	1.4e-18
WP_000916811.1|4010855_4011299_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000705927.1|4011314_4011602_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000345349.1|4011614_4012871_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001533773.1|4013086_4013371_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	62.2	1.0e-24
WP_000998352.1|4014818_4016135_-	L-fucose:H+ symporter permease	NA	NA	NA	NA	NA
WP_000350265.1|4016162_4017083_-	ribokinase	NA	NA	NA	NA	NA
WP_001298267.1|4017387_4018170_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073519782.1|4019708_4020167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001445629.1|4020509_4020938_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP010196	Escherichia coli strain M9 chromosome, complete genome	5145749	4413759	4481072	5145749	integrase,protease,tRNA,transposase	Enterobacteria_phage(42.86%)	57	4406549:4406564	4451356:4451371
4406549:4406564	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_085947598.1|4413759_4414921_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000377420.1|4416043_4417330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007262.1|4417326_4421613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000092642.1|4421623_4422472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004904.1|4422474_4423632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000323666.1|4423621_4425307_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001358348.1|4425443_4425857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001022619.1|4425853_4427323_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001218329.1|4427523_4428789_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_170979708.1|4429004_4429229_-|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	9.8e-23
WP_001544037.1|4429554_4431888_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_073519814.1|4431902_4432223_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459291.1|4432358_4432814_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|4432806_4433094_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_032226384.1|4433086_4433641_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001149160.1|4433637_4433904_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_024215847.1|4434456_4435191_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.1	7.4e-128
WP_000638629.1|4435187_4435688_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4435761_4436334_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000094232.1|4436535_4437225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772670.1|4440189_4441446_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.6	2.4e-73
WP_001349988.1|4441889_4442909_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.1e-44
WP_000896734.1|4442912_4443476_-	gluconokinase	NA	NA	NA	NA	NA
WP_001197416.1|4443692_4444724_+	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000998695.1|4444747_4445512_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001128335.1|4445576_4446896_+	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_001349989.1|4446962_4447961_+	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001294556.1|4448038_4449541_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	3.9e-83
WP_001295681.1|4449659_4450742_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_000584114.1|4450741_4451842_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
4451356:4451371	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_000397144.1|4452108_4453620_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|4453753_4454197_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416382.1|4454196_4457052_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_073519815.1|4457107_4458304_-	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_001059422.1|4458496_4459000_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4459045_4459462_-	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_000012907.1|4459623_4460628_+	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_001309158.1|4460728_4460959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001368705.1|4460945_4462289_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000583470.1|4462411_4462864_-	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000256656.1|4463008_4463602_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000500725.1|4463672_4464386_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000230281.1|4464516_4464912_+	RidA family protein	NA	NA	NA	NA	NA
WP_001296693.1|4465192_4465327_+	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000013042.1|4465330_4466266_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	3.8e-52
WP_000148581.1|4466278_4466740_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|4466812_4467199_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000399648.1|4467475_4468456_+|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000471866.1|4468683_4471380_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|4471520_4471574_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181332.1|4471758_4472706_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	6.0e-13
WP_001297258.1|4472824_4474246_+	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001358354.1|4474295_4475951_+	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_000187791.1|4476344_4478483_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001106217.1|4478641_4479106_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	60.4	6.5e-53
WP_001232240.1|4479150_4479537_-	cytochrome b562	NA	NA	NA	NA	NA
WP_001162171.1|4479719_4481072_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 1
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	0	1501	146524		Morganella_phage(50.0%)	2	NA	NA
WP_073519984.1|818_1256_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
WP_073519983.1|1252_1501_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
>prophage 2
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	9479	17968	146524		Pectobacterium_phage(16.67%)	12	NA	NA
WP_160537948.1|9479_9734_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	47.5	1.5e-11
WP_154813206.1|9910_10132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157920373.1|10196_10346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519975.1|10416_10974_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	4.3e-51
WP_073519974.1|11025_11268_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_073519973.1|11337_13335_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.1e-21
WP_097455818.1|13375_13810_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_073519971.1|14532_14847_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	35.7	6.4e-12
WP_073519970.1|15056_15218_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_171769349.1|15391_15766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519969.1|16658_17003_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	51.5	9.1e-20
WP_073519968.1|17146_17968_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.4	2.0e-44
>prophage 3
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	25757	25979	146524		Escherichia_phage(100.0%)	1	NA	NA
WP_073519957.1|25757_25979_+	conjugal transfer protein TraR	NA	A0A0F7LDI3	Escherichia_phage	38.9	1.7e-06
>prophage 4
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	52409	53144	146524		Xanthomonas_phage(100.0%)	1	NA	NA
WP_073519934.1|52409_53144_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.3	5.9e-08
>prophage 5
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	56327	57413	146524		Escherichia_phage(100.0%)	1	NA	NA
WP_077897982.1|56327_57413_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	58.5	5.0e-112
>prophage 6
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	66789	69721	146524		Bacillus_phage(50.0%)	2	NA	NA
WP_073519925.1|66789_68943_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.0	3.4e-27
WP_073519924.1|68986_69721_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	28.1	3.2e-06
>prophage 7
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	80020	82210	146524		Bacillus_phage(100.0%)	1	NA	NA
WP_073519912.1|80020_82210_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	5.8e-27
>prophage 8
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	85918	86497	146524		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001400936.1|85918_86497_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	40.2	1.2e-27
>prophage 9
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	91711	100428	146524		Enterobacteria_phage(33.33%)	4	NA	NA
WP_073528053.1|91711_95815_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.0	0.0e+00
WP_095374788.1|97154_98348_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_073519905.1|98572_99211_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	2.8e-54
WP_073519904.1|99195_100428_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.4	6.3e-63
>prophage 10
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	103441	104197	146524		Escherichia_phage(100.0%)	1	NA	NA
WP_187655892.1|103441_104197_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	3.6e-133
>prophage 11
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	114737	118667	146524		Enterobacteria_phage(100.0%)	1	NA	NA
WP_073519890.1|114737_118667_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.0	5.3e-212
>prophage 12
NZ_CP010197	Escherichia coli strain M9 plasmid A, complete sequence	146524	124633	134079	146524	transposase,integrase	Enterobacteria_phage(50.0%)	8	113398:113411	130564:130577
113398:113411	attL	GCATCTCTCCGGCA	NA	NA	NA	NA
WP_073519885.1|124633_125374_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	1.7e-23
WP_000361618.1|125658_126636_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.0e-100
WP_001270417.1|127564_127852_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_001132895.1|127848_128100_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032334873.1|128264_128477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817644.1|128850_130056_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000756325.1|130052_131015_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.6	6.1e-114
130564:130577	attR	GCATCTCTCCGGCA	NA	NA	NA	NA
WP_073519881.1|132933_134079_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	96.2	3.8e-219
