The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	82406	87719	5146228	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_049590476.1|82406_83198_+	BRO family, N-terminal domain protein	NA	Q6J1W3	Lactobacillus_phage	31.3	3.7e-08
WP_172944258.1|83720_84584_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.0e-75
WP_000410600.1|84559_85066_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	2.5e-10
WP_073519873.1|85133_85781_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	45.2	3.5e-20
WP_000624622.1|85780_86128_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_073519772.1|86147_87719_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	59.1	2.4e-168
>prophage 2
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	839303	959501	5146228	lysis,head,holin,coat,capsid,terminase,integrase,protease,tail,portal	Escherichia_phage(38.32%)	153	864050:864072	922224:922246
WP_000156526.1|839303_841064_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000877161.1|841249_841702_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_000750416.1|841777_842818_-	porin OmpA	NA	NA	NA	NA	NA
WP_000288710.1|843174_843684_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_000839153.1|843902_844532_+	CRP-S regulon transcriptional coactivator Sxy	NA	NA	NA	NA	NA
WP_000875044.1|844494_846657_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001261231.1|846666_847113_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000420533.1|847235_849290_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
WP_000424181.1|849321_849780_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_000847783.1|849875_850538_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_001301418.1|850710_851124_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_001358373.1|851168_851486_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_000116297.1|851543_852734_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000048252.1|852828_853107_+	acylphosphatase	NA	NA	NA	NA	NA
WP_000904442.1|853103_853433_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000375136.1|853523_854183_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
WP_073519722.1|854590_855610_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	4.9e-85
WP_021564129.1|855578_855830_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073519721.1|855896_858368_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	59.1	2.2e-59
WP_073519720.1|858461_858653_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000449196.1|858649_858838_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000920491.1|859399_859633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519719.1|859610_860018_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	40.0	3.0e-09
WP_001171942.1|860040_860259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519718.1|860330_860630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003379.1|860880_861288_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|861365_861593_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_073519717.1|861576_862128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123006575.1|862099_863140_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_157896686.1|863051_863594_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_073519871.1|863623_864019_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	54.3	2.4e-32
864050:864072	attL	CTGGCATTCGCATCAAAGGAGAG	NA	NA	NA	NA
WP_077897935.1|864076_864433_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.4e-58
WP_172944232.1|864525_864699_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	94.7	5.2e-24
WP_000753060.1|864700_864877_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_073519714.1|864873_865476_+	ead/Ea22-like family protein	NA	A0A0F6R7P8	Escherichia_coli_O157_typing_phage	72.3	3.1e-55
WP_172944234.1|865684_865990_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	78.9	4.3e-37
WP_073519713.1|865991_866201_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	91.3	3.7e-32
WP_073519712.1|866197_866863_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	48.9	1.0e-51
WP_073519711.1|866862_867258_+	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	60.5	1.6e-36
WP_073519710.1|867469_867682_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	5.1e-21
WP_073519709.1|867902_868163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519708.1|868455_869502_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	5.0e-109
WP_073519707.1|869514_869874_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	1.4e-39
WP_073519706.1|869870_870560_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.2	1.4e-59
WP_001351476.1|871837_872230_+|holin	holin	holin	Q8W636	Enterobacteria_phage	96.9	1.0e-54
WP_073519705.1|872219_872495_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	92.3	1.7e-40
WP_073519704.1|872497_872875_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	2.5e-63
WP_164997238.1|872916_873072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542813.1|873246_873543_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	98.0	1.5e-50
WP_073519703.1|873625_873928_+	hypothetical protein	NA	Q8HA83	Salmonella_phage	86.0	3.8e-46
WP_073519702.1|874014_874215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|874222_874573_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_038354741.1|874719_875202_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	99.4	2.7e-86
WP_001140897.1|875201_876959_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_069904030.1|876970_877153_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	81.7	4.8e-20
WP_073519701.1|877152_878394_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	94.7	3.6e-231
WP_001193625.1|878371_879022_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	100.0	6.0e-121
WP_073519700.1|879035_880262_+|capsid	phage major capsid protein	capsid	Q8W627	Enterobacteria_phage	99.1	1.1e-187
WP_065228207.1|880306_880624_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	51.5	4.8e-23
WP_001147815.1|880632_880971_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	91.1	1.2e-51
WP_172944233.1|880970_881417_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	79.7	8.7e-63
WP_073519698.1|881413_881758_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	8.8e-55
WP_059215647.1|881818_882523_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	95.7	1.9e-117
WP_016231754.1|882537_882909_+|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	95.9	5.2e-61
WP_059215648.1|882932_883211_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.7	1.8e-42
WP_073528046.1|883257_886485_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.4	0.0e+00
WP_001330090.1|886462_886819_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_073519696.1|886818_887517_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	2.4e-131
WP_073519869.1|887522_888266_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.9	6.8e-145
WP_073519695.1|888163_888799_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	74.9	1.7e-83
WP_073546131.1|888859_892243_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	87.2	0.0e+00
WP_073519693.1|892310_892910_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	9.4e-105
WP_073527995.1|892974_894144_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	64.1	1.9e-32
WP_077898612.1|894127_894694_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	3.0e-28
WP_073519868.1|894686_895070_+	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	42.1	3.4e-15
WP_001058323.1|896636_897755_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001504149.1|897751_899545_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_073519691.1|899563_900271_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003671.1|900267_900855_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_000063972.1|900851_901250_+	hydrogenase-1 operon protein HyaE	NA	NA	NA	NA	NA
WP_000004899.1|901246_902104_+	hydrogenase expression/formation protein	NA	NA	NA	NA	NA
WP_000263563.1|902237_903782_+	cytochrome bd-II oxidase subunit 1	NA	NA	NA	NA	NA
WP_073519690.1|903793_904930_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_000270305.1|904942_905035_+	cytochrome bd-II oxidase subunit CbdX	NA	NA	NA	NA	NA
WP_001297112.1|905114_906413_+	bifunctional acid phosphatase/4-phytase	NA	NA	NA	NA	NA
WP_000208650.1|906527_908708_-	tyrosine-protein kinase	NA	NA	NA	NA	NA
WP_000057871.1|908727_909174_-	protein-tyrosine-phosphatase Etp	NA	NA	NA	NA	NA
WP_000742334.1|910345_912442_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001038079.1|912441_913188_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001247610.1|913184_913829_-	lipoprotein GfcB	NA	NA	NA	NA	NA
WP_001295358.1|913935_914241_-	threonine-rich inner membrane protein GfcA	NA	NA	NA	NA	NA
WP_000087763.1|914682_914895_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|915180_915393_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071597721.1|915403_915592_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001316982.1|915566_915797_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|915786_915960_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829658.1|916007_917081_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_073527996.1|919991_921065_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	98.0	1.0e-197
WP_001303849.1|921042_921261_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_032320906.1|921300_921468_-	hypothetical protein	NA	K7P728	Enterobacteria_phage	94.5	1.4e-26
WP_077897938.1|921568_922219_-	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	55.6	1.4e-53
WP_073527997.1|922220_922919_-	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	68.9	2.1e-79
922224:922246	attR	CTCTCCTTTGATGCGAATGCCAG	NA	NA	NA	NA
WP_073527998.1|922920_923220_-	hypothetical protein	NA	G8C7K8	Escherichia_phage	97.0	6.2e-57
WP_097737550.1|923216_923759_-	hypothetical protein	NA	A0A2H4FN96	Salmonella_phage	76.3	7.1e-59
WP_001214456.1|923755_923920_-	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	100.0	1.1e-23
WP_001111280.1|923930_924227_-	DUF2856 family protein	NA	A0A220NRR0	Escherichia_phage	100.0	2.3e-51
WP_001016185.1|924243_924792_-	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.4	1.6e-103
WP_073527999.1|924800_925316_-	single-stranded DNA-binding protein	NA	A0A220NRQ8	Escherichia_phage	93.6	2.8e-73
WP_000018646.1|925312_925780_-	HNH endonuclease	NA	A0A2I7QWC6	Vibrio_phage	62.0	1.2e-46
WP_073528000.1|925780_926488_-	recombinase	NA	G5DA86	Enterobacteria_phage	99.1	8.5e-137
WP_000050554.1|926496_926667_-	hypothetical protein	NA	K7PJW0	Enterobacteria_phage	100.0	3.0e-24
WP_001243355.1|926742_926895_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_073528001.1|926879_927011_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	97.7	1.8e-16
WP_000005785.1|927035_928004_-	hypothetical protein	NA	G5DA88	Enterobacteria_phage	100.0	7.7e-56
WP_073528002.1|928171_928414_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	57.1	7.1e-19
WP_073528003.1|928424_928724_-	hypothetical protein	NA	A5VW99	Enterobacteria_phage	94.9	1.6e-28
WP_073528004.1|929495_930146_-	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	99.5	7.1e-122
WP_000276886.1|930226_930412_+	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000424164.1|930520_930799_+	lambda phage CII family protein	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_073528005.1|930981_931872_+	DNA replication protein	NA	K7PH45	Enterobacterial_phage	97.3	9.3e-157
WP_149025958.1|931861_933298_+	AAA family ATPase	NA	A0A220NRL4	Escherichia_phage	99.4	3.0e-274
WP_000736903.1|933373_933814_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|933810_934338_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254220.1|934334_934511_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	100.0	2.7e-28
WP_073528007.1|934513_934915_+	hypothetical protein	NA	G9L690	Escherichia_phage	91.7	2.9e-65
WP_021514114.1|934874_935084_+	protein ninF	NA	G9L691	Escherichia_phage	97.1	2.0e-30
WP_073528008.1|935076_935799_+	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	99.2	2.7e-130
WP_000002228.1|935798_936089_+	DUF1364 domain-containing protein	NA	K7P7N7	Enterobacteria_phage	100.0	3.4e-52
WP_001008200.1|936085_936448_+	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	100.0	9.2e-63
WP_000994516.1|936444_936633_+	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001235461.1|936629_937253_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_000286100.1|937688_937892_+|holin	phage holin family protein	holin	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_073528050.1|937869_938367_+	lysozyme RrrD	NA	I6R0P2	Salmonella_phage	98.2	7.1e-90
WP_032217736.1|938363_938831_+|lysis	lysis protein	lysis	A0A192Y689	Salmonella_phage	94.2	4.8e-72
WP_073528010.1|938881_939070_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	78.7	1.2e-18
WP_000342560.1|939415_939631_+	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	75.7	3.1e-26
WP_073528011.1|940022_940202_+	hypothetical protein	NA	Q9AZ02	Salmonella_phage	94.9	5.4e-24
WP_000729922.1|940225_940714_+	DNA-packaging protein	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_001404864.1|940691_942191_+|terminase	terminase large subunit	terminase	A0A2D1GLW6	Escherichia_phage	99.8	2.4e-306
WP_073528012.1|942191_944357_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	99.9	0.0e+00
WP_000438545.1|944370_945282_+	scaffold protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	4.9e-161
WP_073528013.1|945281_946577_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.8	1.0e-241
WP_073528014.1|946620_947226_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	62.3	2.7e-59
WP_073528015.1|947203_947704_+	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	99.4	1.1e-90
WP_073528016.1|947703_949122_+	packaged DNA stabilization protein gp10	NA	A0A2D1GM00	Escherichia_phage	99.4	1.9e-276
WP_073528017.1|949121_949970_+	hypothetical protein	NA	Q716G6	Shigella_phage	98.6	4.3e-103
WP_000614037.1|949969_950425_+	DUF2824 family protein	NA	A0A088CQ57	Enterobacteria_phage	99.3	8.8e-87
WP_000964852.1|950427_951120_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.1	3.9e-110
WP_000246949.1|951129_952461_+	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	99.8	3.1e-217
WP_073528018.1|952461_954855_+	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_047667588.1|954944_955205_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	97.7	1.4e-36
WP_073528019.1|955340_957497_+|head	phage head-binding domain-containing protein	head	Q9AYY6	Salmonella_phage	67.4	2.0e-59
WP_052320192.1|957545_959501_-	acyltransferase	NA	A0A193GZ69	Enterobacter_phage	30.9	1.5e-66
>prophage 3
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	1734886	1832641	5146228	lysis,head,holin,tRNA,capsid,transposase,terminase,integrase,protease,tail,portal	Escherichia_phage(43.55%)	111	1798218:1798233	1830872:1830887
WP_073546133.1|1734886_1736095_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.3	1.6e-204
WP_049090741.1|1736102_1736534_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	1.8e-41
WP_000513743.1|1736549_1736738_-	DUF1869 domain-containing protein	NA	NA	NA	NA	NA
WP_000939317.1|1736741_1737101_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000457200.1|1737271_1737910_-	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_001061578.1|1738036_1738960_-	DNA-binding transcriptional regulator DmlR	NA	NA	NA	NA	NA
WP_000978494.1|1739062_1740148_+	multifunctional D-malate/3-isopropylmalate/tartarate dehydrogenase	NA	NA	NA	NA	NA
WP_073519637.1|1740398_1742009_+	BCCT family transporter YeaV	NA	NA	NA	NA	NA
WP_000067822.1|1742040_1743165_+	carnitine monooxygenase subunit YeaW	NA	NA	NA	NA	NA
WP_001286999.1|1743220_1744186_+	carnitine monooxygenase subunit YeaX	NA	NA	NA	NA	NA
WP_001303529.1|1744239_1745355_-	ribonuclease D	NA	NA	NA	NA	NA
WP_000758422.1|1745436_1747122_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1747326_1747908_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220965.1|1747947_1748643_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1748700_1750611_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1750742_1751087_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|1751449_1751809_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1751928_1752108_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1752181_1753543_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000456725.1|1753546_1754125_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624298.1|1754308_1755673_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001295494.1|1755803_1757402_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_053898130.1|1757405_1758962_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.8	6.0e-42
WP_000150543.1|1759424_1760396_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406926.1|1760458_1761259_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000228655.1|1761271_1762123_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_073519636.1|1762177_1762636_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001296134.1|1763065_1763632_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010129.1|1763628_1764438_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_001062678.1|1764603_1764813_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001295496.1|1764825_1764969_-	YobF family protein	NA	NA	NA	NA	NA
WP_001006865.1|1765638_1765926_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714550.1|1766000_1766144_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001211011.1|1766302_1766542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262174.1|1766684_1767476_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_001127216.1|1767652_1769026_+	MFS transporter	NA	NA	NA	NA	NA
WP_000984517.1|1769071_1769953_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001326055.1|1770144_1772193_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.3	1.2e-85
WP_000431370.1|1772212_1772911_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_073519635.1|1773007_1773505_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001207284.1|1773634_1774918_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001299674.1|1774886_1777520_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
WP_000057022.1|1777599_1779039_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|1779156_1779393_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|1779497_1779689_+	YebW family protein	NA	NA	NA	NA	NA
WP_000812724.1|1779689_1780346_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_077897940.1|1782245_1782428_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_061892726.1|1782713_1783097_-	DUF1353 domain-containing protein	NA	A0A0A8J9K3	Ralstonia_phage	41.1	1.3e-14
WP_077898612.1|1783089_1783656_-	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	42.2	3.0e-28
WP_077897941.1|1783639_1784809_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9LA62	Enterobacterial_phage	64.1	1.4e-32
WP_001233071.1|1784873_1785473_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_073546134.1|1785543_1788957_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.1	0.0e+00
WP_073519633.1|1789587_1790331_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	1.2e-146
WP_001152619.1|1790336_1791035_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_021528540.1|1791034_1791364_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	93.6	2.1e-53
WP_073519632.1|1791360_1793940_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	96.7	0.0e+00
WP_073519631.1|1793932_1794367_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	94.2	2.7e-61
WP_053294703.1|1794348_1794771_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	1.7e-60
WP_061892718.1|1794786_1795527_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_061892716.1|1795534_1795930_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	92.4	1.7e-65
WP_061892715.1|1795926_1796502_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	60.2	9.8e-51
WP_073519630.1|1796513_1796867_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	95.7	2.4e-60
WP_061892713.1|1796878_1797259_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	70.0	7.2e-34
WP_073519629.1|1797311_1798340_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.9e-115
1798218:1798233	attL	CAGCATCACCTCTTCG	NA	NA	NA	NA
WP_061892174.1|1798397_1798745_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.2e-21
WP_073519628.1|1798781_1800287_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.4	2.9e-102
WP_061892172.1|1800276_1801869_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	3.4e-186
WP_061892171.1|1801865_1802069_-|tail	phage tail protein	tail	K7PM10	Enterobacteria_phage	55.7	9.5e-09
WP_073519627.1|1802052_1803981_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.1e-258
WP_061892169.1|1803952_1804501_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	6.5e-60
WP_073528025.1|1805216_1805609_+	DUF1398 family protein	NA	NA	NA	NA	NA
WP_061892323.1|1805920_1806073_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	94.0	1.2e-19
WP_061892324.1|1806060_1806528_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	98.7	7.2e-76
WP_061892325.1|1806524_1807058_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.4	6.4e-97
WP_073519623.1|1807380_1807932_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	58.9	1.1e-43
WP_000284506.1|1807935_1808151_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_064768310.1|1808228_1808534_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_073519622.1|1810000_1810429_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_073519621.1|1812003_1812546_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	6.4e-76
WP_073519620.1|1812542_1812833_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	1.3e-46
WP_061892354.1|1812832_1813432_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.7e-106
WP_000411312.1|1813503_1813716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000818163.1|1813939_1814425_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000119355.1|1814443_1814623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|1814831_1815044_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_073519618.1|1815277_1815673_-	hypothetical protein	NA	A0A193GYM6	Enterobacter_phage	62.8	2.3e-38
WP_073519617.1|1815669_1816188_-	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	48.8	6.8e-35
WP_073528026.1|1817593_1817851_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	88.9	1.8e-28
WP_073519615.1|1818372_1818573_-	hypothetical protein	NA	K7P729	Enterobacteria_phage	71.2	7.9e-16
WP_073519614.1|1818569_1818992_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.2	6.3e-63
WP_073519613.1|1819007_1819769_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	2.8e-117
WP_073519612.1|1819791_1820538_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	2.1e-114
WP_073519611.1|1820544_1821675_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.5	2.5e-42
WP_000702025.1|1821752_1822175_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	94.3	3.4e-69
WP_001033914.1|1822171_1822414_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|1822510_1822930_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000232638.1|1823229_1823448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001419881.1|1823413_1823608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519610.1|1824137_1824359_+	cell division protein FtsZ	NA	A0A0U2RTC4	Escherichia_phage	93.2	1.3e-35
WP_000245528.1|1824352_1824529_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	93.1	9.7e-26
WP_001452559.1|1824603_1824879_+	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	92.3	3.7e-40
WP_021527613.1|1824977_1827611_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	58.1	2.9e-206
WP_000166317.1|1827603_1828413_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_042853000.1|1828469_1828664_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|1828656_1828845_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_001311878.1|1828951_1829233_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	41.2	1.7e-11
WP_001189091.1|1829198_1830275_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.7	5.3e-98
WP_000976492.1|1830667_1831009_-	YebY family protein	NA	NA	NA	NA	NA
1830872:1830887	attR	CAGCATCACCTCTTCG	NA	NA	NA	NA
WP_000879280.1|1831021_1831894_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1831897_1832272_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1832410_1832641_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
>prophage 4
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	2158735	2167044	5146228		Enterobacteria_phage(83.33%)	9	NA	NA
WP_001317947.1|2158735_2160736_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2160860_2161322_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2161362_2161833_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2161879_2162599_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2162595_2164281_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2164502_2165234_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2165293_2165401_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2165381_2166113_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569329.1|2166117_2167044_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 5
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	2373789	2418730	5146228	head,holin,tRNA,capsid,terminase,integrase,tail,portal,plate	Enterobacteria_phage(86.36%)	55	2369951:2369974	2415279:2415302
2369951:2369974	attL	GATAAGACGCGCCAGCGTCGCATC	NA	NA	NA	NA
WP_001283590.1|2373789_2374602_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289162.1|2374601_2375615_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004833.1|2375680_2376838_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	7.9e-23
WP_000023402.1|2376996_2378001_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	55.7	4.5e-99
WP_001390705.1|2378097_2378418_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	43.2	1.4e-14
WP_000004249.1|2378531_2378819_+	hypothetical protein	NA	A0A0M4RCW1	Salmonella_phage	52.6	4.3e-23
WP_073519573.1|2378825_2379032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021579104.1|2379284_2379626_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	91.4	2.5e-54
WP_044788547.1|2379636_2379924_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000514277.1|2379935_2380178_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021652.1|2380174_2380288_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	97.3	3.3e-11
WP_000985161.1|2380373_2380577_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	86.6	2.9e-26
WP_000153674.1|2380573_2380819_+	winged helix-turn-helix domain-containing protein	NA	A0A0A7NV47	Enterobacteria_phage	98.8	3.3e-40
WP_021579106.1|2380815_2381115_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.8	6.2e-41
WP_001326016.1|2381126_2381744_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.7	5.3e-10
WP_073519572.1|2381740_2382106_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_021579107.1|2382112_2384935_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	96.8	0.0e+00
WP_000686499.1|2385011_2385971_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	2.0e-181
WP_000211289.1|2385975_2386287_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	95.1	1.2e-47
WP_001289966.1|2386350_2386941_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	51.3	3.6e-32
WP_001705841.1|2387431_2388478_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_000613781.1|2388477_2390229_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.9	0.0e+00
WP_001262673.1|2390383_2391220_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_021533064.1|2391243_2392296_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	2.5e-193
WP_000632362.1|2392341_2393142_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.7	1.3e-130
WP_000063094.1|2393243_2393738_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.2	3.0e-88
WP_000864897.1|2393737_2393938_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000104350.1|2393940_2394264_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072335.1|2394260_2394653_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	9.9e-71
WP_021511916.1|2394649_2395057_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	97.8	7.7e-66
WP_000920594.1|2395194_2395662_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_001705834.1|2395654_2396290_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_077631957.1|2396301_2396868_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-99
WP_001067548.1|2396885_2397215_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001512968.1|2397218_2398115_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	3.9e-155
WP_021293091.1|2398107_2398638_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	99.4	5.1e-94
WP_047084517.1|2398640_2400752_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	97.7	9.7e-112
WP_073519571.1|2400751_2401351_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	91.1	5.9e-99
WP_001100987.1|2401445_2402624_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979954.1|2402720_2403209_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.6e-86
WP_071685921.1|2403221_2406029_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	88.2	0.0e+00
WP_000333495.1|2406015_2406171_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665308.1|2406179_2406545_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000290450.1|2406599_2407112_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_073519570.1|2407111_2408296_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	6.4e-222
WP_000132808.1|2408453_2409563_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.6	4.8e-195
WP_000060706.1|2409735_2410806_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_000488107.1|2410890_2411151_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|2411342_2411483_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_042094562.1|2411718_2411916_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042094563.1|2411860_2412652_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	52.1	7.4e-65
WP_000615821.1|2412881_2413877_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127781.1|2413873_2415052_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2415344_2416565_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
2415279:2415302	attR	GATGCGACGCTGGCGCGTCTTATC	NA	NA	NA	NA
WP_000683799.1|2416723_2418730_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	2802156	2809296	5146228		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2802156_2804718_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141314.1|2804823_2805480_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001297141.1|2805530_2806298_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2806493_2807402_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2807398_2808661_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2808657_2809296_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 7
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	3991293	4006651	5146228	transposase,tRNA	Stx2-converting_phage(42.86%)	8	NA	NA
WP_077897958.1|3991293_3991521_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	51.4	2.8e-17
WP_172944258.1|3991602_3992466_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	51.3	3.0e-75
WP_000410600.1|3992441_3992948_-	helix-turn-helix domain-containing protein	NA	A0A1B1P776	Bacillus_phage	32.5	2.5e-10
WP_073519844.1|3993015_3993663_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.1e-21
WP_012904570.1|3993662_3994010_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	3.4e-46
WP_073519403.1|3994029_3995601_+|transposase	IS66-like element ISCro1 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.3	1.2e-167
WP_000826005.1|3996704_3996938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073546136.1|3996934_4006651_-|tRNA	contact-dependent inhibition effector tRNA nuclease	tRNA	A0A0R6PJK4	Moraxella_phage	33.8	1.9e-29
>prophage 8
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	4601766	4660139	5146228	transposase,protease	Pectobacterium_phage(11.11%)	60	NA	NA
WP_000312488.1|4601766_4603026_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4603028_4604033_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4604114_4604312_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4604415_4605714_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|4605918_4606344_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4606382_4608824_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4609003_4609735_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000220137.1|4609861_4610263_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4610281_4610980_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012553.1|4611030_4611690_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547760.1|4611707_4612106_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101649.1|4612115_4612754_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000943987.1|4612756_4613920_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.5	1.7e-81
WP_001339483.1|4614003_4615629_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4615745_4616021_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4616169_4616499_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|4616680_4617430_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4617426_4618182_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4618289_4619354_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4619708_4621106_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218358.1|4621121_4621427_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4621436_4621901_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4621914_4622565_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949539.1|4622574_4623429_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|4623428_4624115_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|4624211_4624763_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4624837_4625113_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4625439_4625835_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4625841_4626156_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4626160_4626388_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4626429_4626879_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4626949_4627744_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4628366_4628798_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_073546139.1|4628805_4630014_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	4.1e-208
WP_001119478.1|4630148_4630787_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4631005_4631626_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4631934_4633347_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4633391_4634054_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_073519817.1|4634161_4635127_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560563.1|4635234_4636095_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_073519816.1|4636183_4636564_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000886909.1|4638824_4639565_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4639554_4640112_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4640436_4640643_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4640704_4642048_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4642370_4643009_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4643214_4644948_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060945.1|4644944_4648724_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4648726_4649068_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001223208.1|4649279_4649531_+	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_000239579.1|4649524_4649875_+	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_000055075.1|4649954_4650485_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000265933.1|4650794_4651751_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000205813.1|4651890_4653393_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001296689.1|4653406_4654429_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4654415_4655411_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4655443_4656442_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219792.1|4656617_4657991_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4658141_4658693_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001162171.1|4658786_4660139_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
>prophage 9
NZ_CP010186	Escherichia coli strain M6 chromosome, complete genome	5146228	4703524	4714005	5146228	integrase	Enterobacteria_phage(80.0%)	12	4695134:4695148	4724119:4724133
4695134:4695148	attL	CTTAGAAAACAAGCT	NA	NA	NA	NA
WP_000446132.1|4703524_4704097_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000638629.1|4704170_4704671_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_024215847.1|4704667_4705402_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.1	7.4e-128
WP_001149160.1|4705954_4706221_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_032226384.1|4706217_4706772_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	80.2	4.0e-41
WP_001244665.1|4706764_4707052_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459291.1|4707044_4707500_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_073519814.1|4707635_4707956_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001544037.1|4707970_4710304_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.7	0.0e+00
WP_170979708.1|4710629_4710854_+|integrase	integrase	integrase	Q38404	Enterobacteria_phage	96.1	9.8e-23
WP_001218329.1|4711069_4712335_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.1	1.1e-81
WP_001022619.1|4712535_4714005_-	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
4724119:4724133	attR	AGCTTGTTTTCTAAG	NA	NA	NA	NA
>prophage 1
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	0	1501	146575		Morganella_phage(50.0%)	2	NA	NA
WP_073519984.1|818_1256_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	1.1e-25
WP_073519983.1|1252_1501_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	46.7	4.1e-14
>prophage 2
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	9479	17968	146575		Pectobacterium_phage(16.67%)	12	NA	NA
WP_160537948.1|9479_9734_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	47.5	1.5e-11
WP_154813206.1|9910_10132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157920373.1|10196_10346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073519975.1|10416_10974_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.0	4.3e-51
WP_073519974.1|11025_11268_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_073519973.1|11337_13335_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.3	1.1e-21
WP_097455818.1|13375_13810_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_073519971.1|14532_14847_+	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	35.7	6.4e-12
WP_073519970.1|15056_15218_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_171769349.1|15391_15766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073519969.1|16658_17003_+	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	51.5	9.1e-20
WP_073519968.1|17146_17968_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	39.4	2.0e-44
>prophage 3
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	25757	25979	146575		Escherichia_phage(100.0%)	1	NA	NA
WP_073519957.1|25757_25979_+	conjugal transfer protein TraR	NA	A0A0F7LDI3	Escherichia_phage	38.9	1.7e-06
>prophage 4
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	52409	53144	146575		Xanthomonas_phage(100.0%)	1	NA	NA
WP_073519934.1|52409_53144_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.3	5.9e-08
>prophage 5
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	56327	57413	146575		Escherichia_phage(100.0%)	1	NA	NA
WP_077897982.1|56327_57413_+	hypothetical protein	NA	H6WZJ9	Escherichia_phage	58.5	5.0e-112
>prophage 6
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	66789	69721	146575		Bacillus_phage(50.0%)	2	NA	NA
WP_073519925.1|66789_68943_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	25.0	3.4e-27
WP_073519924.1|68986_69721_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	28.1	3.2e-06
>prophage 7
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	80020	82210	146575		Bacillus_phage(100.0%)	1	NA	NA
WP_073519912.1|80020_82210_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.6	5.8e-27
>prophage 8
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	91710	100427	146575		Enterobacteria_phage(33.33%)	4	NA	NA
WP_073528053.1|91710_95814_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	45.0	0.0e+00
WP_095374788.1|97153_98347_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_073519905.1|98571_99210_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	50.5	2.8e-54
WP_073519904.1|99194_100427_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.4	6.3e-63
>prophage 9
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	103440	104196	146575		Escherichia_phage(100.0%)	1	NA	NA
WP_187655892.1|103440_104196_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	98.8	3.6e-133
>prophage 10
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	114736	118666	146575		Enterobacteria_phage(100.0%)	1	NA	NA
WP_073519890.1|114736_118666_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	37.0	5.3e-212
>prophage 11
NZ_CP010187	Escherichia coli strain M6 plasmid A, complete sequence	146575	124632	134078	146575	transposase,integrase	Enterobacteria_phage(50.0%)	8	113397:113410	130563:130576
113397:113410	attL	GCATCTCTCCGGCA	NA	NA	NA	NA
WP_073519885.1|124632_125373_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.6	1.7e-23
WP_000361618.1|125657_126635_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	3.0e-100
WP_001270417.1|127563_127851_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	47.4	2.2e-19
WP_001132895.1|127847_128099_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_032334873.1|128263_128476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817644.1|128849_130055_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000756325.1|130051_131014_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.6	6.1e-114
130563:130576	attR	GCATCTCTCCGGCA	NA	NA	NA	NA
WP_073519881.1|132932_134078_+|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	96.2	3.8e-219
