The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	0	15886	4838808		Caulobacter_phage(50.0%)	11	NA	NA
WP_000939262.1|4773_5256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122985282.1|5170_5356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118029.1|7843_8614_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|8767_9241_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973081.1|9283_11728_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|11967_12546_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|12751_13519_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|13489_14230_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615976.1|14385_14664_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729704.1|14666_14927_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000543895.1|15112_15886_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
>prophage 2
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	29754	32712	4838808		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|29754_30150_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_073520410.1|30267_32712_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	42.6	1.6e-33
>prophage 3
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	56231	57371	4838808		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000528869.1|56231_57371_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.7	2.0e-31
>prophage 4
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	62048	72442	4838808	transposase	Streptococcus_phage(40.0%)	9	NA	NA
WP_000749881.1|62048_63104_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|63391_64495_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893255.1|64506_65760_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001111352.1|66076_66487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121354.1|66465_67422_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667063.1|67431_69630_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	3.3e-38
WP_000643328.1|69626_70583_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070697.1|70579_71269_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000019445.1|71461_72442_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
>prophage 5
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	91022	92348	4838808		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046295.1|91022_92348_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 6
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	97924	108400	4838808	holin	Catovirus(33.33%)	5	NA	NA
WP_001159102.1|97924_99595_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089063.1|99608_101081_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001351501.1|101094_101682_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|101810_103844_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_073520563.1|104416_108400_+	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.1	8.4e-125
>prophage 7
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	120394	124932	4838808		Bacillus_virus(50.0%)	4	NA	NA
WP_000447335.1|120394_121879_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.7	8.0e-12
WP_000818900.1|121871_122843_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000750340.1|122839_123796_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000692601.1|123882_124932_+	NADPH-dependent aldehyde reductase YahK	NA	A0A2K9L339	Tupanvirus	45.2	2.8e-72
>prophage 8
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	133308	138903	4838808		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000010284.1|133308_135195_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
WP_000076236.1|135431_136691_+	cytosine permease	NA	NA	NA	NA	NA
WP_001299008.1|136680_137964_+	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000952482.1|138003_138903_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	3.2e-16
>prophage 9
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	142743	147023	4838808		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_039022561.1|142743_145818_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	98.8	0.0e+00
WP_000805910.1|145940_147023_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	99.4	1.1e-191
>prophage 10
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	152433	154394	4838808		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|152433_153384_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|153380_154394_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 11
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	157572	160680	4838808	transposase	Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000842102.1|157572_158682_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
WP_001141271.1|158716_158992_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_085947771.1|159518_160680_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 12
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	165239	166007	4838808		Planktothrix_phage(100.0%)	1	NA	NA
WP_039022571.1|165239_166007_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-25
>prophage 13
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	172900	174058	4838808		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|172900_174058_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 14
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	181473	182589	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000484048.1|181473_182589_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 15
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	186878	196850	4838808		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|186878_187790_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219320.1|187914_188823_+	fructokinase	NA	NA	NA	NA	NA
WP_001345723.1|188965_190150_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_000698907.1|190275_193419_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|193415_194618_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|194807_195497_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893578.1|195554_196850_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
>prophage 16
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	203802	212783	4838808	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_000667319.1|203802_204930_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
WP_000007629.1|204952_205285_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|205312_207160_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|207170_208142_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|208270_208618_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|208794_209679_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001295327.1|209977_210517_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|210667_211117_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150467.1|211120_212224_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	2.0e-52
WP_001021161.1|212312_212783_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 17
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	236615	241662	4838808	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|236615_237239_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|237364_238639_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|238826_241181_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|241389_241662_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 18
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	244790	245486	4838808		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817244.1|244790_245486_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	3.2e-88
>prophage 19
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	248809	252356	4838808		Bacillus_phage(100.0%)	2	NA	NA
WP_001235599.1|248809_250582_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	8.8e-50
WP_001256180.1|250574_252356_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
>prophage 20
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	261191	264341	4838808		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|261191_264341_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 21
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	271349	279911	4838808		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|271349_271901_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122008.1|272029_273961_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|274013_274343_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|274342_274948_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678208.1|275057_276932_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_073520417.1|277112_277757_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250088.1|277992_278955_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801832.1|278951_279911_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
>prophage 22
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	288105	291065	4838808		Escherichia_phage(50.0%)	2	NA	NA
WP_001344274.1|288105_288447_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	74.5	1.8e-39
WP_000083962.1|288560_291065_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	3.8e-115
>prophage 23
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	295604	296282	4838808		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|295604_296282_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 24
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	299418	413903	4838808	lysis,protease,transposase,head,tail,capsid,integrase,terminase,tRNA,portal	Enterobacteria_phage(37.93%)	99	344366:344412	393207:393253
WP_001110573.1|299418_300105_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561844.1|300101_302516_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014664.1|302945_307235_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000877768.1|307274_307643_+	YbbC/YhhH family protein	NA	NA	NA	NA	NA
WP_001306947.1|307642_308353_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
WP_032254663.1|308333_308825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001158001.1|309825_310920_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|310988_311915_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|312144_312627_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141276.1|312704_313520_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|313609_315391_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_001676375.1|315403_316180_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|316279_317158_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|317326_318781_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006887.1|318840_320202_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001297442.1|320258_321560_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001676376.1|321581_322727_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.1e-48
WP_000540996.1|322855_323641_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001297443.1|323651_324887_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703894.1|324908_325958_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580875.1|326274_327942_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495365.1|327951_329211_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000855388.1|330032_330926_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815522.1|331120_332188_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|332184_332694_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212252.1|332811_333534_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256002.1|333536_334031_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|334204_335590_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|335625_336147_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|336254_336467_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|336468_337335_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000988366.1|338577_339270_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_039022804.1|339300_341910_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001250424.1|342940_343456_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805422.1|343458_344091_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
344366:344412	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|344425_345589_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000206813.1|345815_346121_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|346120_346483_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|346473_347010_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000081287.1|347137_347962_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|348027_348390_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000559922.1|348860_349376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000450738.1|349603_350230_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_000205494.1|350327_350528_+	cell division protein	NA	NA	NA	NA	NA
WP_000515870.1|350565_351117_+	hypothetical protein	NA	U5P4K1	Shigella_phage	98.9	1.7e-100
WP_001250269.1|351292_351472_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104957.1|351461_352403_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001573323.1|352399_352894_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	97.5	6.2e-86
WP_000210176.1|352893_353220_+	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	97.2	2.3e-52
WP_000767127.1|353216_353606_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061408.1|353625_354423_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_001358249.1|354430_355420_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	97.0	2.4e-190
WP_001204780.1|355437_355821_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737266.1|356010_357108_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|357696_357912_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|357911_358409_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001082750.1|358405_358843_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	7.9e-69
WP_001028465.1|359047_359569_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000079508.1|359918_360329_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_000105084.1|360385_360619_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000453580.1|361007_361553_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001027292.1|361527_363453_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	100.0	0.0e+00
WP_000198149.1|363449_363656_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001358226.1|363652_365254_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	8.8e-312
WP_000123248.1|365234_366554_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001358225.1|366563_366896_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000063250.1|366951_367977_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_000158878.1|368018_368414_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000785282.1|368425_368779_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|368790_369369_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|369365_369761_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001317730.1|369768_370509_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_000479193.1|370524_370947_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|370928_371363_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_001401538.1|371355_373917_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847379.1|373913_374243_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_073520418.1|374945_375689_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	4.7e-146
WP_000090891.1|375625_376258_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_073520419.1|376318_379816_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_073520421.1|382892_383492_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	2.2e-109
WP_073520564.1|383556_386955_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_000885602.1|386954_387530_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086525.1|387627_388218_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|388534_388768_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|388836_388950_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|389315_389984_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001201810.1|391829_392783_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177464.1|393296_394058_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
393207:393253	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|394240_395131_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_073520422.1|395131_398104_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|398090_400328_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420935.1|400596_401733_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_157719142.1|401863_402043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299578.1|403524_403734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520423.1|403772_408635_-	PAAR/RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.0	1.2e-19
WP_001160804.1|408654_409116_-	DcrB-related protein	NA	NA	NA	NA	NA
WP_000103240.1|409143_411045_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-26
WP_000253830.1|411781_413230_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000770941.1|413219_413903_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
>prophage 25
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	417048	420192	4838808		Leptospira_phage(100.0%)	1	NA	NA
WP_000573945.1|417048_420192_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 26
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	431621	437664	4838808		Tupanvirus(50.0%)	3	NA	NA
WP_039022601.1|431621_435503_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	7.6e-62
WP_000096723.1|435718_436852_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|436848_437664_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 27
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	452024	453847	4838808		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502952.1|452024_452654_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029813.1|452626_453847_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	3.6e-58
>prophage 28
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	456956	459071	4838808		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|456956_458522_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278505.1|458642_459071_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 29
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	474495	475143	4838808		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|474495_474705_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939738.1|474759_475143_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 30
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	479958	482398	4838808		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|479958_481170_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231428.1|481309_482398_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 31
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	489408	491991	4838808	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|489408_491991_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 32
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	498929	500600	4838808		Bathycoccus_sp._RCC1105_virus(100.0%)	1	NA	NA
WP_000367852.1|498929_500600_-	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.5	5.2e-76
>prophage 33
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	510357	511398	4838808		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|510357_511398_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 34
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	515533	517198	4838808		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|515533_517198_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 35
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	521824	525638	4838808	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023104.1|521824_523771_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|523973_525638_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 36
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	529787	530552	4838808		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773295.1|529787_530552_-	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	5.8e-06
>prophage 37
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	537207	555462	4838808		Hokovirus(33.33%)	12	NA	NA
WP_000186103.1|537207_537885_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
WP_001351528.1|537881_540566_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.1e-11
WP_001297248.1|540558_541131_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087967.1|541139_543188_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_000741137.1|543210_544884_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|544883_544973_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|545285_545492_+	YbfA family protein	NA	NA	NA	NA	NA
WP_073520427.1|545734_549934_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	33.1	1.1e-26
WP_000832340.1|549930_550500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076004.1|552014_552524_+	YbgA family protein	NA	NA	NA	NA	NA
WP_000628037.1|552520_553939_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.2	7.5e-60
WP_001032694.1|553980_555462_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 38
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	558840	559632	4838808		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114035.1|558840_559632_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 39
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	595670	599190	4838808		Vibrio_phage(33.33%)	4	NA	NA
WP_000345401.1|595670_596390_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	33.2	3.2e-22
WP_000951292.1|596386_597328_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|597441_597822_-	YbgS-like family protein	NA	NA	NA	NA	NA
WP_001109196.1|598137_599190_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 40
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	603546	610120	4838808		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|603546_604563_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|604823_606296_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|606363_607152_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|607280_607430_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_001676420.1|607596_608370_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|608369_609059_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891685.1|609061_610120_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 41
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	620475	621765	4838808		Klosneuvirus(100.0%)	1	NA	NA
WP_001389241.1|620475_621765_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 42
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	628246	629155	4838808		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|628246_629155_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 43
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	640467	656557	4838808		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_000996099.1|640467_642204_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_001296990.1|642196_643192_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_001296991.1|643194_643866_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007102.1|644094_645459_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145128.1|646968_647451_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_001340191.1|647570_649721_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386510.1|649748_650711_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443534.1|650851_651937_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|652165_652426_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_024238541.1|652690_652957_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|653030_653708_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000430073.1|653749_656032_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|656296_656557_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 44
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	660097	665322	4838808		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569080.1|660097_660820_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
WP_001159065.1|660816_661476_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|661614_662361_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|662764_663268_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001119538.1|663566_664454_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|664688_664754_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|664806_665322_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 45
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	670319	671912	4838808		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|670319_671912_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 46
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	675809	679940	4838808		Citrobacter_phage(50.0%)	3	NA	NA
WP_000209359.1|675809_678242_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
WP_001307076.1|678247_679147_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_073520430.1|679277_679940_+	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	33.2	2.2e-25
>prophage 47
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	683167	685039	4838808		Planktothrix_phage(100.0%)	1	NA	NA
WP_001676423.1|683167_685039_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 48
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	696373	697576	4838808		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|696373_697576_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 49
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	706142	715293	4838808		Vibrio_phage(25.0%)	11	NA	NA
WP_001195240.1|706142_706400_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|706559_706847_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189152.1|706830_707553_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|707613_708516_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|708603_709080_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126065.1|709431_710544_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000995994.1|710638_711772_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.9e-29
WP_001093858.1|711781_712735_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|712731_713577_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|713636_714125_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149732.1|714165_715293_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
>prophage 50
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	718630	721368	4838808		Planktothrix_phage(50.0%)	4	NA	NA
WP_000027205.1|718630_719359_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|719576_720092_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|720217_720541_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|720537_721368_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
>prophage 51
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	724955	726674	4838808		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815350.1|724955_726674_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
>prophage 52
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	735971	841326	4838808	lysis,protease,plate,head,tail,capsid,integrase,terminase,tRNA,portal	Escherichia_phage(26.67%)	94	722245:722263	806767:806785
722245:722263	attL	GCGCCCATTTTTTCCAGCA	NA	NA	NA	NA
WP_073520431.1|735971_737918_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|737990_738215_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|738537_738858_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|738888_741165_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|741849_742068_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|742352_743057_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001676429.1|743098_744820_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	8.4e-21
WP_001043618.1|744820_746587_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_000537418.1|746709_747675_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|748219_748714_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077054.1|748848_752916_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|753070_753682_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067767.1|753692_755036_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|755126_756419_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_073520432.1|756657_759102_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	2.3e-221
WP_000213098.1|759112_759730_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534648.1|759731_760595_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000165876.1|760630_761257_-	hydrolase	NA	NA	NA	NA	NA
WP_000109289.1|761571_762720_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918506.1|762929_764360_+	amino acid permease	NA	NA	NA	NA	NA
WP_001242664.1|764360_765269_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001190374.1|765368_765959_+	NAD(P)H oxidoreductase	NA	NA	NA	NA	NA
WP_052318711.1|766040_766838_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_040090130.1|766869_767865_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	86.7	2.5e-166
WP_040090132.1|768007_768307_-	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	73.7	1.4e-32
WP_073520433.1|768410_768767_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	75.2	1.4e-44
WP_169072971.1|768777_768954_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	73.1	3.2e-13
WP_040090136.1|768944_769445_+	hypothetical protein	NA	M1SV55	Escherichia_phage	84.9	1.3e-78
WP_040090137.1|769508_769733_+	DUF2732 family protein	NA	Q7Y4C2	Escherichia_virus	67.6	2.1e-17
WP_040090138.1|769732_770032_+	DUF5405 family protein	NA	M1RZ07	Escherichia_phage	57.7	6.1e-20
WP_040090139.1|770031_770307_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	63.7	4.7e-27
WP_040090140.1|770296_772588_+	replication endonuclease	NA	Q858T4	Yersinia_virus	75.1	0.0e+00
WP_040090142.1|772587_773067_+	DUF3850 domain-containing protein	NA	Q858T3	Yersinia_virus	52.9	4.5e-41
WP_047660605.1|773063_773288_+	hypothetical protein	NA	Q6K1F0	Salmonella_virus	58.0	1.4e-13
WP_040090145.1|773756_774896_+	DUF262 domain-containing protein	NA	A0A0R6PJX3	Moraxella_phage	24.8	1.4e-16
WP_040090146.1|774896_775505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040090148.1|775535_776546_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	77.9	4.0e-156
WP_040090149.1|776547_778317_-|terminase	terminase ATPase subunit family protein	terminase	Q9T0R3	Escherichia_phage	84.4	2.3e-300
WP_040090151.1|778483_779338_+|capsid	GPO family capsid scaffolding protein	capsid	Q6K1I7	Salmonella_virus	71.8	1.6e-113
WP_040090153.1|779399_780467_+|capsid	phage major capsid protein, P2 family	capsid	S4TUA6	Salmonella_phage	83.9	1.1e-169
WP_073520434.1|780470_781226_+|terminase	terminase endonuclease subunit	terminase	O80305	Escherichia_phage	73.0	1.1e-81
WP_046276225.1|781325_781832_+|head	head completion/stabilization protein	head	O80306	Escherichia_phage	72.6	1.2e-63
WP_046276226.1|781831_782035_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	86.6	7.0e-28
WP_016153631.1|782025_782247_+	hypothetical protein	NA	A0A218M4L5	Erwinia_phage	79.2	2.9e-27
WP_040090160.1|782230_782743_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	88.8	1.7e-83
WP_040090161.1|782739_783171_+	hypothetical protein	NA	A0A218M4L6	Erwinia_phage	59.4	1.9e-43
WP_040090162.1|783152_783581_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A218M4K2	Erwinia_phage	71.9	8.4e-47
WP_040090165.1|783676_784144_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	72.9	1.1e-60
WP_073520435.1|784136_784583_+	phage virion morphogenesis protein	NA	A0A0M3UL83	Salmonella_phage	63.5	1.3e-47
WP_052318713.1|784702_786334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073520436.1|786758_787400_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	81.2	5.2e-93
WP_040090174.1|787396_787747_+	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	72.4	6.2e-40
WP_047660579.1|787752_788661_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	81.8	3.5e-135
WP_040090175.1|788653_789184_+|tail	phage tail protein I	tail	Q37841	Escherichia_phage	88.1	3.6e-92
WP_040090179.1|790905_791328_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	38.5	5.8e-16
WP_073520437.1|791451_792645_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	81.4	8.3e-185
WP_001207672.1|792657_793176_+|tail	phage major tail tube protein	tail	A0A218M4J0	Erwinia_phage	79.7	6.5e-78
WP_040091629.1|793230_793545_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	72.9	4.6e-26
WP_000763322.1|793577_793700_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	84.6	1.9e-12
WP_073520438.1|793689_796131_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	75.7	0.0e+00
WP_040091630.1|796144_796609_+|tail	phage tail protein	tail	A0A218M4I2	Erwinia_phage	72.1	1.6e-59
WP_040091631.1|796605_797775_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	75.1	9.6e-162
WP_047670860.1|797850_798072_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	74.0	2.2e-27
WP_001292814.1|798391_800674_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.0e-162
WP_000642546.1|800728_801586_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001295344.1|801991_803752_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642849.1|803881_804574_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057127.1|804772_805861_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.5	2.3e-80
WP_000445231.1|805931_807215_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
806767:806785	attR	TGCTGGAAAAAATGGGCGC	NA	NA	NA	NA
WP_001295345.1|807383_808148_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000125016.1|808320_809004_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|809114_810788_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|810947_811232_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_039022796.1|811438_813703_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|813739_815488_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570542.1|815484_816471_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000056529.1|816507_817740_+	YcaQ family DNA glycosylase	NA	NA	NA	NA	NA
WP_000350058.1|817791_817974_+	protein YcaR	NA	NA	NA	NA	NA
WP_000011590.1|817970_818717_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|818870_819764_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000899599.1|819740_820520_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|820655_821441_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|821437_822760_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295347.1|822740_823445_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_000572634.1|823444_827905_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_000925997.1|828165_830013_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|830193_830742_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109487.1|830768_831416_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|831637_832828_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|833012_834101_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|834702_836103_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|836271_837474_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193844.1|837739_840352_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001090508.1|840558_841326_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 53
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	857247	859155	4838808		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|857247_859155_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 54
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	871765	873820	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000420536.1|871765_873820_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	1.0e-20
>prophage 55
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	878053	878713	4838808	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|878053_878713_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 56
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	897978	910233	4838808		Morganella_phage(20.0%)	13	NA	NA
WP_000066490.1|897978_898191_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071524879.1|898201_898390_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001331090.1|898364_898595_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|898584_898758_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000829669.1|898805_899879_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_015695619.1|899950_902695_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	1.0e-36
WP_001264919.1|902777_903806_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|903778_904471_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|904600_905773_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001063132.1|905772_908319_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	30.7	2.2e-70
WP_000209869.1|908315_908915_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|909007_909313_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|909312_910233_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 57
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	914537	916637	4838808		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|914537_914711_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001297178.1|914793_916122_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.6	6.9e-233
WP_001028096.1|916142_916637_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	96.9	1.1e-50
>prophage 58
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	931548	932337	4838808		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|931548_932337_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 59
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	939156	941718	4838808	transposase	Bacillus_phage(50.0%)	2	NA	NA
WP_000409850.1|939156_940515_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.5e-20
WP_085947771.1|940555_941718_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 60
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	946588	947422	4838808		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|946588_947422_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 61
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	951555	952089	4838808		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857414.1|951555_952089_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	1.0e-25
>prophage 62
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	961397	962318	4838808		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|961397_962318_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 63
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	966980	967226	4838808		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|966980_967226_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 64
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	983106	984048	4838808		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|983106_984048_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 65
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	996406	997588	4838808		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|996406_997141_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|997351_997588_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 66
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1000860	1002503	4838808		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1000860_1001502_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267931.1|1001498_1002503_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
>prophage 67
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1014817	1015075	4838808		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1014817_1015075_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 68
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1022364	1026087	4838808		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|1022364_1023066_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251350.1|1023065_1024310_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1024338_1025250_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|1025265_1026087_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
>prophage 69
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1029363	1031341	4838808		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1029363_1030221_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1030204_1031341_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 70
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1036461	1037832	4838808		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423729.1|1036461_1037832_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
>prophage 71
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1040968	1044530	4838808		Enterobacteria_phage(66.67%)	6	NA	NA
WP_000444487.1|1040968_1042219_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001307134.1|1042321_1042645_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_120795380.1|1042730_1042775_-	protein YmgK	NA	NA	NA	NA	NA
WP_032141808.1|1043010_1043121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1043173_1043578_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_073520440.1|1043798_1044530_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
>prophage 72
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1050396	1052718	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_073520441.1|1050396_1052718_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	42.8	8.8e-90
>prophage 73
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1061252	1062940	4838808		Morganella_phage(50.0%)	2	NA	NA
WP_000897378.1|1061252_1061672_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000457616.1|1061671_1062940_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 74
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1089700	1092452	4838808		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033346.1|1089700_1091380_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.0e-23
WP_001298109.1|1091504_1092452_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 75
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1095588	1099596	4838808		Pseudomonas_phage(50.0%)	5	NA	NA
WP_000804726.1|1095588_1096671_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456572.1|1096670_1097504_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|1097500_1097893_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1097896_1098706_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1098741_1099596_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 76
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1102697	1102928	4838808		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|1102697_1102928_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 77
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1114181	1124192	4838808		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1114181_1115720_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1115716_1116427_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1116426_1117104_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1117829_1118672_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001307143.1|1118721_1119180_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1119292_1120198_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001676509.1|1120289_1121303_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1121504_1122413_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1122556_1122970_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|1123574_1124192_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 78
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1132602	1134617	4838808		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110945.1|1132602_1133616_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1133612_1134617_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 79
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1146274	1149232	4838808		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983912.1|1146274_1147636_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1147636_1149232_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 80
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1154165	1159457	4838808	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559280.1|1154165_1154924_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1155143_1156193_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1156228_1156480_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1156859_1159457_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 81
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1164380	1164971	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1164380_1164971_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 82
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1172786	1178443	4838808		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|1172786_1174721_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001610022.1|1174788_1175916_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1176059_1176848_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000968844.1|1177215_1177569_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|1177636_1178443_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 83
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1191248	1192514	4838808		Klosneuvirus(100.0%)	1	NA	NA
WP_000069229.1|1191248_1192514_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	2.0e-24
>prophage 84
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1206519	1207602	4838808		Planktothrix_phage(100.0%)	1	NA	NA
WP_000057977.1|1206519_1207602_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.7	5.6e-23
>prophage 85
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1224220	1224736	4838808		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|1224220_1224736_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 86
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1231062	1291006	4838808	lysis,tail,integrase,terminase,tRNA	Escherichia_phage(50.0%)	67	1225446:1225462	1265995:1266011
1225446:1225462	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_000628065.1|1231062_1232295_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1232549_1233533_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123738.1|1234010_1235384_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1235512_1236448_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1236499_1237735_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1237736_1237952_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1238030_1238240_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_053889809.1|1238232_1238427_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	5.8e-32
WP_000166319.1|1238483_1239293_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_073520447.1|1239285_1241886_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	5.7e-247
WP_000632297.1|1241987_1242263_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1242337_1242508_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1242507_1242729_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1243170_1243659_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001610067.1|1243655_1243811_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	8.0e-08
WP_000948459.1|1244264_1244741_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1244864_1245161_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1245183_1245606_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899746.1|1245618_1246476_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_042097776.1|1246482_1247229_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	1.2e-112
WP_042097778.1|1247251_1248001_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	3.3e-115
WP_001586994.1|1248017_1248440_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	82.7	6.7e-57
WP_001586995.1|1248600_1249119_+	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	57.4	5.8e-34
WP_046788432.1|1249149_1250583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042097780.1|1250554_1251613_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001586998.1|1251885_1252098_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	59.7	1.9e-12
WP_000940319.1|1252561_1253161_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247763.1|1253160_1253451_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000640161.1|1253447_1253990_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000506936.1|1255034_1255463_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|1255634_1256009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|1256260_1256476_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135310.1|1256475_1256973_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_001228688.1|1257189_1257375_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_073520448.1|1257571_1259029_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_016232661.1|1259166_1259958_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	3.7e-48
WP_001742940.1|1259950_1260883_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	9.3e-83
WP_000613571.1|1260818_1261070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520449.1|1261073_1262168_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	2.2e-112
WP_000625348.1|1262148_1263450_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763702.1|1263452_1264859_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_073520450.1|1264842_1265955_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|1266059_1266824_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
1265995:1266011	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|1266922_1268062_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|1268104_1268281_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|1268284_1268680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520451.1|1268679_1269063_+	glutamate 5-kinase	NA	A0A0H5ARS2	Pseudomonas_phage	37.3	3.5e-12
WP_001029819.1|1269063_1269444_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000673077.1|1269440_1269833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|1269859_1270822_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|1270972_1271332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001755909.1|1271439_1271640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073520452.1|1271805_1275039_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	7.9e-105
WP_000024051.1|1275031_1275370_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152422.1|1275369_1276068_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.1	9.6e-125
WP_073520453.1|1276073_1276817_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
WP_021514630.1|1276714_1277362_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_073520454.1|1277422_1280821_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.0	0.0e+00
WP_073520455.1|1280887_1281487_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	1.8e-111
WP_073520568.1|1281551_1284467_+|tail	phage tail protein	tail	A0A2D1UII2	Escherichia_phage	98.3	2.9e-58
WP_073507386.1|1284466_1285051_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000968131.1|1285263_1286121_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|1286117_1286975_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_073507385.1|1286971_1287799_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	M1HV27	Acanthocystis_turfacea_Chlorella_virus	28.0	8.7e-08
WP_073507384.1|1287798_1288713_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001082294.1|1289297_1289732_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_000837924.1|1289872_1291006_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 87
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1295966	1296956	4838808		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|1295966_1296956_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 88
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1328241	1332144	4838808		Klosneuvirus(100.0%)	1	NA	NA
WP_000139551.1|1328241_1332144_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 89
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1336083	1337032	4838808		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|1336083_1336614_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1336858_1337032_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 90
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1348834	1359008	4838808	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_024195537.1|1348834_1350043_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	92.8	1.7e-206
WP_071601296.1|1350082_1351297_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|1351349_1351886_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001301045.1|1351958_1353920_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000494244.1|1354011_1354242_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|1354463_1354640_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270285.1|1354685_1355102_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	58.5	1.6e-31
WP_000760594.1|1355180_1356587_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_039022646.1|1356831_1357977_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220411.1|1357994_1359008_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 91
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1366140	1368243	4838808		Salmonella_phage(100.0%)	1	NA	NA
WP_000689351.1|1366140_1368243_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.9	2.8e-135
>prophage 92
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1378915	1380078	4838808	transposase	Acinetobacter_phage(100.0%)	1	NA	NA
WP_085947771.1|1378915_1380078_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
>prophage 93
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1383870	1388133	4838808		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_073520457.1|1383870_1388133_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	4.2e-21
>prophage 94
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1393936	1395481	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_000702560.1|1393936_1395481_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 95
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1402366	1402657	4838808		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1402366_1402657_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 96
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1408668	1410110	4838808		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1408668_1408953_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642407.1|1409099_1410110_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 97
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1413384	1415290	4838808		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285553.1|1413384_1414311_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193523.1|1414303_1415290_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	2.9e-18
>prophage 98
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1419606	1423413	4838808		Klosneuvirus(50.0%)	2	NA	NA
WP_001307211.1|1419606_1422006_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426265.1|1422030_1423413_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 99
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1428687	1435623	4838808		Powai_lake_megavirus(50.0%)	3	NA	NA
WP_001245007.1|1428687_1431471_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.3e-19
WP_000832442.1|1431527_1433900_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_073520459.1|1433937_1435623_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	24.1	5.9e-11
>prophage 100
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1452210	1453611	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_149027166.1|1452210_1453611_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	49.0	9.0e-106
>prophage 101
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1461035	1462571	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194894.1|1461035_1462571_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	1.9e-16
>prophage 102
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1470452	1471871	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000558044.1|1470452_1471871_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 103
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1479615	1481745	4838808		Streptococcus_phage(50.0%)	3	NA	NA
WP_000091199.1|1479615_1479999_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803659.1|1480030_1480249_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012618.1|1480305_1481745_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
>prophage 104
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1489249	1490140	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000592805.1|1489249_1490140_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 105
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1495506	1510944	4838808		Escherichia_phage(44.44%)	15	NA	NA
WP_000214712.1|1495506_1495710_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527751.1|1495745_1497206_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000151243.1|1497294_1498662_-	MHS family MFS transporter YdfJ	NA	NA	NA	NA	NA
WP_000836057.1|1498719_1499739_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|1499750_1500965_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1501170_1501497_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|1501631_1501973_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|1502007_1502568_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1502570_1503281_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|1503388_1503694_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041534.1|1503892_1506319_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
WP_001340362.1|1506379_1508803_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1508813_1509431_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1509432_1510287_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1510329_1510944_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 106
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1528705	1530007	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|1528705_1530007_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 107
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1539902	1541714	4838808		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945924.1|1539902_1541714_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	99.7	0.0e+00
>prophage 108
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1561213	1562488	4838808	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|1561213_1562488_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 109
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1569399	1570898	4838808		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|1569399_1569921_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250661.1|1570001_1570898_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
>prophage 110
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1579700	1588492	4838808		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|1579700_1580516_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|1580643_1581225_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|1581370_1582540_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|1582705_1582795_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|1583093_1584119_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|1584115_1585048_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|1585160_1586372_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098911.1|1586662_1587811_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_000493947.1|1587850_1588492_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 111
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1593996	1596257	4838808		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587560.1|1593996_1594809_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_001069961.1|1594812_1595598_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_077897341.1|1595594_1596257_-	4Fe-4S binding protein	NA	A0A077SL61	Escherichia_phage	37.4	6.9e-24
>prophage 112
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1604547	1609631	4838808		environmental_halophage(33.33%)	5	NA	NA
WP_000144565.1|1604547_1605768_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000908012.1|1605764_1607036_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948872.1|1607010_1607757_-	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.0	2.2e-10
WP_000089364.1|1607766_1609254_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|1609262_1609631_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 113
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1628277	1647817	4838808	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001297385.1|1628277_1629924_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	1.6e-32
WP_000069375.1|1629980_1632359_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|1632691_1633525_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|1633681_1634728_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|1634859_1635051_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175615.1|1635054_1636491_-	YdiU family protein	NA	NA	NA	NA	NA
WP_001315654.1|1636553_1637267_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209780.1|1637513_1637978_-	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_000029466.1|1638055_1638805_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001154187.1|1638804_1639356_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956519.1|1639418_1640399_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|1640499_1640799_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672359.1|1640803_1643191_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|1643205_1644189_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|1644472_1644517_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|1644639_1644996_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|1645048_1645246_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|1645342_1645885_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144192.1|1645888_1647817_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
>prophage 114
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1659086	1661348	4838808		Tupanvirus(100.0%)	1	NA	NA
WP_000077825.1|1659086_1661348_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	2.3e-143
>prophage 115
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1667475	1668303	4838808		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|1667475_1668303_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 116
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1675779	1677000	4838808		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|1675779_1677000_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 117
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1683764	1684418	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_001299207.1|1683764_1684418_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.1	9.6e-10
>prophage 118
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1690018	1691980	4838808		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235796.1|1690018_1691980_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	4.1e-40
>prophage 119
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1696906	1700991	4838808		Tupanvirus(50.0%)	4	NA	NA
WP_001120535.1|1696906_1697548_+	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_000438813.1|1697640_1698999_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719088.1|1699115_1699874_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|1700010_1700991_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 120
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1709804	1710659	4838808		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|1709804_1710659_-	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 121
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1713977	1718554	4838808		Bacillus_phage(100.0%)	3	NA	NA
WP_000219686.1|1713977_1715261_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|1715407_1716883_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|1717063_1718554_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 122
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1724505	1726153	4838808	transposase	Escherichia_phage(50.0%)	2	NA	NA
WP_073520468.1|1724505_1725714_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	6.0e-207
WP_000604942.1|1725721_1726153_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.1	7.4e-43
>prophage 123
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1735055	1743161	4838808	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|1735055_1736741_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290576.1|1736945_1737527_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|1737566_1738262_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|1738319_1740230_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|1740361_1740706_+	RidA family protein	NA	NA	NA	NA	NA
WP_001300615.1|1741067_1741427_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|1741546_1741726_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000854972.1|1741799_1743161_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
>prophage 124
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1747023	1748580	4838808		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|1747023_1748580_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 125
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1754221	1754431	4838808		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|1754221_1754431_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 126
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1759762	1761811	4838808		Moraxella_phage(100.0%)	1	NA	NA
WP_001315679.1|1759762_1761811_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 127
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1769307	1773777	4838808		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|1769307_1769964_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976492.1|1770359_1770701_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879285.1|1770713_1771586_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000204699.1|1771589_1771964_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|1772102_1772333_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011652.1|1772434_1773091_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|1773114_1773777_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 128
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1781833	1783309	4838808		Cyanophage(100.0%)	1	NA	NA
WP_000301720.1|1781833_1783309_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.3	9.9e-79
>prophage 129
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1787307	1794371	4838808		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|1787307_1788630_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001342995.1|1788645_1789578_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|1789656_1790412_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571465.1|1790408_1791194_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|1791340_1792351_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580328.1|1792359_1792971_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_001386853.1|1793109_1793175_-	stress response small protein YobI	NA	NA	NA	NA	NA
WP_001024910.1|1793245_1793848_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1793849_1794371_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 130
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1798389	1800440	4838808		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|1798389_1799208_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1799260_1799656_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019588.1|1799696_1800440_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
>prophage 131
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1808335	1810069	4838808	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025342.1|1808335_1810069_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 132
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1815321	1820965	4838808		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|1815321_1815711_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036378.1|1815725_1816775_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|1816777_1817638_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483202.1|1817656_1819258_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	4.9e-15
WP_001307261.1|1819303_1820965_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 133
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1831052	1832567	4838808		Cedratvirus(100.0%)	1	NA	NA
WP_001187810.1|1831052_1832567_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 134
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1844556	1845309	4838808		Bacillus_virus(100.0%)	1	NA	NA
WP_001272986.1|1844556_1845309_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	4.9e-26
>prophage 135
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1857574	1858243	4838808		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334598.1|1857574_1858243_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	2.8e-81
>prophage 136
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1872259	1884850	4838808		Bacillus_phage(28.57%)	12	NA	NA
WP_001351364.1|1872259_1873954_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
WP_000009306.1|1874191_1874374_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|1874452_1875370_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212248.1|1875542_1876463_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|1876451_1876922_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157241.1|1876902_1878321_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000365565.1|1878387_1879083_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001313057.1|1879122_1879488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824402.1|1880055_1881270_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.5	5.2e-102
WP_000218209.1|1881861_1882713_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826746.1|1882820_1884179_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001339045.1|1884178_1884850_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 137
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1888394	1927897	4838808	capsid,terminase,head,plate,integrase,holin,tail,transposase,portal	Escherichia_phage(26.92%)	49	1889478:1889537	1927967:1928043
WP_001079074.1|1888394_1888925_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
1889478:1889537	attL	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTA	NA	NA	NA	NA
WP_047621001.1|1890917_1891961_-	phage late control protein	NA	R9TNM7	Vibrio_phage	29.3	7.5e-33
WP_047621003.1|1891964_1892177_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_000418460.1|1892193_1892436_+	superinfection immunity protein	NA	M4MA40	Vibrio_phage	46.9	1.8e-06
WP_047621042.1|1892414_1892804_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	40.3	5.3e-16
WP_047621005.1|1892839_1894480_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	27.9	8.3e-18
WP_000444666.1|1894588_1894870_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_039264464.1|1894882_1895395_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_047621009.1|1895412_1896906_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	K4HZC3	Acidithiobacillus_phage	37.0	5.0e-70
WP_001559300.1|1896911_1897145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264466.1|1898096_1898723_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	39.5	3.1e-26
WP_039264467.1|1898725_1899646_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.4	7.0e-67
WP_047621011.1|1899642_1899984_-	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.8e-20
WP_039264469.1|1899986_1900889_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_039264470.1|1900869_1901406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264472.1|1901402_1902083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264473.1|1902114_1902495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264474.1|1902491_1902899_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_039264475.1|1902929_1903964_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	57.4	9.2e-108
WP_000206291.1|1904025_1904355_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	39.5	2.6e-08
WP_001145891.1|1904354_1905665_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	51.7	5.8e-99
WP_047621016.1|1905664_1907236_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.3	1.6e-188
WP_012565126.1|1907232_1907466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148194.1|1907462_1909328_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	4.1e-191
WP_000168116.1|1909314_1909881_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	43.5	7.7e-32
WP_001559319.1|1910253_1910499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039264476.1|1910815_1911109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071791986.1|1911105_1911384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131874.1|1911724_1912204_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	69.4	1.6e-62
WP_039264477.1|1912190_1912475_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	1.0e-08
WP_001294589.1|1912474_1912858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039264478.1|1912970_1913642_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	32.4	7.8e-15
WP_000717782.1|1913641_1913935_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.6	5.0e-35
WP_039264479.1|1913931_1914528_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.6	1.4e-71
WP_001025459.1|1914605_1914785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047621045.1|1914936_1915578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001559328.1|1915696_1915975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1916542_1917031_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_039264480.1|1917040_1917646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048963140.1|1917755_1918160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021560857.1|1918480_1919146_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_021560858.1|1919350_1919548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028985353.1|1920174_1921098_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_165369427.1|1922132_1923346_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	87.4	1.9e-144
WP_047621027.1|1923479_1925696_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.2	6.2e-101
WP_047621030.1|1925692_1926262_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.7	3.0e-36
WP_000916333.1|1926261_1926444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001559348.1|1926653_1926869_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	67.6	1.0e-21
WP_028985344.1|1926868_1927897_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	55.4	5.6e-97
1927967:1928043	attR	TAAGTCATTGATAAAGTGGCGGAGAGAGGGGGATTTGAACCCCCGGTAGAGTTGCCCCTACTCCGGTTTTCGAGACC	NA	NA	NA	NA
>prophage 138
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1953353	1954163	4838808		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_001000035.1|1953353_1954163_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.1	2.6e-09
>prophage 139
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1971655	1972822	4838808		Stx2-converting_phage(100.0%)	1	NA	NA
WP_047661092.1|1971655_1972822_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.2	1.3e-227
>prophage 140
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1980466	1981366	4838808		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|1980466_1981366_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 141
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	1988719	1995842	4838808		Paramecium_bursaria_Chlorella_virus(25.0%)	6	NA	NA
WP_000704903.1|1988719_1989886_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.7	1.7e-110
WP_029397755.1|1990135_1991542_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.1	4.0e-37
WP_174580680.1|1991683_1992838_-	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	45.6	5.3e-80
WP_000794346.1|1992851_1993766_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_029397753.1|1993755_1994868_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_029397752.1|1994879_1995842_-	hypothetical protein	NA	A0A0N7KVT5	Yellowstone_lake_phycodnavirus	31.5	3.2e-22
>prophage 142
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2001197	2006889	4838808		uncultured_Mediterranean_phage(20.0%)	5	NA	NA
WP_029397745.1|2001197_2001902_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	31.9	4.5e-13
WP_000668789.1|2001902_2003054_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2K9L470	Tupanvirus	32.1	1.6e-36
WP_000460024.1|2003053_2004052_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A1V0SAI8	Catovirus	38.8	3.5e-43
WP_000183060.1|2004426_2005320_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_029397744.1|2005494_2006889_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	1.4e-18
>prophage 143
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2012600	2019482	4838808		Bacillus_phage(25.0%)	6	NA	NA
WP_073520479.1|2012600_2013971_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	1.3e-32
WP_073520480.1|2014251_2015688_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	30.0	6.5e-51
WP_073520481.1|2015690_2016914_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479836.1|2016910_2017390_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_073520482.1|2017392_2018358_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	51.1	9.9e-88
WP_000048190.1|2018360_2019482_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 144
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2023725	2034378	4838808		uncultured_marine_virus(20.0%)	8	NA	NA
WP_000654503.1|2023725_2024565_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137138.1|2024742_2026905_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2026907_2027351_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2027356_2028496_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000454701.1|2029154_2030738_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001252331.1|2031188_2033042_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2033063_2033645_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2033736_2034378_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 145
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2039036	2040389	4838808		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469734.1|2039036_2040389_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.9	1.2e-06
>prophage 146
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2053831	2060705	4838808	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|2053831_2055235_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137873.1|2055231_2055954_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000929408.1|2056144_2056477_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2056685_2056982_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2056983_2057280_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2057382_2058744_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_000716757.1|2059073_2059391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807362.1|2059805_2060705_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
>prophage 147
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2069927	2073484	4838808		Serratia_phage(50.0%)	4	NA	NA
WP_073520486.1|2069927_2070932_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000011973.1|2070928_2071894_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2071867_2072614_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001351455.1|2072665_2073484_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	1.7e-24
>prophage 148
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2084133	2086167	4838808	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001295427.1|2084133_2086167_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 149
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2098732	2108174	4838808		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292767.1|2098732_2099869_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	4.6e-161
WP_001351453.1|2099865_2101866_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2101990_2102452_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2102492_2102963_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2103009_2103729_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2103725_2105411_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2105632_2106364_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2106423_2106531_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2106511_2107243_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_032326746.1|2107247_2108174_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	31.2	1.3e-23
>prophage 150
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2128489	2130010	4838808		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2128489_2130010_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 151
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2133704	2137490	4838808		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2133704_2134373_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2134630_2135467_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000489233.1|2135498_2137490_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 152
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2141559	2142417	4838808		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2141559_2142417_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 153
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2156912	2161213	4838808		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_000848214.1|2156912_2158379_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.3	8.7e-43
WP_000198822.1|2158496_2159483_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|2159521_2160235_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000241012.1|2160646_2161213_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 154
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2166967	2174616	4838808		Vibrio_phage(50.0%)	7	NA	NA
WP_000194940.1|2166967_2168557_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-19
WP_000202798.1|2168560_2168905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|2169238_2170429_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2170456_2171152_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578076.1|2171300_2173061_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2173185_2173470_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050789.1|2173608_2174616_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	1.5e-83
>prophage 155
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2186315	2186933	4838808		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2186315_2186933_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 156
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2195700	2201478	4838808		Bacillus_phage(25.0%)	5	NA	NA
WP_000422188.1|2195700_2197344_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	9.5e-14
WP_000884963.1|2197419_2198070_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000710368.1|2198069_2199134_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000406101.1|2199207_2200263_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865571.1|2200374_2201478_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.4	6.2e-118
>prophage 157
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2205754	2208604	4838808		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|2205754_2208604_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 158
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2218304	2232360	4838808		Pseudomonas_phage(33.33%)	8	NA	NA
WP_001281242.1|2218304_2220932_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
WP_000990766.1|2221078_2221801_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001220040.1|2221928_2225663_-	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	23.6	1.5e-19
WP_001075177.1|2226358_2228644_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_000332036.1|2228732_2229863_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_000135040.1|2229862_2230117_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301045.1|2230170_2230821_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779084.1|2231283_2232360_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
>prophage 159
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2238253	2239156	4838808	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|2238253_2239156_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 160
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2242308	2247312	4838808		Tupanvirus(50.0%)	4	NA	NA
WP_001297077.1|2242308_2242911_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
WP_001379044.1|2243218_2244358_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|2244361_2245330_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_001748583.1|2245329_2247312_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.7	1.4e-19
>prophage 161
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2281728	2284956	4838808		Salmonella_phage(50.0%)	3	NA	NA
WP_000813860.1|2281728_2282328_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_001012899.1|2282386_2284219_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203389.1|2284305_2284956_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
>prophage 162
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2295515	2297388	4838808		Sodalis_phage(50.0%)	2	NA	NA
WP_000156113.1|2295515_2296418_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
WP_001293612.1|2296614_2297388_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 163
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2301599	2303117	4838808		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2301599_2303117_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 164
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2309593	2310730	4838808		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|2309593_2310730_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 165
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2319294	2320380	4838808		Pandoravirus(100.0%)	1	NA	NA
WP_000918470.1|2319294_2320380_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	48.4	9.1e-90
>prophage 166
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2338263	2339196	4838808		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2338263_2339196_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 167
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2342236	2343670	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000194515.1|2342236_2343670_+	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	7.0e-29
>prophage 168
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2350311	2357888	4838808		Hokovirus(50.0%)	4	NA	NA
WP_001307321.1|2350311_2353905_+	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
WP_001296867.1|2353960_2355106_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2355179_2356124_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283505.1|2356193_2357888_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.4	2.3e-23
>prophage 169
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2361579	2362500	4838808		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2361579_2362500_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 170
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2366318	2367053	4838808		Clostridioides_phage(100.0%)	1	NA	NA
WP_073520490.1|2366318_2367053_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 171
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2392747	2408104	4838808		Streptococcus_phage(33.33%)	15	NA	NA
WP_000443665.1|2392747_2394763_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
WP_001297862.1|2394833_2395820_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254843.1|2396049_2396811_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2396995_2397967_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2398350_2398608_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623136.1|2398652_2400380_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000522247.1|2400420_2400930_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096660.1|2400971_2401823_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719943.1|2401927_2402296_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001351424.1|2402298_2403210_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.6	2.9e-57
WP_000021039.1|2403343_2404441_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
WP_000852685.1|2404430_2405306_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000458406.1|2405305_2406139_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000290248.1|2406138_2407155_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517431.1|2407312_2408104_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 172
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2411582	2416520	4838808		Mycobacterium_phage(33.33%)	6	NA	NA
WP_001315775.1|2411582_2412887_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2412944_2413844_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838945.1|2413939_2414515_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_001307326.1|2414575_2415025_-	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000406000.1|2415011_2415437_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102891.1|2415650_2416520_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 173
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2435274	2436225	4838808		Cyanophage(100.0%)	1	NA	NA
WP_001402393.1|2435274_2436225_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 174
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2454253	2454967	4838808		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2454253_2454967_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 175
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2476052	2480054	4838808		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|2476052_2477342_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2477427_2478054_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001295474.1|2478378_2479416_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001028614.1|2479415_2480054_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	2.4e-29
>prophage 176
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2486300	2492783	4838808		Escherichia_phage(66.67%)	7	NA	NA
WP_000017552.1|2486300_2486453_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2486470_2486662_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|2486972_2487491_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755179.1|2487506_2488046_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.3	4.1e-43
WP_000138282.1|2488138_2489716_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_001299507.1|2489784_2491251_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937933.1|2491412_2492783_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	4.0e-42
>prophage 177
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2501612	2502044	4838808		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2501612_2502044_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 178
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2511929	2518386	4838808		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133582.1|2511929_2513213_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
WP_000523616.1|2513390_2513591_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|2513602_2513938_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|2513939_2515790_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384411.1|2515806_2516322_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|2516417_2516741_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|2516757_2517144_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|2517171_2518386_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 179
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2533522	2535034	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000493471.1|2533522_2535034_-	sugar ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.0	1.8e-11
>prophage 180
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2540792	2552100	4838808		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|2540792_2542046_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_000883101.1|2542374_2543565_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|2543609_2543948_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_001298983.1|2544008_2545343_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215872.1|2545332_2546046_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001351415.1|2546209_2547637_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	2.3e-16
WP_000970092.1|2548212_2552100_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.1	2.0e-131
>prophage 181
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2556219	2556480	4838808		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2556219_2556480_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 182
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2559938	2563681	4838808		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|2559938_2560619_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2560891_2561866_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|2561881_2563681_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 183
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2569452	2575711	4838808	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|2569452_2570787_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2570995_2571877_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|2571979_2572567_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_073520493.1|2572622_2573006_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|2573310_2574000_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997411.1|2574047_2575085_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2575291_2575711_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 184
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2581004	2582303	4838808		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|2581004_2582303_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 185
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2586827	2589401	4838808		Enterobacteria_phage(100.0%)	1	NA	NA
WP_073520494.1|2586827_2589401_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
>prophage 186
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2595307	2596378	4838808		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|2595307_2596378_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 187
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2610012	2610495	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000162574.1|2610012_2610495_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 188
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2614762	2615020	4838808		Salmonella_phage(100.0%)	1	NA	NA
WP_000340075.1|2614762_2615020_-	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	1.2e-05
>prophage 189
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2625634	2629759	4838808		Klosneuvirus(50.0%)	4	NA	NA
WP_000097641.1|2625634_2626915_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
WP_073520495.1|2627225_2628626_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|2628646_2629309_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522424.1|2629309_2629759_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 190
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2633694	2638990	4838808		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|2633694_2633940_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|2633936_2634347_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246543.1|2634319_2636464_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	8.4e-196
WP_000777969.1|2636473_2637433_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_001297215.1|2637787_2638990_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 191
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2651765	2657325	4838808	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|2651765_2651951_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_073520496.1|2652185_2654816_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140506.1|2654943_2655444_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|2655686_2656748_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132234.1|2656827_2657325_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	50.3	1.5e-31
>prophage 192
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2662791	2663757	4838808		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|2662791_2663757_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 193
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2671330	2672341	4838808		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001402444.1|2671330_2672341_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 194
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2690169	2697309	4838808		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2690169_2692731_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|2692836_2693493_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|2693543_2694311_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2694506_2695415_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2695411_2696674_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2696670_2697309_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 195
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2702523	2706239	4838808		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000081550.1|2702523_2703516_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|2703578_2704718_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|2704857_2705484_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001472109.1|2705477_2706239_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	4.9e-58
>prophage 196
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2709351	2711384	4838808		Tupanvirus(50.0%)	2	NA	NA
WP_001173673.1|2709351_2709957_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
WP_001090348.1|2709956_2711384_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	2.2e-30
>prophage 197
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2735844	2736630	4838808		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|2735844_2736630_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 198
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2741530	2746450	4838808		Vibrio_phage(33.33%)	4	NA	NA
WP_001199973.1|2741530_2742202_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288227.1|2742340_2742481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000036723.1|2743426_2744725_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|2744812_2746450_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 199
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2750482	2754597	4838808		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_000046785.1|2750482_2751784_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
WP_000186450.1|2751840_2754597_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 200
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2762131	2762980	4838808		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|2762131_2762980_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 201
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2767838	2768594	4838808		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2767838_2768594_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 202
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2780120	2795505	4838808	tRNA	environmental_halophage(16.67%)	9	NA	NA
WP_073520500.1|2780120_2781326_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	2.3e-73
WP_000184253.1|2781325_2781769_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|2781819_2782626_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|2782702_2783800_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|2784377_2785631_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|2785862_2787194_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|2787255_2789082_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_073520501.1|2789081_2792624_-	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.8	1.2e-08
WP_001138213.1|2792616_2795505_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.6	1.2e-67
>prophage 203
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2800982	2807755	4838808		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|2800982_2801777_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|2801783_2802659_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957914.1|2802809_2805056_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|2805068_2805599_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082188.1|2806283_2806973_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|2807041_2807755_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 204
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2817386	2819881	4838808		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|2817386_2818805_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603508.1|2819119_2819881_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	4.5e-19
>prophage 205
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2842287	2843043	4838808		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2842287_2843043_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 206
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2867322	2882714	4838808	tRNA	environmental_Halophage(14.29%)	14	NA	NA
WP_001280215.1|2867322_2868723_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001295158.1|2868740_2870057_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|2870092_2871460_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|2871495_2871984_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001345944.1|2871983_2873903_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|2874338_2875787_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|2875788_2875914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|2875910_2875982_-	protein YqfH	NA	NA	NA	NA	NA
WP_001192814.1|2876036_2876585_+	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000003068.1|2876627_2878145_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|2878154_2879253_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813215.1|2879343_2881077_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_000715214.1|2881082_2881793_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|2881817_2882714_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 207
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2887798	2893166	4838808		Pandoravirus(50.0%)	3	NA	NA
WP_001387034.1|2887798_2889232_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	26.1	4.4e-31
WP_000951964.1|2889288_2890032_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000195023.1|2890292_2893166_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
>prophage 208
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2901694	2902927	4838808		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|2901694_2902927_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 209
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2920978	2921656	4838808		Bacillus_virus(100.0%)	1	NA	NA
WP_000956868.1|2920978_2921656_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	6.4e-09
>prophage 210
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2935232	2936387	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2935232_2936387_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 211
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2959177	2960443	4838808	integrase	Pseudomonas_phage(100.0%)	1	2950797:2950810	2961568:2961581
2950797:2950810	attL	TATAACCGTCAATA	NA	NA	NA	NA
WP_001218789.1|2959177_2960443_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.7e-79
WP_001218789.1|2959177_2960443_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.7e-79
2961568:2961581	attR	TATAACCGTCAATA	NA	NA	NA	NA
>prophage 212
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2971062	2972918	4838808		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502847.1|2971062_2971701_-	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.0	3.3e-55
WP_050188206.1|2971685_2972918_-	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.3	2.0e-61
>prophage 213
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	2981852	2991019	4838808		Escherichia_phage(100.0%)	3	NA	NA
WP_001406120.1|2981852_2982371_-	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	98.3	6.1e-84
WP_073520507.1|2982430_2990356_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	81.3	0.0e+00
WP_001535963.1|2990386_2991019_-	helix-turn-helix transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	54.3	1.5e-60
>prophage 214
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3012250	3015286	4838808		Pseudomonas_phage(50.0%)	5	NA	NA
WP_073520518.1|3012250_3013072_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.2	1.2e-46
WP_000855079.1|3013373_3013847_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.5	2.5e-12
WP_001186771.1|3013862_3014339_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692315.1|3014401_3014623_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	8.5e-11
WP_073520519.1|3014641_3015286_+	antitoxin of toxin-antitoxin stability system	NA	A0A2I6PI07	Pseudomonas_phage	32.7	2.7e-25
>prophage 215
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3050253	3051426	4838808		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|3050253_3051426_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 216
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3074918	3075803	4838808		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3074918_3075803_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 217
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3081879	3092703	4838808		Staphylococcus_phage(25.0%)	9	NA	NA
WP_000013149.1|3081879_3082707_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691598.1|3082906_3083833_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3083883_3084141_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3084183_3086403_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059395.1|3086513_3087926_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965712.1|3088000_3088738_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3088971_3091230_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
WP_000183494.1|3091775_3092258_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000712658.1|3092310_3092703_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 218
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3096530	3107492	4838808		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3096530_3098423_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3098451_3099033_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3099032_3099860_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3099884_3100307_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3100307_3100937_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3101141_3102623_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3102770_3103442_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3103447_3104608_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_024184509.1|3104645_3105434_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3105576_3106350_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3106407_3106578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3106838_3107492_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 219
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3117007	3118441	4838808		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|3117007_3118441_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 220
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3123578	3124817	4838808	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708500.1|3123578_3124817_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 221
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3131200	3147377	4838808	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_001264365.1|3131200_3132214_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
WP_001144069.1|3132450_3132666_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3132776_3134522_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437371.1|3134716_3136558_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3136629_3137136_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001065895.1|3137389_3138154_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3138430_3139054_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094682.1|3139207_3140728_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_001297164.1|3141145_3142525_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000450589.1|3142566_3142899_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212470.1|3143117_3144101_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082869.1|3144284_3147377_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.6e-158
>prophage 222
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3159798	3160764	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3159798_3160764_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 223
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3186779	3189074	4838808		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3186779_3189074_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 224
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3197060	3198206	4838808		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3197060_3198206_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 225
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3221215	3229008	4838808		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|3221215_3222076_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249149.1|3222139_3224176_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246855.1|3224133_3224529_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3224548_3225139_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646043.1|3225148_3225724_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147622.1|3225837_3226878_-	permease	NA	NA	NA	NA	NA
WP_001315854.1|3226950_3227586_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3227713_3228232_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449451.1|3228211_3228655_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189371.1|3228705_3229008_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	1.7e-14
>prophage 226
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3234835	3236725	4838808		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001297428.1|3234835_3236725_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 227
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3242206	3248845	4838808		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3242206_3244879_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|3244903_3246391_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3246418_3246871_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207685.1|3247501_3248845_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 228
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3252925	3255798	4838808	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3252925_3253774_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3253863_3255798_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 229
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3262426	3263904	4838808		Indivirus(50.0%)	2	NA	NA
WP_001047336.1|3262426_3263398_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3263625_3263904_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 230
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3267972	3282767	4838808		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3267972_3268782_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922861.1|3268991_3269969_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3269982_3270969_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030016.1|3270989_3271556_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3271552_3272128_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3272096_3272654_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3272660_3273386_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809051.1|3273433_3274867_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3274889_3275177_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3275294_3275786_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3275831_3276686_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3276682_3276955_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|3277168_3277801_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3277797_3278526_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001299134.1|3278522_3279176_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|3279405_3281742_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|3281837_3282767_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 231
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3292463	3293954	4838808		Burkholderia_virus(100.0%)	1	NA	NA
WP_000108459.1|3292463_3293954_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 232
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3297658	3298156	4838808	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3297658_3298156_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 233
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3302122	3304647	4838808	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3302122_3303490_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3303579_3304647_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 234
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3321423	3322467	4838808		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3321423_3322467_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 235
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3333032	3333917	4838808		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258900.1|3333032_3333917_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.1e-24
>prophage 236
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3340421	3344575	4838808		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738579.1|3340421_3341447_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	2.4e-71
WP_000019674.1|3341514_3342696_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001299298.1|3342705_3343809_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078338.1|3343816_3344575_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
>prophage 237
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3354813	3356285	4838808	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|3354813_3355323_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004479.1|3355337_3356285_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 238
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3376162	3381736	4838808		Tupanvirus(33.33%)	7	NA	NA
WP_000031783.1|3376162_3377347_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3377417_3379532_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3379628_3380099_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3380195_3380570_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903377.1|3380695_3380983_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820720.1|3380990_3381350_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001209689.1|3381349_3381736_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.1	3.3e-18
>prophage 239
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3387306	3396847	4838808		Tupanvirus(25.0%)	9	NA	NA
WP_000634810.1|3387306_3389220_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.3	2.1e-73
WP_000057405.1|3389219_3390242_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|3390235_3390454_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|3390507_3391377_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3391431_3391836_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3392137_3392770_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|3392820_3394911_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963784.1|3394977_3396198_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|3396283_3396847_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 240
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3421082	3421919	4838808		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3421082_3421919_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 241
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3438894	3443405	4838808		Bacillus_phage(66.67%)	5	NA	NA
WP_001265681.1|3438894_3440517_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_000493756.1|3440633_3440951_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000650976.1|3441009_3441306_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001253696.1|3441336_3442689_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3442685_3443405_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 242
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3449968	3450847	4838808		Sodalis_phage(100.0%)	1	NA	NA
WP_000039057.1|3449968_3450847_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.4	4.7e-68
>prophage 243
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3456816	3459210	4838808		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3456816_3459210_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 244
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3463589	3464816	4838808		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105435.1|3463589_3464816_-	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	59.3	6.4e-132
>prophage 245
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3474043	3476491	4838808		Dickeya_phage(100.0%)	1	NA	NA
WP_000993449.1|3474043_3476491_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 246
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3486821	3488918	4838808		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000410810.1|3486821_3488918_-	RecQ family ATP-dependent DNA helicase	NA	F2NZ48	Diadromus_pulchellus_ascovirus	33.8	6.1e-42
>prophage 247
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3499928	3501739	4838808		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073584.1|3499928_3500672_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	24.9	2.9e-10
WP_000907797.1|3500668_3501739_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 248
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3505279	3506762	4838808		Planktothrix_phage(50.0%)	2	NA	NA
WP_000416895.1|3505279_3505993_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
WP_000082101.1|3505994_3506762_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 249
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3512495	3515314	4838808		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|3512495_3513350_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|3513594_3514653_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|3514645_3515314_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 250
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3518317	3522449	4838808		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|3518317_3518944_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106506.1|3519017_3521216_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	8.5e-119
WP_000130621.1|3521317_3521563_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100467.1|3521783_3522449_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
>prophage 251
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3530342	3536225	4838808		Bacillus_virus(50.0%)	5	NA	NA
WP_000173666.1|3530342_3531149_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
WP_001190062.1|3531154_3531556_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000593555.1|3531675_3532035_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001216257.1|3532365_3533490_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000149132.1|3533489_3536225_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	4.1e-22
>prophage 252
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3549637	3551680	4838808		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|3549637_3551680_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 253
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3554794	3556929	4838808		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|3554794_3555148_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_001324556.1|3555201_3556491_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	1.7e-172
WP_000065769.1|3556503_3556929_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 254
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3561798	3562446	4838808		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|3561798_3562446_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 255
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3609425	3611410	4838808		Bacillus_virus(50.0%)	2	NA	NA
WP_073520530.1|3609425_3610430_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.4	1.5e-17
WP_001196496.1|3610426_3611410_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
>prophage 256
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3621467	3623801	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_000013916.1|3621467_3623801_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	1.1e-71
>prophage 257
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3627455	3627668	4838808		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|3627455_3627668_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 258
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3631892	3632888	4838808		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|3631892_3632888_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 259
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3638206	3639748	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|3638206_3639748_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 260
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3664023	3672426	4838808	tRNA	Tupanvirus(50.0%)	4	NA	NA
WP_000582465.1|3664023_3665868_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.8e-16
WP_000206275.1|3665864_3667256_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_000779792.1|3667353_3667962_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_073520533.1|3668190_3672426_+	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 261
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3696843	3706350	4838808		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|3696843_3697095_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001297451.1|3697236_3697668_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116566.1|3697912_3699457_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|3699466_3700750_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483860.1|3700753_3701713_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982104.1|3701699_3702734_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000646014.1|3702972_3703998_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213834.1|3704007_3705204_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000587750.1|3705417_3706350_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	8.5e-36
>prophage 262
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3710813	3711839	4838808		Archaeal_BJ1_virus(100.0%)	1	NA	NA
WP_000364782.1|3710813_3711839_-	UDP-galactose--(galactosyl) LPS alpha1,2-galactosyltransferase	NA	A0ZYL4	Archaeal_BJ1_virus	25.5	1.4e-10
>prophage 263
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3719277	3723840	4838808		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171866.1|3719277_3719757_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
WP_001114533.1|3719795_3720605_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|3720702_3720870_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|3720890_3721127_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_039022934.1|3721343_3722012_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|3722183_3723404_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|3723381_3723840_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 264
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3727213	3733964	4838808		Morganella_phage(25.0%)	6	NA	NA
WP_001299758.1|3727213_3728038_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	6.9e-90
WP_000924289.1|3728329_3728947_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_073520536.1|3728943_3730626_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	5.7e-22
WP_001295237.1|3730883_3731507_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|3731561_3731837_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|3731855_3733964_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 265
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3738397	3739789	4838808		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|3738397_3739789_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 266
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3751907	3753242	4838808		Moraxella_phage(100.0%)	1	NA	NA
WP_001349999.1|3751907_3753242_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	6.6e-66
>prophage 267
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3760546	3769708	4838808		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168480.1|3760546_3762235_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	4.2e-57
WP_001315912.1|3762340_3762439_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000060506.1|3763003_3763093_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|3763511_3764696_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148063.1|3764703_3765201_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|3765197_3765560_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|3765549_3765897_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511287.1|3766006_3766456_+	membrane protein	NA	NA	NA	NA	NA
WP_000828483.1|3766502_3767996_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_001087147.1|3767992_3769708_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 268
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3776061	3777015	4838808		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|3776061_3776490_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|3776601_3777015_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 269
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3781442	3782591	4838808		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|3781442_3782591_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 270
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3787297	3794666	4838808		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|3787297_3789712_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060118.1|3789740_3790814_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|3790813_3791914_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|3791918_3793322_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|3793618_3793699_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|3793928_3794069_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|3794085_3794445_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|3794408_3794666_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 271
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3804865	3806203	4838808		Moraxella_phage(100.0%)	1	NA	NA
WP_001299598.1|3804865_3806203_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 272
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3817194	3821035	4838808		Bacillus_phage(50.0%)	4	NA	NA
WP_000063125.1|3817194_3817968_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251991.1|3818058_3818949_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741620.1|3818948_3819908_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|3819994_3821035_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
>prophage 273
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3826566	3829928	4838808		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334099.1|3826566_3828396_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_000933736.1|3828557_3829928_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
>prophage 274
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3841880	3842873	4838808		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845133.1|3841880_3842873_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.3	6.5e-50
>prophage 275
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3846041	3851894	4838808		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|3846041_3847910_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001297694.1|3848076_3848496_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387753.1|3848503_3850009_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	4.6e-15
WP_000211858.1|3850013_3850979_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|3851003_3851894_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 276
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3865283	3866930	4838808		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012602.1|3865283_3866930_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.6	1.4e-65
>prophage 277
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3875403	3880815	4838808		Bacillus_phage(33.33%)	4	NA	NA
WP_001238869.1|3875403_3877425_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
WP_001299253.1|3877471_3878956_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|3879089_3880355_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|3880485_3880815_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 278
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3884857	3891001	4838808		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000866673.1|3884857_3885988_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	1.9e-26
WP_000006625.1|3885984_3887247_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226604.1|3887246_3888314_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000676056.1|3888332_3889214_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001145193.1|3889191_3889866_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612044.1|3889870_3891001_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 279
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3907280	3910099	4838808		Salmonella_phage(100.0%)	2	NA	NA
WP_000678267.1|3907280_3908594_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	34.1	5.2e-07
WP_001352855.1|3908590_3910099_-	hypothetical protein	NA	A0A0U2C3T4	Salmonella_phage	54.7	1.8e-43
>prophage 280
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3913105	3916964	4838808		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|3913105_3914002_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|3914001_3914718_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|3914801_3916964_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 281
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3924448	3926278	4838808		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|3924448_3926278_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 282
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3938690	3941977	4838808		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|3938690_3940331_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_001295260.1|3940409_3940679_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|3940682_3941198_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|3941200_3941977_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 283
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3950767	3951382	4838808		Streptococcus_phage(100.0%)	1	NA	NA
WP_001301303.1|3950767_3951382_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 284
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3965069	3967856	4838808		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|3965069_3967856_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 285
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3971934	3974405	4838808		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188776.1|3971934_3973344_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|3973355_3974405_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 286
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	3990628	3993408	4838808		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718896.1|3990628_3991525_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	9.6e-61
WP_000621656.1|3991692_3992589_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|3992622_3993408_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 287
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4002263	4005314	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|4002263_4005314_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 288
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4020089	4020710	4838808		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_001297064.1|4020089_4020710_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 289
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4024160	4026229	4838808		Bacillus_phage(50.0%)	2	NA	NA
WP_000580417.1|4024160_4025534_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033722.1|4025530_4026229_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 290
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4037803	4042306	4838808		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|4037803_4038649_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4039073_4039319_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4039403_4039889_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001307494.1|4039981_4040908_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293343.1|4040974_4042306_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 291
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4047943	4052038	4838808		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_077897339.1|4047943_4052038_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	3.5e-25
>prophage 292
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4064996	4072243	4838808		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424845.1|4064996_4065659_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174096.1|4065670_4068172_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.8e-11
WP_001004446.1|4068480_4069560_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|4069574_4069895_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184826.1|4069945_4072243_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 293
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4084361	4085576	4838808		Oenococcus_phage(100.0%)	1	NA	NA
WP_000690934.1|4084361_4085576_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	28.6	5.9e-45
>prophage 294
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4092326	4094171	4838808		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|4092326_4094171_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 295
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4102769	4105822	4838808		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4102769_4103720_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4104637_4105822_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 296
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4109938	4118267	4838808		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4109938_4113967_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4114043_4118267_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 297
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4127482	4129246	4838808		Klosneuvirus(50.0%)	3	NA	NA
WP_000362392.1|4127482_4128154_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|4128196_4128787_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4128973_4129246_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 298
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4134614	4136204	4838808		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187566.1|4134614_4136204_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	1.3e-68
>prophage 299
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4151581	4155265	4838808		Dickeya_phage(100.0%)	1	NA	NA
WP_000096010.1|4151581_4155265_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 300
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4160915	4161707	4838808		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130538.1|4160915_4161707_+	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	1.5e-46
>prophage 301
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4177514	4178630	4838808		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4177514_4178630_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 302
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4187845	4188454	4838808		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4187845_4188454_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 303
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4195050	4197598	4838808		Escherichia_phage(50.0%)	2	NA	NA
WP_000918363.1|4195050_4196466_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|4196518_4197598_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 304
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4201805	4205418	4838808		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|4201805_4204628_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|4204881_4205418_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 305
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4209235	4210585	4838808		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|4209235_4210585_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 306
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4216169	4218128	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|4216169_4218128_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 307
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4227410	4229558	4838808		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|4227410_4229558_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 308
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4234803	4236789	4838808		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|4234803_4236789_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 309
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4240773	4242389	4838808		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611420.1|4240773_4241454_-	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
WP_001039800.1|4241630_4242389_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
>prophage 310
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4247993	4248782	4838808		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|4247993_4248782_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 311
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4253621	4255124	4838808		Burkholderia_virus(100.0%)	1	NA	NA
WP_001676851.1|4253621_4255124_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 312
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4276319	4279531	4838808	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|4276319_4277837_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856834.1|4278073_4279531_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.6	1.8e-48
>prophage 313
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4293808	4295792	4838808		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|4293808_4294102_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|4294145_4295792_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 314
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4301577	4302111	4838808		Morganella_phage(100.0%)	1	NA	NA
WP_001238369.1|4301577_4302111_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 315
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4307031	4308009	4838808		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|4307031_4308009_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 316
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4315992	4316538	4838808		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001358360.1|4315992_4316538_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	1.7e-28
>prophage 317
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4320574	4387794	4838808	protease,transposase,tRNA	Vibrio_phage(23.08%)	67	NA	NA
WP_000990321.1|4320574_4321912_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122507.1|4321921_4323769_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|4323761_4324712_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|4324797_4325106_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|4325181_4326462_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|4326547_4327807_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|4327809_4328814_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|4328895_4329093_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|4329196_4330495_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177644.1|4330699_4331125_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076316.1|4331163_4333605_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001293282.1|4333784_4334516_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_073520546.1|4334642_4335044_+	DUF2170 family protein	NA	NA	NA	NA	NA
WP_000511955.1|4335062_4335761_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000012556.1|4335811_4336471_+	YjfK family protein	NA	NA	NA	NA	NA
WP_000547764.1|4336488_4336887_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000101654.1|4336896_4337535_+	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_073520547.1|4337537_4338701_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	9.2e-80
WP_001339483.1|4338784_4340410_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4340526_4340802_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4340950_4341280_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569708.1|4341461_4342211_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4342207_4342963_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001295191.1|4343070_4344135_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001300695.1|4344489_4345887_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4345902_4346208_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_000776505.1|4346217_4346682_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4346695_4347346_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|4347355_4348210_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170812.1|4348209_4348896_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000996728.1|4348992_4349544_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4349618_4349894_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4350220_4350616_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4350622_4350937_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4350941_4351169_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4351210_4351660_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001351393.1|4351730_4352525_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_000604912.1|4353147_4353579_-|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.9e-43
WP_001367946.1|4353586_4354795_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	9.2e-208
WP_001119478.1|4354929_4355568_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211225.1|4355786_4356407_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228343.1|4356715_4358128_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4358172_4358835_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001351395.1|4358942_4359908_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560552.1|4360016_4360877_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4360965_4361346_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000589460.1|4361474_4363418_-	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000886909.1|4363607_4364348_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000175289.1|4364337_4364895_-	YtfJ family protein	NA	NA	NA	NA	NA
WP_000689228.1|4365219_4365426_+	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000935042.1|4365487_4366831_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001295196.1|4367153_4367792_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_001269327.1|4367997_4369731_+	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_000060936.1|4369727_4373507_+	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001219160.1|4373509_4373851_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000055072.1|4374230_4374761_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265912.1|4375070_4376027_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210559.1|4376166_4377669_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.4e-11
WP_001351397.1|4377682_4378705_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|4378691_4379687_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|4379719_4380718_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_001219795.1|4380893_4382267_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000166270.1|4382422_4382974_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_000852988.1|4383067_4384420_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232261.1|4384602_4384989_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|4385033_4385498_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|4385655_4387794_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
>prophage 318
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4391432	4397889	4838808	transposase	Paramecium_bursaria_Chlorella_virus(66.67%)	7	NA	NA
WP_001181337.1|4391432_4392380_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4392564_4392618_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471866.1|4392758_4395455_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001118337.1|4395499_4395955_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000047539.1|4396020_4396407_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4396479_4396941_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4396953_4397889_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 319
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4406166	4416329	4838808	tRNA	Klosneuvirus(25.0%)	7	NA	NA
WP_000416392.1|4406166_4409022_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
WP_000786399.1|4409021_4409465_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|4409598_4411110_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_073520548.1|4411376_4412477_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001386017.1|4412476_4413559_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_073520549.1|4413677_4415180_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	1.4e-83
WP_001382682.1|4415309_4416329_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	4.2e-44
>prophage 320
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4421274	4422831	4838808		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024232412.1|4421274_4422831_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	1.7e-105
>prophage 321
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4426634	4427615	4838808		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001366032.1|4426634_4427615_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	56.2	9.4e-102
>prophage 322
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4430977	4432654	4838808		Escherichia_phage(100.0%)	2	NA	NA
WP_000790583.1|4430977_4431580_+	type 1 fimbria switch DNA invertase FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
WP_000044711.1|4432057_4432654_+	type 1 fimbria switch DNA invertase FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
>prophage 323
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4442920	4444381	4838808		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_044687138.1|4442920_4444381_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	1.6e-49
>prophage 324
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4450948	4451503	4838808		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151864.1|4450948_4451503_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 325
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4459004	4459949	4838808	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000181170.1|4459004_4459949_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.7	5.9e-61
>prophage 326
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4479920	4485285	4838808		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919567.1|4479920_4481585_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410127.1|4481633_4482995_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|4483209_4484124_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|4484262_4485285_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 327
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4488511	4489791	4838808		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|4488511_4489249_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|4489251_4489791_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 328
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4497982	4573463	4838808	lysis,protease,tail,integrase,terminase,tRNA,portal	Escherichia_phage(39.29%)	80	4490524:4490539	4515666:4515681
4490524:4490539	attL	CAGCAGAACGCTGGCG	NA	NA	NA	NA
WP_001680166.1|4497982_4499206_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.8	7.6e-234
WP_001419254.1|4499462_4501163_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001377405.1|4501595_4502216_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001242749.1|4502215_4502578_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001401560.1|4502568_4503105_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_001763729.1|4503233_4504058_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_000135682.1|4504123_4504486_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000848748.1|4505152_4505827_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4505917_4506118_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000521508.1|4506161_4506713_+	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_001446923.1|4506709_4507546_+	ash family protein	NA	A0A291AWU3	Escherichia_phage	100.0	1.0e-152
WP_000933942.1|4507538_4507775_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_029365219.1|4507771_4508590_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	5.2e-122
WP_001373594.1|4508586_4509081_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	100.0	3.9e-88
WP_000210170.1|4509080_4509407_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001398927.1|4509403_4509793_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	100.0	5.4e-69
WP_001061444.1|4509812_4510622_+	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001360050.1|4510629_4511619_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_073520553.1|4511632_4512385_+	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	99.6	1.1e-137
WP_000217632.1|4512665_4513091_+	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_000917724.1|4513314_4513518_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_029365220.1|4513668_4514721_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	3.6e-208
WP_000839596.1|4514788_4515004_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|4515003_4515501_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|4515497_4515965_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
4515666:4515681	attR	CGCCAGCGTTCTGCTG	NA	NA	NA	NA
WP_001139675.1|4515952_4516105_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_001205130.1|4516246_4516423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373425.1|4516780_4517275_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934119.1|4517274_4519377_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	98.9	0.0e+00
WP_001072975.1|4519373_4519586_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001613114.1|4519585_4521094_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	1.2e-286
WP_085947433.1|4521038_4523066_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|4523152_4523476_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4523468_4523744_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|4523755_4524334_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|4524330_4524732_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|4524743_4525487_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001300035.1|4525547_4525934_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_001161009.1|4525942_4526272_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000371987.1|4526243_4529309_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.2	0.0e+00
WP_000447248.1|4529308_4529638_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001152385.1|4529647_4530346_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_001341212.1|4530351_4531095_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	2.3e-148
WP_073520555.1|4530992_4531640_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.0	2.6e-108
WP_073520556.1|4531700_4535198_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.9	0.0e+00
WP_001233090.1|4535268_4535868_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_073520572.1|4535932_4539211_+|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.5e-06
WP_073520557.1|4539210_4539795_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	5.4e-105
WP_029365257.1|4540239_4541844_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_001217545.1|4542201_4542462_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	8.1e-37
WP_000202564.1|4542681_4544268_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|4544660_4545266_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|4545392_4545554_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|4545675_4546749_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563068.1|4546745_4547528_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088405.1|4547640_4548504_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_073520558.1|4548475_4550026_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|4550283_4551063_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|4551189_4552512_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
WP_000816471.1|4552563_4553787_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|4553866_4554586_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000566138.1|4554860_4555010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105865.1|4555041_4556058_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|4556085_4556730_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132955.1|4556835_4557804_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|4557852_4559235_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093808.1|4559255_4560488_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.9	9.4e-83
WP_000046749.1|4560794_4562462_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|4562672_4564610_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|4564699_4565026_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001338221.1|4565067_4565580_-	inosine/xanthosine triphosphatase	NA	NA	NA	NA	NA
WP_000942344.1|4565631_4566279_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|4566275_4567145_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|4567355_4567829_+	protein CreA	NA	NA	NA	NA	NA
WP_001188659.1|4567841_4568531_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
WP_001219611.1|4568530_4569955_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_000920337.1|4570012_4571365_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|4571424_4572141_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|4572236_4572377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223177.1|4572776_4573463_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 329
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4583001	4592070	4838808		Cyanophage(20.0%)	9	NA	NA
WP_000130189.1|4583001_4583955_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|4584069_4584657_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|4584691_4585258_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102379.1|4585406_4586120_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843559.1|4586145_4586550_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|4586926_4588843_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|4588931_4590062_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000935262.1|4590165_4590375_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_000681360.1|4590903_4592070_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
>prophage 330
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4599079	4601896	4838808	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|4599079_4601896_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 331
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4606302	4607451	4838808		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|4606302_4607451_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 332
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4612921	4618582	4838808		Hepacivirus(50.0%)	4	NA	NA
WP_001297614.1|4612921_4614475_-	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	4.7e-31
WP_000349932.1|4614548_4615766_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|4615894_4617037_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|4617067_4618582_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 333
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4626476	4627876	4838808		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|4626476_4626956_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257186.1|4627033_4627876_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 334
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4635620	4641043	4838808		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|4635620_4638527_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035654.1|4638691_4641043_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 335
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4647375	4648074	4838808		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916310.1|4647375_4648074_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	36.7	2.3e-22
>prophage 336
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4660776	4662501	4838808		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425658.1|4660776_4662501_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 337
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4689753	4690797	4838808		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|4689753_4690797_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 338
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4695042	4695594	4838808		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|4695042_4695594_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 339
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4704220	4705645	4838808		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|4704220_4705645_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 340
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4713294	4719762	4838808		Mamastrovirus(33.33%)	5	NA	NA
WP_001189608.1|4713294_4714845_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001349940.1|4714891_4717282_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|4717487_4718024_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|4718064_4718727_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|4718835_4719762_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 341
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4723024	4723927	4838808		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|4723024_4723927_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 342
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4733833	4740639	4838808	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|4733833_4735252_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937432.1|4735290_4736217_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|4736253_4736709_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|4736886_4737591_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|4737605_4738136_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001378710.1|4738209_4740639_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
>prophage 343
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4745882	4746680	4838808		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|4745882_4746680_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 344
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4752591	4752936	4838808		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|4752591_4752936_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 345
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4756865	4758290	4838808	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753945.1|4756865_4758290_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 346
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4770174	4770933	4838808		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|4770174_4770933_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 347
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4779761	4783877	4838808		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|4779761_4780358_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|4780394_4783877_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 348
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4798113	4799145	4838808		Planktothrix_phage(100.0%)	1	NA	NA
WP_000593994.1|4798113_4799145_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
>prophage 349
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4805659	4813512	4838808		Indivirus(25.0%)	9	NA	NA
WP_000997037.1|4805659_4806463_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_000648576.1|4806459_4807374_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|4807614_4808415_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211727.1|4808492_4809263_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|4809310_4810669_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052720.1|4810740_4811496_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_073520561.1|4811529_4812252_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|4812248_4812716_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001297205.1|4812780_4813512_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
>prophage 350
NZ_CP010236	Escherichia coli strain S42 chromosome, complete genome	4838808	4823985	4826751	4838808		Cronobacter_phage(100.0%)	1	NA	NA
WP_000614399.1|4823985_4826751_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
