The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	0	38489	4735489	portal,transposase,head,capsid,lysis,integrase,terminase,tail	Enterobacteria_phage(58.0%)	53	5345:5360	41749:41764
WP_000090917.1|2157_2790_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_047088332.1|2726_3470_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_001152538.1|3475_4174_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.1e-131
WP_073508520.1|4173_4503_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	3.1e-57
WP_073508521.1|4499_7061_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
5345:5360	attL	ATTTTGCCCGTTGCTG	NA	NA	NA	NA
WP_000459457.1|7053_7488_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479193.1|7469_7892_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_001317730.1|7907_8648_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_073508522.1|8655_9051_-|tail	phage tail protein	tail	A0A2R9YJI2	Escherichia_phage	97.7	3.2e-69
WP_000975081.1|9047_9626_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|9637_9991_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|10002_10398_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063254.1|10439_11465_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.2	2.8e-189
WP_073508523.1|11520_11853_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	4.2e-54
WP_000123309.1|11862_13182_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.1	7.4e-235
WP_072841936.1|13162_14764_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.2e-308
WP_000198149.1|14760_14967_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027268.1|14963_16889_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|16863_17409_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001663509.1|17797_18031_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000079508.1|18087_18498_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|18849_19002_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|18989_19457_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_073508524.1|19453_19951_-	lysozyme RrrD	NA	A5LH83	Enterobacteria_phage	98.8	1.9e-90
WP_000839596.1|19950_20166_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_073508525.1|20739_21822_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	79.0	2.6e-161
WP_001204791.1|22010_22394_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971074.1|22479_22620_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	6.5e-09
WP_001099712.1|22616_22979_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774476.1|22975_23266_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_000224914.1|23258_23429_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_073508526.1|23428_23884_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	69.5	2.0e-62
WP_073508527.1|23880_23982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187655762.1|24121_25349_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_000068668.1|25416_26346_-	hypothetical protein	NA	A0A1R3Y6Z6	Salmonella_virus	40.0	3.0e-57
WP_073508529.1|26550_27153_-	hypothetical protein	NA	Q7Y5X0	Haemophilus_phage	42.1	3.7e-32
WP_032227093.1|27748_28153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508531.1|28555_29050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508532.1|29196_29370_-	MarR family transcriptional regulator	NA	A0A0N6WES4	Escherichia_phage	96.4	9.8e-23
WP_000788793.1|29366_30068_-	Replication protein 14	NA	M1FJ72	Enterobacteria_phage	97.4	2.7e-127
WP_077694507.1|30064_31084_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	9.7e-110
WP_001182899.1|31080_31620_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|31689_31920_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|32024_32714_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000995439.1|33592_33889_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|33894_34680_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_021546785.1|34676_35357_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	97.8	1.5e-130
WP_000682303.1|35353_35512_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	100.0	3.1e-23
WP_000581108.1|35508_36261_+	hypothetical protein	NA	M1FN76	Enterobacteria_phage	99.6	8.4e-151
WP_000151207.1|36268_36484_+	hypothetical protein	NA	M1FPM2	Enterobacteria_phage	97.2	8.5e-32
WP_000763385.1|36582_36801_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|36848_37127_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001299447.1|37325_38489_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	3.4e-199
41749:41764	attR	ATTTTGCCCGTTGCTG	NA	NA	NA	NA
>prophage 2
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	45579	48710	4735489	tRNA	Enterococcus_phage(50.0%)	4	NA	NA
WP_000729160.1|45579_46446_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|46447_46660_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|46767_47289_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912345.1|47324_48710_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 3
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	60188	61334	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_000706355.1|60188_61334_-	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.9	1.8e-48
>prophage 4
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	67525	69307	4735489		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096878.1|67525_69307_-	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.1	2.1e-38
>prophage 5
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	74563	83498	4735489		uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_001306947.1|74563_75274_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.2e-19
WP_000877768.1|75273_75642_-	YbbC/YhhH family protein	NA	NA	NA	NA	NA
WP_073508533.1|75681_79971_-	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	41.5	2.1e-20
WP_000561844.1|80400_82815_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001110573.1|82811_83498_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
>prophage 6
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	86634	87312	4735489		Bacillus_virus(100.0%)	1	NA	NA
WP_001157535.1|86634_87312_-	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	2.4e-27
>prophage 7
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	91851	94811	4735489		uncultured_virus(50.0%)	2	NA	NA
WP_000078266.1|91851_94356_+	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.2	2.9e-115
WP_001361120.1|94469_94811_-	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	73.6	3.9e-39
>prophage 8
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	103055	111617	4735489		Acanthamoeba_polyphaga_moumouvirus(25.0%)	8	NA	NA
WP_000801832.1|103055_104015_+	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	1.1e-14
WP_001250088.1|104011_104974_-	ferrochelatase	NA	NA	NA	NA	NA
WP_001220233.1|105209_105854_-	adenylate kinase	NA	NA	NA	NA	NA
WP_000678208.1|106034_107909_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001195025.1|108018_108624_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_000467098.1|108623_108953_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_000122008.1|109005_110937_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000127356.1|111065_111617_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
>prophage 9
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	118625	121775	4735489		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|118625_121775_+	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 10
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	130610	134157	4735489		Bacillus_phage(100.0%)	2	NA	NA
WP_001256180.1|130610_132392_-	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	1.1e-42
WP_001235608.1|132384_134157_-	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	2.6e-49
>prophage 11
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	137480	138176	4735489		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817229.1|137480_138176_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	1.9e-88
>prophage 12
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	141304	146351	4735489	protease	Bacillus_phage(25.0%)	4	NA	NA
WP_001043542.1|141304_141577_-	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
WP_001295325.1|141785_144140_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_000130305.1|144327_145602_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_000122253.1|145727_146351_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
>prophage 13
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	170182	179163	4735489	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_001021161.1|170182_170653_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
WP_001150472.1|170741_171845_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.5	5.3e-53
WP_000543535.1|171848_172298_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001295327.1|172448_172988_+	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_001295328.1|173286_174171_+	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000974813.1|174347_174695_-	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_000046637.1|174823_175795_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000934822.1|175805_177653_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000007629.1|177680_178013_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000667319.1|178035_179163_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	2.1e-89
>prophage 14
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	186115	196087	4735489		Bacillus_phage(60.0%)	7	NA	NA
WP_000893603.1|186115_187411_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_000113933.1|187468_188158_-	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_001221332.1|188347_189550_+	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	1.8e-06
WP_000698879.1|189546_192690_+	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001345723.1|192815_194000_+	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_001219320.1|194142_195051_-	fructokinase	NA	NA	NA	NA	NA
WP_001298537.1|195175_196087_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
>prophage 15
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	200376	201492	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_000484055.1|200376_201492_-	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.5e-18
>prophage 16
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	208906	210064	4735489		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|208906_210064_+	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 17
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	217029	217797	4735489		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939349.1|217029_217797_-	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-25
>prophage 18
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	223094	224204	4735489		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000842102.1|223094_224204_+	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 19
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	227282	229243	4735489		Micromonas_sp._RCC1109_virus(50.0%)	2	NA	NA
WP_001013499.1|227282_228296_-	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
WP_000044314.1|228292_229243_-	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
>prophage 20
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	234653	238933	4735489		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000805902.1|234653_235736_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
WP_000177918.1|235858_238933_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.1	0.0e+00
>prophage 21
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	242773	248368	4735489		Lactobacillus_phage(50.0%)	4	NA	NA
WP_000952485.1|242773_243673_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
WP_001299008.1|243712_244996_-	cytosine/isoguanine deaminase	NA	NA	NA	NA	NA
WP_000076236.1|244985_246245_-	cytosine permease	NA	NA	NA	NA	NA
WP_000010284.1|246481_248368_-	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	2.4e-53
>prophage 22
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	256748	261286	4735489		Acanthamoeba_polyphaga_mimivirus(50.0%)	4	NA	NA
WP_000692742.1|256748_257798_-	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.3	1.1e-71
WP_000750340.1|257884_258841_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000818900.1|258837_259809_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000447344.1|259801_261286_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.8	8.0e-12
>prophage 23
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	273280	283756	4735489	holin	Escherichia_phage(33.33%)	5	NA	NA
WP_001585377.1|273280_277264_-	autotransporter adhesin EhaA	NA	A0A2L1IV18	Escherichia_phage	38.0	1.2e-123
WP_047657037.1|277836_279870_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|279998_280586_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089077.1|280599_282072_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|282085_283756_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
>prophage 24
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	289331	290657	4735489		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046295.1|289331_290657_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	8.5e-114
>prophage 25
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	310848	318430	4735489		Streptococcus_phage(50.0%)	6	NA	NA
WP_000667026.1|310848_313047_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
WP_000121330.1|313056_314013_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|313991_314402_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000893255.1|314718_315972_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_001285288.1|315983_317087_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|317374_318430_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 26
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	323107	324247	4735489		Mycobacterium_phage(100.0%)	1	NA	NA
WP_032240043.1|323107_324247_-	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.5	1.3e-30
>prophage 27
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	329325	333244	4735489		Clostridioides_phage(50.0%)	6	NA	NA
WP_000543899.1|329325_330099_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729704.1|330284_330545_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615982.1|330547_330826_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|330981_331722_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|331692_332460_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|332665_333244_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
>prophage 28
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	337409	412271	4735489	plate,protease,tRNA,transposase	uncultured_Caudovirales_phage(18.18%)	58	NA	NA
WP_073508538.1|337409_338546_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001350058.1|339416_339854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508539.1|339813_343875_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.9	4.4e-20
WP_000103361.1|343950_346092_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_001142958.1|346301_346820_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037391.1|347516_348017_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|348051_348276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611742.1|349808_350222_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393845.1|350225_352076_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348806.1|352039_353122_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|353146_354427_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|354423_354948_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_047657263.1|354950_356282_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|356286_357048_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614399.1|357056_359822_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.8	1.8e-81
WP_000088862.1|359818_360562_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240545.1|360566_361979_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122985538.1|362087_365522_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087754.1|365532_366885_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284199.1|366908_367391_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908057.1|367434_368349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|368974_369760_-	aminopeptidase	NA	NA	NA	NA	NA
WP_073508641.1|370295_371027_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
WP_000917883.1|371091_371559_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001295200.1|371555_372278_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052707.1|372311_373067_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|373138_374497_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211729.1|374544_375315_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|375392_376193_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648577.1|376433_377348_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997010.1|377344_378148_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_001140175.1|383816_384392_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|384579_385611_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|385603_386257_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|386296_387112_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|387229_387634_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|387630_388338_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|388448_390167_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000239192.1|391197_391908_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|391921_392344_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185290.1|392340_392886_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|393051_393252_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|393238_393499_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_047657065.1|393547_394846_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|394910_395300_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020973.1|395356_397498_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|397596_398556_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294774.1|398568_402051_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
WP_000569430.1|402087_402684_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000166359.1|402680_403829_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|403828_404617_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|404620_405076_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|405180_406206_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|406209_406695_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|406816_409249_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001346129.1|409278_410631_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_000922446.1|410642_411500_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001295562.1|411512_412271_-	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 29
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	424155	425580	4735489	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|424155_425580_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 30
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	429509	429854	4735489		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|429509_429854_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 31
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	435765	436563	4735489		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|435765_436563_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 32
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	441806	448612	4735489	tRNA	Acanthamoeba_polyphaga_mimivirus(50.0%)	6	NA	NA
WP_001676320.1|441806_444236_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.3	3.9e-40
WP_001294700.1|444309_444840_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396036.1|444854_445559_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|445736_446192_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937432.1|446228_447155_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174643.1|447193_448612_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
>prophage 33
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	458518	459421	4735489		Sodalis_phage(100.0%)	1	NA	NA
WP_000339945.1|458518_459421_-	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	5.7e-61
>prophage 34
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	462683	469151	4735489		Anomala_cuprea_entomopoxvirus(33.33%)	5	NA	NA
WP_000150637.1|462683_463610_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|463718_464381_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|464421_464958_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001349940.1|465163_467554_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189602.1|467600_469151_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
>prophage 35
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	476800	478225	4735489		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|476800_478225_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 36
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	486852	487404	4735489		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|486852_487404_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 37
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	491649	492693	4735489		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|491649_492693_-	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 38
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	518666	520391	4735489		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000425657.1|518666_520391_-	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	8.3e-37
>prophage 39
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	533093	533792	4735489		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916291.1|533093_533792_+	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	2.8e-23
>prophage 40
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	540124	545547	4735489		Yellowstone_lake_phycodnavirus(50.0%)	2	NA	NA
WP_000035651.1|540124_542476_+	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
WP_001117011.1|542640_545547_+	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
>prophage 41
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	554570	555970	4735489		Microcystis_phage(50.0%)	2	NA	NA
WP_000257192.1|554570_555413_+	bis(5'-nucleosyl)-tetraphosphatase (symmetrical) ApaH	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
WP_000624375.1|555490_555970_-	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
>prophage 42
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	563865	569525	4735489		Vibrio_phage(50.0%)	4	NA	NA
WP_000787103.1|563865_565380_+	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
WP_000347117.1|565410_566553_+	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000349938.1|566680_567898_+	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_001395601.1|567971_569525_+	crotonobetaine/carnitine-CoA ligase	NA	Q75ZG1	Hepacivirus	25.4	6.2e-31
>prophage 43
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	574995	576144	4735489		Halovirus(100.0%)	1	NA	NA
WP_000597260.1|574995_576144_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.7e-49
>prophage 44
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	580550	583367	4735489	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286857.1|580550_583367_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 45
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	590399	599468	4735489		uncultured_Caudovirales_phage(20.0%)	9	NA	NA
WP_000681360.1|590399_591566_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	50.3	7.5e-90
WP_000935262.1|592094_592304_+	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	73.9	8.0e-19
WP_001118464.1|592407_593538_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_000516135.1|593626_595543_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_000843559.1|595919_596324_+	DUF2541 family protein	NA	NA	NA	NA	NA
WP_001102383.1|596349_597063_+	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000528538.1|597211_597778_+	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001094682.1|597812_598400_-	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000130189.1|598514_599468_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
>prophage 46
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	611236	613350	4735489		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_001219604.1|611236_612661_-	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	21.7	1.2e-09
WP_001188659.1|612660_613350_-	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	8.8e-30
>prophage 47
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	616581	621936	4735489		Bacillus_phage(33.33%)	3	NA	NA
WP_000409450.1|616581_618519_-	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	35.7	2.3e-11
WP_000046749.1|618729_620397_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000093810.1|620703_621936_-	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
>prophage 48
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	628679	630002	4735489		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477808.1|628679_630002_-	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	1.4e-79
>prophage 49
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	635637	638513	4735489		Salmonella_phage(50.0%)	3	NA	NA
WP_000490275.1|635637_635799_-	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001295748.1|635925_636531_-	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000175943.1|636923_638513_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 50
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	646409	647689	4735489		Salmonella_phage(50.0%)	2	NA	NA
WP_000098818.1|646409_646949_+	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
WP_000799911.1|646951_647689_+	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
>prophage 51
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	650915	656280	4735489		Tupanvirus(50.0%)	4	NA	NA
WP_000106030.1|650915_651938_-	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
WP_000091569.1|652076_652991_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000410129.1|653205_654567_+	MFS transporter	NA	NA	NA	NA	NA
WP_073508541.1|654615_656280_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
>prophage 52
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	672808	676777	4735489		Synechococcus_phage(50.0%)	2	NA	NA
WP_001593930.1|672808_675241_+	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	25.0	1.0e-08
WP_001387312.1|675307_676777_+	type I restriction-modification system subunit M	NA	J7I0U9	Acinetobacter_phage	27.3	9.6e-34
>prophage 53
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	683320	684277	4735489	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_047657183.1|683320_684277_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.2	2.3e-60
>prophage 54
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	691778	692333	4735489		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151854.1|691778_692333_-	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.7e-37
>prophage 55
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	698901	700362	4735489		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208194.1|698901_700362_-	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	32.2	9.5e-50
>prophage 56
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	710629	712306	4735489		Escherichia_phage(100.0%)	2	NA	NA
WP_000044711.1|710629_711226_-	type 1 fimbria switch DNA invertase FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	3.9e-50
WP_000790583.1|711703_712306_-	type 1 fimbria switch DNA invertase FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	3.1e-55
>prophage 57
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	715667	723894	4735489		Stx2-converting_phage(33.33%)	7	NA	NA
WP_000991447.1|715667_716648_+	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	3.9e-100
WP_001338066.1|716655_716778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168559.1|716859_717732_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_000177023.1|717901_719977_+	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	33.8	4.5e-37
WP_000504880.1|719969_721313_+	McrC family protein	NA	NA	NA	NA	NA
WP_000148644.1|721309_721696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001593915.1|721746_723894_+	N-6 DNA methylase	NA	B3GAM1	uncultured_virus	42.3	5.7e-19
>prophage 58
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	735247	739684	4735489		Tupanvirus(50.0%)	2	NA	NA
WP_001022619.1|735247_736717_+	serine/threonine protein kinase	NA	A0A2K9L5Y0	Tupanvirus	26.5	1.4e-11
WP_001593906.1|738664_739684_+	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	2.4e-44
>prophage 59
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	743884	748828	4735489	tRNA	Mycoplasma_phage(50.0%)	3	NA	NA
WP_000397144.1|743884_745396_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000786399.1|745529_745973_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000416392.1|745972_748828_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.8e-140
>prophage 60
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	757105	763202	4735489		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_000013046.1|757105_758041_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_000148581.1|758053_758515_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047539.1|758587_758974_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000471889.1|759179_761876_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_001387276.1|762016_762070_-	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_001181324.1|762254_763202_+	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
>prophage 61
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	766840	769601	4735489		Vibrio_phage(50.0%)	2	NA	NA
WP_000187795.1|766840_768979_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001106236.1|769136_769601_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	58.9	2.9e-53
>prophage 62
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	773911	780399	4735489		Klosneuvirus(33.33%)	6	NA	NA
WP_000853753.1|773911_774910_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000596027.1|774942_775938_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|775924_776947_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205795.1|776960_778463_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|778602_779559_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|779868_780399_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
>prophage 63
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	823037	824201	4735489		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943988.1|823037_824201_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.2	1.4e-80
>prophage 64
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	828133	841164	4735489	protease,tRNA	Lactococcus_phage(20.0%)	11	NA	NA
WP_000076316.1|828133_830575_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|830613_831039_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|831243_832542_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|832645_832843_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|832924_833929_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|833931_835191_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|835276_836557_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|836632_836941_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280345.1|837026_837977_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001542593.1|837969_839817_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	5.8e-60
WP_047657117.1|839826_841164_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
>prophage 65
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	845079	845625	4735489		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|845079_845625_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 66
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	853053	854031	4735489		Tupanvirus(100.0%)	1	NA	NA
WP_000004770.1|853053_854031_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	1.2e-27
>prophage 67
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	858951	859485	4735489		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|858951_859485_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 68
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	865282	867266	4735489		Vibrio_phage(50.0%)	2	NA	NA
WP_000729117.1|865282_866929_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|866972_867266_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
>prophage 69
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	881543	884755	4735489	tRNA	Acinetobacter_phage(50.0%)	2	NA	NA
WP_000856829.1|881543_883001_+	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
WP_001295087.1|883237_884755_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.0e-87
>prophage 70
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	905951	907454	4735489		Burkholderia_virus(100.0%)	1	NA	NA
WP_001296882.1|905951_907454_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.0	7.0e-56
>prophage 71
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	912293	913082	4735489		Cedratvirus(100.0%)	1	NA	NA
WP_001193391.1|912293_913082_+	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	8.5e-13
>prophage 72
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	918642	920192	4735489		Bacillus_virus(50.0%)	2	NA	NA
WP_001075526.1|918642_919401_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.8	1.0e-15
WP_000611428.1|919511_920192_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	25.0	8.7e-06
>prophage 73
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	924176	926162	4735489		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001307516.1|924176_926162_+	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.5	5.5e-149
>prophage 74
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	931407	933555	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_077781815.1|931407_933555_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.7	7.7e-32
>prophage 75
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	942837	944796	4735489		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078239.1|942837_944796_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.4	1.9e-90
>prophage 76
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	950379	951729	4735489		Moraxella_phage(100.0%)	1	NA	NA
WP_000106879.1|950379_951729_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	2.3e-159
>prophage 77
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	955546	959159	4735489		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168305.1|955546_956083_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|956336_959159_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
>prophage 78
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	963366	965914	4735489		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_001147325.1|963366_964446_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	1.5e-28
WP_000918363.1|964498_965914_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
>prophage 79
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	972535	973144	4735489		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|972535_973144_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 80
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	982360	983476	4735489		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|982360_983476_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 81
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	999338	1000130	4735489		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001130534.1|999338_1000130_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.5	1.4e-47
>prophage 82
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1005780	1009464	4735489		Dickeya_phage(100.0%)	1	NA	NA
WP_073508546.1|1005780_1009464_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 83
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1024841	1026431	4735489		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187485.1|1024841_1026431_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	8.4e-68
>prophage 84
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1031799	1033563	4735489		Bacillus_phage(50.0%)	3	NA	NA
WP_001044513.1|1031799_1032072_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
WP_000940106.1|1032258_1032849_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362388.1|1032891_1033563_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
>prophage 85
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1042779	1051108	4735489		Vibrio_phage(50.0%)	2	NA	NA
WP_000653944.1|1042779_1047003_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
WP_000263098.1|1047079_1051108_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 86
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1055224	1058277	4735489		Tupanvirus(50.0%)	2	NA	NA
WP_000031784.1|1055224_1056409_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000023081.1|1057326_1058277_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
>prophage 87
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1066783	1068628	4735489		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591355.1|1066783_1068628_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 88
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1085728	1092975	4735489		Serratia_phage(33.33%)	5	NA	NA
WP_073508547.1|1085728_1088026_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
WP_000161265.1|1088076_1088397_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_073508548.1|1088411_1089491_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023140301.1|1089799_1092301_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_047657270.1|1092312_1092975_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.1e-28
>prophage 89
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1115663	1120166	4735489		Erwinia_phage(50.0%)	5	NA	NA
WP_001293343.1|1115663_1116995_+	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000139496.1|1117061_1117988_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872908.1|1118080_1118566_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001296623.1|1118650_1118896_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000084268.1|1119320_1120166_+	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
>prophage 90
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1131740	1136601	4735489		Feldmannia_irregularis_virus(33.33%)	5	NA	NA
WP_001033722.1|1131740_1132439_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1132435_1133809_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270270.1|1133914_1134589_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166062.1|1134737_1135721_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001297064.1|1135980_1136601_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.8	4.9e-64
>prophage 91
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1151309	1154360	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_011310337.1|1151309_1154360_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 92
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1163233	1166013	4735489		Escherichia_phage(50.0%)	3	NA	NA
WP_000059678.1|1163233_1164019_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
WP_000621656.1|1164052_1164949_-	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000718893.1|1165116_1166013_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
>prophage 93
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1182236	1184707	4735489		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190577.1|1182236_1183286_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
WP_001188776.1|1183297_1184707_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
>prophage 94
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1188785	1191572	4735489		uncultured_virus(100.0%)	1	NA	NA
WP_073508553.1|1188785_1191572_-	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 95
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1205171	1205786	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_073508554.1|1205171_1205786_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	1.6e-19
>prophage 96
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1214576	1217863	4735489		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000109943.1|1214576_1215353_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
WP_000459594.1|1215355_1215871_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_001295260.1|1215874_1216144_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187530.1|1216222_1217863_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
>prophage 97
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1230274	1232104	4735489		Catovirus(100.0%)	1	NA	NA
WP_001346040.1|1230274_1232104_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	9.7e-84
>prophage 98
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1239590	1243449	4735489		Bacillus_phage(100.0%)	3	NA	NA
WP_000383424.1|1239590_1241753_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
WP_001213584.1|1241836_1242553_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000130691.1|1242552_1243449_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
>prophage 99
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1261914	1268058	4735489		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612036.1|1261914_1263045_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.6e-18
WP_001145196.1|1263049_1263724_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000676056.1|1263701_1264583_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	8.7e-107
WP_001226604.1|1264601_1265669_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.7	3.5e-102
WP_000006618.1|1265668_1266931_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	5.9e-24
WP_000866672.1|1266927_1268058_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.3	3.9e-27
>prophage 100
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1272100	1277512	4735489		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|1272100_1272430_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047499.1|1272560_1273826_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001295254.1|1273959_1275444_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001238869.1|1275490_1277512_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	2.9e-113
>prophage 101
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1285985	1287632	4735489		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_033817519.1|1285985_1287632_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.5	2.2e-66
>prophage 102
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1301028	1306881	4735489		Enterobacteria_phage(33.33%)	5	NA	NA
WP_001056273.1|1301028_1301919_-	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
WP_000211858.1|1301943_1302909_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_047657163.1|1302913_1304419_-	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	3.9e-14
WP_000715936.1|1304426_1304846_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000102319.1|1305012_1306881_-	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
>prophage 103
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1310049	1311042	4735489		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845106.1|1310049_1311042_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 104
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1322994	1326356	4735489		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000933736.1|1322994_1324365_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	3.1e-34
WP_000334099.1|1324526_1326356_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
>prophage 105
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1331887	1335728	4735489		Cyanophage(50.0%)	4	NA	NA
WP_000867146.1|1331887_1332928_+	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000741620.1|1333014_1333974_+	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_001251991.1|1333973_1334864_+	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000063125.1|1334954_1335728_+	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
>prophage 106
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1346718	1348056	4735489		Moraxella_phage(100.0%)	1	NA	NA
WP_000082693.1|1346718_1348056_+	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 107
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1358254	1365623	4735489		Staphylococcus_phage(33.33%)	8	NA	NA
WP_001307474.1|1358254_1358512_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
WP_000239730.1|1358475_1358835_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_000831330.1|1358851_1358992_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_120795392.1|1359221_1359302_-	protein YsdD	NA	NA	NA	NA	NA
WP_000059111.1|1359598_1361002_+	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000673464.1|1361006_1362107_+	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000060112.1|1362106_1363180_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000072067.1|1363208_1365623_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
>prophage 108
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1370327	1371476	4735489		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|1370327_1371476_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 109
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1375903	1376857	4735489		Cyanophage(50.0%)	2	NA	NA
WP_001243437.1|1375903_1376317_+	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
WP_001243431.1|1376428_1376857_+	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
>prophage 110
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1383203	1392364	4735489		Aeromonas_phage(25.0%)	10	NA	NA
WP_001087147.1|1383203_1384919_+	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
WP_000828483.1|1384915_1386409_+	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.4	1.1e-29
WP_000511287.1|1386455_1386905_-	membrane protein	NA	NA	NA	NA	NA
WP_000703959.1|1387014_1387362_+	YidH family protein	NA	NA	NA	NA	NA
WP_001113432.1|1387351_1387714_+	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000148063.1|1387710_1388208_+	radical SAM protein	NA	NA	NA	NA	NA
WP_000828746.1|1388215_1389400_-	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000060506.1|1389818_1389908_-	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_001315912.1|1390471_1390570_+	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000168432.1|1390675_1392364_+	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	5.4e-57
>prophage 111
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1399669	1401004	4735489		Moraxella_phage(100.0%)	1	NA	NA
WP_001058151.1|1399669_1401004_+	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	8.6e-66
>prophage 112
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1413122	1414514	4735489		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|1413122_1414514_-	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 113
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1419635	1426386	4735489		Bordetella_phage(25.0%)	6	NA	NA
WP_000280488.1|1419635_1421744_-	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
WP_000135058.1|1421762_1422038_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_001295237.1|1422092_1422716_-	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_001399398.1|1422973_1424656_+	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.1	5.7e-22
WP_000924289.1|1424652_1425270_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_047657217.1|1425561_1426386_-	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	76.6	2.4e-90
>prophage 114
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1429759	1434322	4735489		Xanthomonas_phage(25.0%)	7	NA	NA
WP_000976070.1|1429759_1430218_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
WP_000050117.1|1430195_1431416_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	5.0e-44
WP_001298959.1|1431587_1432256_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000091955.1|1432472_1432709_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001051798.1|1432729_1432897_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001114546.1|1432994_1433804_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.5	1.5e-25
WP_001171866.1|1433842_1434322_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.0	4.8e-27
>prophage 115
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1446253	1456981	4735489		Synechococcus_phage(16.67%)	10	NA	NA
WP_000587764.1|1446253_1447186_-	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.1e-35
WP_000842823.1|1447489_1448347_+	protein YibB	NA	NA	NA	NA	NA
WP_001213834.1|1448621_1449818_+	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.4	4.9e-36
WP_000646014.1|1449827_1450853_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_000982091.1|1451091_1452126_+	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000483856.1|1452112_1453072_-	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_001214147.1|1453075_1454359_-	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_001352773.1|1454368_1455913_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001315904.1|1456157_1456589_+	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000024392.1|1456729_1456981_+	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
>prophage 116
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1487954	1489799	4735489		Tupanvirus(100.0%)	1	NA	NA
WP_000582487.1|1487954_1489799_+	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	27.6	1.3e-16
>prophage 117
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1518223	1519765	4735489		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|1518223_1519765_-	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 118
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1525083	1526079	4735489		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182653.1|1525083_1526079_-	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 119
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1530303	1530516	4735489		Morganella_phage(100.0%)	1	NA	NA
WP_000014594.1|1530303_1530516_-	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 120
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1534170	1536504	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_000013928.1|1534170_1536504_+	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.4	4.9e-72
>prophage 121
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1552253	1554238	4735489		Planktothrix_phage(50.0%)	2	NA	NA
WP_001196496.1|1552253_1553237_+	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.7e-15
WP_000107035.1|1553233_1554238_+	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	8.6e-18
>prophage 122
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1600735	1601383	4735489		Bacillus_virus(100.0%)	1	NA	NA
WP_001307446.1|1600735_1601383_+	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 123
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1606274	1608409	4735489		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000065786.1|1606274_1606700_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.5e-51
WP_001347664.1|1606712_1608002_-	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.8	2.1e-173
WP_000008957.1|1608055_1608409_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
>prophage 124
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1611754	1613797	4735489		Indivirus(100.0%)	1	NA	NA
WP_001295214.1|1611754_1613797_+	oligopeptidase A	NA	A0A1V0SD92	Indivirus	22.9	3.4e-45
>prophage 125
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1627209	1633106	4735489		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000149125.1|1627209_1629945_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	9.2e-22
WP_001314210.1|1629944_1631069_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001259388.1|1631141_1631417_+	type II toxin-antitoxin system HicA family toxin	NA	R4JMD3	Burkholderia_phage	48.8	3.2e-15
WP_000593555.1|1631413_1631773_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_001190062.1|1631892_1632294_-	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000173666.1|1632299_1633106_-	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	4.5e-17
>prophage 126
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1640999	1645131	4735489		Dickeya_phage(50.0%)	4	NA	NA
WP_001100467.1|1640999_1641665_-	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.6	5.6e-58
WP_000130621.1|1641885_1642131_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_000106527.1|1642232_1644431_-	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.0e-119
WP_000964718.1|1644504_1645131_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
>prophage 127
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1648134	1650953	4735489		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000617723.1|1648134_1648803_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
WP_001042003.1|1648795_1649854_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000130217.1|1650098_1650953_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
>prophage 128
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1656686	1658169	4735489		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000082101.1|1656686_1657454_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
WP_000416895.1|1657455_1658169_+	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	9.1e-14
>prophage 129
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1661709	1663520	4735489		Planktothrix_phage(50.0%)	2	NA	NA
WP_000907790.1|1661709_1662780_+	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
WP_000073590.1|1662776_1663520_+	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.0	6.4e-10
>prophage 130
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1683529	1685977	4735489		Dickeya_phage(100.0%)	1	NA	NA
WP_000993455.1|1683529_1685977_+	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 131
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1696642	1697869	4735489		Ralstonia_phage(100.0%)	1	NA	NA
WP_001105504.1|1696642_1697869_+	RNA-splicing ligase RtcB	NA	A0A1L7N133	Ralstonia_phage	60.0	4.0e-134
>prophage 132
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1702248	1704642	4735489		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|1702248_1704642_+	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 133
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1718053	1722565	4735489		Bacillus_phage(66.67%)	5	NA	NA
WP_001157751.1|1718053_1718773_+	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
WP_001253696.1|1718769_1720122_+	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_000650976.1|1720153_1720450_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000493756.1|1720508_1720826_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001265681.1|1720942_1722565_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
>prophage 134
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1739540	1740377	4735489		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|1739540_1740377_+	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 135
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1759391	1768932	4735489		Acinetobacter_phage(25.0%)	9	NA	NA
WP_000601844.1|1759391_1759955_+	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	2.3e-60
WP_000963792.1|1760040_1761261_+	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_001295162.1|1761327_1763418_-	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000242755.1|1763468_1764101_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001148908.1|1764402_1764807_+	OsmC family protein	NA	NA	NA	NA	NA
WP_001274680.1|1764861_1765731_-	phosphoribulokinase	NA	NA	NA	NA	NA
WP_000907085.1|1765784_1766003_-	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_000057356.1|1765996_1767019_-	hydrolase	NA	NA	NA	NA	NA
WP_000634793.1|1767018_1768932_-	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	5.6e-74
>prophage 136
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1774502	1780076	4735489		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_001209710.1|1774502_1774889_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	38.3	5.6e-18
WP_000820724.1|1774888_1775248_+	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_000903377.1|1775255_1775543_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000246815.1|1775668_1776043_+	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_001138043.1|1776139_1776610_+	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000124700.1|1776706_1778821_+	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_000031783.1|1778891_1780076_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 137
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1799953	1801425	4735489	tRNA	Prochlorococcus_phage(50.0%)	2	NA	NA
WP_000004454.1|1799953_1800901_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
WP_000114984.1|1800915_1801425_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
>prophage 138
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1811836	1815990	4735489		Bacillus_virus(50.0%)	4	NA	NA
WP_000078338.1|1811836_1812595_-	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	1.2e-19
WP_001299298.1|1812602_1813706_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000019655.1|1813715_1814897_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000738575.1|1814964_1815990_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.5	6.9e-71
>prophage 139
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1822494	1823379	4735489		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258919.1|1822494_1823379_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.5	4.9e-25
>prophage 140
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1833944	1834988	4735489		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|1833944_1834988_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 141
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1851484	1854009	4735489	protease	uncultured_archaeal_virus(50.0%)	2	NA	NA
WP_000497723.1|1851484_1852552_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
WP_001295271.1|1852641_1854009_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
>prophage 142
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1857975	1858473	4735489	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|1857975_1858473_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 143
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1862177	1866925	4735489		Burkholderia_virus(50.0%)	5	NA	NA
WP_000108459.1|1862177_1863668_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
WP_000054239.1|1863715_1864405_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000209003.1|1864401_1865277_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000979882.1|1865273_1865738_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000445144.1|1865797_1866925_-	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
>prophage 144
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1873674	1888469	4735489		Staphylococcus_phage(25.0%)	17	NA	NA
WP_001176896.1|1873674_1874604_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
WP_000809774.1|1874699_1877036_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299134.1|1877265_1877919_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000047091.1|1877915_1878644_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000620387.1|1878640_1879273_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216791.1|1879486_1879759_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243741.1|1879755_1880610_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_073508558.1|1880655_1881147_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176599.1|1881264_1881552_-	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000809051.1|1881574_1883008_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_000224099.1|1883055_1883781_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000669785.1|1883787_1884345_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000030537.1|1884313_1884889_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030016.1|1884885_1885452_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_001295557.1|1885472_1886459_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000922872.1|1886472_1887450_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_000438245.1|1887659_1888469_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
>prophage 145
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1892537	1894015	4735489		Vibrio_phage(50.0%)	2	NA	NA
WP_000445413.1|1892537_1892816_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
WP_001047336.1|1893043_1894015_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
>prophage 146
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1900643	1903516	4735489	protease	Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_001107467.1|1900643_1902578_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
WP_000764731.1|1902667_1903516_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
>prophage 147
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1907598	1914237	4735489		Dickeya_phage(50.0%)	4	NA	NA
WP_000207683.1|1907598_1908942_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
WP_001300397.1|1909572_1910025_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031057.1|1910052_1911540_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133044.1|1911564_1914237_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
>prophage 148
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1919718	1921608	4735489		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001295553.1|1919718_1921608_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 149
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1927435	1935228	4735489		Diadromus_pulchellus_ascovirus(25.0%)	10	NA	NA
WP_000189314.1|1927435_1927738_-	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	52.5	3.9e-14
WP_000449030.1|1927788_1928232_+	YhbP family protein	NA	NA	NA	NA	NA
WP_000037608.1|1928211_1928730_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_001298741.1|1928857_1929493_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_047657031.1|1929565_1930606_+	permease	NA	NA	NA	NA	NA
WP_000646033.1|1930719_1931295_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_001158035.1|1931304_1931895_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000246865.1|1931914_1932310_-	YraN family protein	NA	NA	NA	NA	NA
WP_000249157.1|1932267_1934304_-	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000809253.1|1934367_1935228_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.3	2.1e-49
>prophage 150
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1958237	1959383	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_001299416.1|1958237_1959383_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 151
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1967702	1969997	4735489		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|1967702_1969997_+	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 152
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	1996013	1996979	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|1996013_1996979_-	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 153
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2008786	2024933	4735489	tRNA	Herpes_simplex_virus(16.67%)	12	NA	NA
WP_001082883.1|2008786_2011879_-	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.2	2.0e-158
WP_000212470.1|2012062_2013046_-	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_000450589.1|2013264_2013597_+|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_001297164.1|2013638_2015018_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	4.5e-33
WP_000094682.1|2015435_2016956_+	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	52.2	1.4e-35
WP_000018005.1|2017062_2017686_-	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_001065895.1|2017973_2018738_+	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000228937.1|2018991_2019498_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437371.1|2019575_2021417_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000918827.1|2021611_2023357_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_001144069.1|2023467_2023683_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_001264365.1|2023919_2024933_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	4.8e-109
>prophage 154
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2031317	2032556	4735489	tRNA	Sinorhizobium_phage(100.0%)	1	NA	NA
WP_000708501.1|2031317_2032556_-|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.6	5.9e-93
>prophage 155
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2037693	2039127	4735489		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000869178.1|2037693_2039127_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
>prophage 156
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2048642	2059604	4735489		Staphylococcus_phage(20.0%)	12	NA	NA
WP_001076997.1|2048642_2049296_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
WP_000469266.1|2049556_2049727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295627.1|2049784_2050558_-	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_001299419.1|2050700_2051489_+	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_000442860.1|2051526_2052687_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_000831543.1|2052692_2053364_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000735278.1|2053511_2054993_-	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000917117.1|2055197_2055827_+	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000833393.1|2055827_2056250_+	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000444747.1|2056274_2057102_+	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000105733.1|2057101_2057683_+	esterase YqiA	NA	NA	NA	NA	NA
WP_000195296.1|2057711_2059604_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
>prophage 157
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2063431	2074255	4735489		Stx_converting_phage(25.0%)	9	NA	NA
WP_000712658.1|2063431_2063824_+	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
WP_000183494.1|2063876_2064359_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001281841.1|2064904_2067163_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.8e-84
WP_000965712.1|2067396_2068134_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000059395.1|2068208_2069621_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000095187.1|2069731_2071951_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000848528.1|2071993_2072251_-	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000691598.1|2072301_2073228_-	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000013149.1|2073427_2074255_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
>prophage 158
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2081609	2082494	4735489		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018758.1|2081609_2082494_-	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 159
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2104708	2105881	4735489		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524972.1|2104708_2105881_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	4.2e-40
>prophage 160
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2162495	2163650	4735489		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|2162495_2163650_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 161
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2184651	2185329	4735489		Bacillus_virus(100.0%)	1	NA	NA
WP_000956871.1|2184651_2185329_-	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	1.1e-08
>prophage 162
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2203380	2204613	4735489		Catovirus(100.0%)	1	NA	NA
WP_047656997.1|2203380_2204613_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 163
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2213140	2218513	4735489		Prochlorococcus_phage(50.0%)	3	NA	NA
WP_000195023.1|2213140_2216014_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.0	3.7e-263
WP_000951964.1|2216279_2217023_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001307385.1|2217079_2218513_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	5.7e-31
>prophage 164
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2222437	2237829	4735489	tRNA	Brevibacillus_phage(14.29%)	14	NA	NA
WP_000806638.1|2222437_2223334_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
WP_000715214.1|2223358_2224069_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000813215.1|2224074_2225808_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.5	3.2e-60
WP_001701073.1|2225898_2226996_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003068.1|2227006_2228524_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001192814.1|2228566_2229115_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_120795390.1|2229169_2229241_+	protein YqfH	NA	NA	NA	NA	NA
WP_001010156.1|2229237_2229363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295374.1|2229364_2230813_-	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_047656998.1|2231248_2233168_+	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_000838428.1|2233167_2233656_+	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_000012140.1|2233691_2235059_-	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	1.6e-160
WP_001295158.1|2235094_2236411_-	guanine deaminase	NA	NA	NA	NA	NA
WP_001280215.1|2236428_2237829_-	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
>prophage 165
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2262108	2262864	4735489		Clostridium_phage(100.0%)	1	NA	NA
WP_001272558.1|2262108_2262864_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 166
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2285691	2288186	4735489		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000603517.1|2285691_2286453_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
WP_000256438.1|2286767_2288186_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
>prophage 167
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2297817	2304590	4735489		Moraxella_phage(33.33%)	6	NA	NA
WP_000895624.1|2297817_2298531_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
WP_000082188.1|2298599_2299289_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564489.1|2299973_2300504_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957912.1|2300516_2302763_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000204658.1|2302913_2303789_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816232.1|2303795_2304590_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
>prophage 168
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2310067	2325616	4735489	tRNA	Klosneuvirus(16.67%)	9	NA	NA
WP_001138159.1|2310067_2312956_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
WP_001345933.1|2312948_2316491_+	exodeoxyribonuclease V subunit beta	NA	G3MA40	Bacillus_virus	21.6	2.0e-08
WP_000775953.1|2316490_2318317_+	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_000237947.1|2318378_2319710_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000016907.1|2319941_2321195_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000678646.1|2321774_2322872_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117734.1|2323110_2323917_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	3.8e-16
WP_000184249.1|2323967_2324411_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_001299106.1|2324410_2325616_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	37.0	1.7e-73
>prophage 169
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2337142	2337898	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|2337142_2337898_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 170
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2342756	2343605	4735489		Vibrio_phage(100.0%)	1	NA	NA
WP_000100430.1|2342756_2343605_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	4.7e-41
>prophage 171
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2351139	2355254	4735489		Hokovirus(50.0%)	2	NA	NA
WP_000186450.1|2351139_2353896_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
WP_000046785.1|2353952_2355254_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.7	2.0e-38
>prophage 172
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2359286	2364206	4735489		Only_Syngen_Nebraska_virus(33.33%)	5	NA	NA
WP_000210878.1|2359286_2360924_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
WP_000036723.1|2361011_2362310_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_001268451.1|2362369_2363242_-	YgcG family protein	NA	NA	NA	NA	NA
WP_001288227.1|2363255_2363396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001199970.1|2363534_2364206_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
>prophage 173
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2369289	2370075	4735489		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_073508567.1|2369289_2370075_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	5.0e-21
>prophage 174
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2394170	2396203	4735489		Hokovirus(50.0%)	2	NA	NA
WP_001090361.1|2394170_2395598_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.4	9.7e-31
WP_001173673.1|2395597_2396203_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	4.2e-28
>prophage 175
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2399315	2403031	4735489		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001349984.1|2399315_2400077_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	47.2	4.9e-58
WP_000254708.1|2400070_2400697_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|2400836_2401976_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_012907185.1|2402038_2403031_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 176
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2408245	2415385	4735489		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|2408245_2408884_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|2408880_2410143_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_047657020.1|2410139_2411048_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	2.3e-118
WP_001297141.1|2411243_2412011_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|2412061_2412718_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|2412823_2415385_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 177
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2433213	2434224	4735489		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001402444.1|2433213_2434224_+	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.3	1.0e-26
>prophage 178
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2441797	2442763	4735489		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287446.1|2441797_2442763_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 179
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2448229	2453789	4735489	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_000132231.1|2448229_2448727_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
WP_000963143.1|2448806_2449868_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000140506.1|2450110_2450611_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000047176.1|2450738_2453369_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|2453603_2453789_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 180
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2466973	2472269	4735489		Bacillus_virus(20.0%)	5	NA	NA
WP_000985494.1|2466973_2468176_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777969.1|2468530_2469490_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000246540.1|2469499_2471644_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.0	2.1e-194
WP_000080947.1|2471616_2472027_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|2472023_2472269_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
>prophage 181
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2476204	2480329	4735489		Clostridium_phage(50.0%)	4	NA	NA
WP_000522422.1|2476204_2476654_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	38.2	5.8e-06
WP_000156811.1|2476654_2477317_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|2477337_2478738_-	GABA permease	NA	NA	NA	NA	NA
WP_001087606.1|2479048_2480329_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	2.4e-33
>prophage 182
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2489815	2490004	4735489		Salmonella_phage(100.0%)	1	NA	NA
WP_000340076.1|2489815_2490004_+	hypothetical protein	NA	A0A1S6L009	Salmonella_phage	69.2	9.1e-06
>prophage 183
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2494094	2500274	4735489		Enterobacteria_phage(75.0%)	8	NA	NA
WP_073508568.1|2494094_2496428_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.8	0.0e+00
WP_023304676.1|2496442_2496766_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_057688232.1|2496762_2496987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077822506.1|2496986_2497535_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	56.1	6.8e-25
WP_073508569.1|2497531_2497792_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	67.5	2.7e-24
WP_057688230.1|2498696_2499449_+	septation initiation protein	NA	NA	NA	NA	NA
WP_073508570.1|2499445_2500000_+	phage polarity suppression protein	NA	NA	NA	NA	NA
WP_023304682.1|2500001_2500274_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	44.1	3.7e-08
>prophage 184
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2504569	2507007	4735489	integrase	Escherichia_phage(50.0%)	2	2497765:2497779	2514083:2514097
2497765:2497779	attL	CTGGGGTGGAAACGG	NA	NA	NA	NA
WP_057688226.1|2504569_2505763_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	5.9e-106
WP_000162574.1|2506524_2507007_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
2514083:2514097	attR	CCGTTTCCACCCCAG	NA	NA	NA	NA
>prophage 185
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2520753	2521824	4735489		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168044.1|2520753_2521824_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 186
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2527730	2530304	4735489		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|2527730_2530304_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 187
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2536082	2537381	4735489		Burkholderia_virus(100.0%)	1	NA	NA
WP_000230376.1|2536082_2537381_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 188
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2542674	2548933	4735489	tRNA	Achromobacter_phage(25.0%)	7	NA	NA
WP_001098726.1|2542674_2543094_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997403.1|2543300_2544338_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001262716.1|2544385_2545075_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000627807.1|2545379_2545763_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_000189207.1|2545818_2546406_-	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000365855.1|2546508_2547390_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000219193.1|2547598_2548933_-	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
>prophage 189
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2554704	2558447	4735489		Tupanvirus(50.0%)	3	NA	NA
WP_000790168.1|2554704_2556504_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000002542.1|2556519_2557494_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068343.1|2557766_2558447_+	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
>prophage 190
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2561905	2562166	4735489		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|2561905_2562166_-	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 191
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2566285	2577593	4735489		Bacillus_phage(50.0%)	7	NA	NA
WP_047657122.1|2566285_2570173_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	59.2	7.7e-131
WP_001297612.1|2570748_2572176_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_001215888.1|2572340_2573054_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001298983.1|2573043_2574378_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_000717694.1|2574438_2574777_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_000883122.1|2574821_2576012_-	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000919159.1|2576339_2577593_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
>prophage 192
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2583351	2584863	4735489		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493471.1|2583351_2584863_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 193
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2600027	2606484	4735489		Faustovirus(20.0%)	8	NA	NA
WP_001295373.1|2600027_2601242_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
WP_000331707.1|2601269_2601656_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_000028953.1|2601672_2601996_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000384411.1|2602091_2602607_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_001196597.1|2602623_2604474_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	7.2e-103
WP_001124469.1|2604475_2604811_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523616.1|2604822_2605023_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133582.1|2605200_2606484_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	2.2e-34
>prophage 194
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2616369	2616801	4735489		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|2616369_2616801_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 195
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2625631	2632116	4735489		Escherichia_phage(66.67%)	7	NA	NA
WP_000937892.1|2625631_2627002_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	6.8e-42
WP_001299507.1|2627163_2628630_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000138282.1|2628698_2630276_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_000755173.1|2630370_2630910_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
WP_001317257.1|2630925_2631444_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	8.5e-62
WP_000076001.1|2631754_2631946_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017552.1|2631963_2632116_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
>prophage 196
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2638362	2642364	4735489		Prochlorococcus_phage(33.33%)	4	NA	NA
WP_001028622.1|2638362_2639001_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.3	9.0e-29
WP_001295474.1|2639000_2640038_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.1e-71
WP_001295473.1|2640362_2640989_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001307334.1|2641074_2642364_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.6	1.7e-63
>prophage 197
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2663336	2664050	4735489		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2663336_2664050_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 198
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2682097	2683048	4735489		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2682097_2683048_-	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 199
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2701602	2706540	4735489		Deep-sea_thermophilic_phage(33.33%)	6	NA	NA
WP_073508577.1|2701602_2702472_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	3.2e-13
WP_000406000.1|2702685_2703111_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842944.1|2703097_2703547_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_000838945.1|2703607_2704183_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000084590.1|2704278_2705178_+	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_001315775.1|2705235_2706540_-	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
>prophage 200
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2710018	2725388	4735489		Streptococcus_phage(33.33%)	15	NA	NA
WP_000517431.1|2710018_2710810_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
WP_000290223.1|2710980_2711997_+	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000458406.1|2711996_2712830_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_000852686.1|2712829_2713705_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000021039.1|2713694_2714792_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	39.4	2.8e-30
WP_001297645.1|2714925_2715837_+	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.9	3.5e-58
WP_000719943.1|2715839_2716208_-	YfeK family protein	NA	NA	NA	NA	NA
WP_000096663.1|2716312_2717164_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000522249.1|2717205_2717715_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000623136.1|2717755_2719483_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	9.6e-17
WP_000487600.1|2719527_2719785_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000034402.1|2720168_2721140_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000254843.1|2721324_2722086_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_001297862.1|2722315_2723302_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000443665.1|2723372_2725388_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.4	6.5e-150
>prophage 201
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2747088	2747823	4735489		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2747088_2747823_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 202
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2751641	2752562	4735489		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2751641_2752562_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 203
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2756291	2763868	4735489		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_001283499.1|2756291_2757986_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.0e-23
WP_000955028.1|2758055_2759000_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001296867.1|2759073_2760219_+	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_072034716.1|2760274_2763868_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	1.7e-36
>prophage 204
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2770509	2771943	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_047656943.1|2770509_2771943_-	sucrose-6-phosphate hydrolase	NA	F8WPR5	Bacillus_phage	25.4	4.1e-29
>prophage 205
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2774982	2775915	4735489		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368131.1|2774982_2775915_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 206
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2793797	2794883	4735489		Pandoravirus(100.0%)	1	NA	NA
WP_001297933.1|2793797_2794883_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
>prophage 207
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2803447	2804584	4735489		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699121.1|2803447_2804584_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	5.9e-23
>prophage 208
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2811060	2812578	4735489		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2811060_2812578_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 209
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2816789	2818662	4735489		Acanthocystis_turfacea_Chlorella_virus(50.0%)	2	NA	NA
WP_001293612.1|2816789_2817563_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
WP_000156113.1|2817759_2818662_+	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	44.5	8.2e-68
>prophage 210
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2829222	2832450	4735489		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_001203389.1|2829222_2829873_+	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	34.3	5.2e-08
WP_001012899.1|2829959_2831792_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_000813848.1|2831850_2832450_-	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	37.3	5.9e-06
>prophage 211
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2866866	2871870	4735489		Tupanvirus(50.0%)	4	NA	NA
WP_000860259.1|2866866_2868849_-	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
WP_000461661.1|2868848_2869817_-	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.2	2.0e-35
WP_001307305.1|2869820_2870960_-	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.1e-29
WP_001297077.1|2871267_2871870_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	3.4e-09
>prophage 212
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2875022	2875925	4735489	transposase	Sodalis_phage(100.0%)	1	NA	NA
WP_000140570.1|2875022_2875925_-|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
>prophage 213
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2881818	2895872	4735489		Pseudomonas_phage(33.33%)	8	NA	NA
WP_000779091.1|2881818_2882895_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	5.1e-08
WP_000301049.1|2883356_2884007_+	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000135040.1|2884060_2884315_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000332036.1|2884314_2885445_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	2.5e-175
WP_001075177.1|2885533_2887819_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	1.1e-283
WP_001437766.1|2888513_2892248_+	AIDA-I family autotransporter adhesin YfaL/EhaC	NA	A0A2L1IV18	Escherichia_phage	24.2	2.2e-18
WP_000990754.1|2892375_2893098_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_001281225.1|2893244_2895872_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 214
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2905572	2908422	4735489		Hokovirus(100.0%)	1	NA	NA
WP_000876014.1|2905572_2908422_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
>prophage 215
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2912699	2918477	4735489		Enterobacteria_phage(25.0%)	5	NA	NA
WP_000865570.1|2912699_2913803_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.9	1.2e-118
WP_000406087.1|2913914_2914970_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000710363.1|2915043_2916108_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	50.5	1.8e-18
WP_000884942.1|2916107_2916758_+	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	31.7	1.4e-05
WP_000422185.1|2916833_2918477_+	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	1.2e-13
>prophage 216
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2927244	2927862	4735489		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2927244_2927862_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 217
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2939561	2947211	4735489		Vibrio_phage(50.0%)	7	NA	NA
WP_000050787.1|2939561_2940569_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	6.9e-84
WP_000494183.1|2940707_2940992_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000578079.1|2941116_2942877_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_001234854.1|2943026_2943722_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213382.1|2943749_2944940_+	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.9e-20
WP_000202798.1|2945273_2945618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194928.1|2945621_2947211_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
>prophage 218
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2952965	2957266	4735489		Clostridioides_phage(50.0%)	4	NA	NA
WP_000241011.1|2952965_2953532_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
WP_001296828.1|2953943_2954657_-	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_000198822.1|2954695_2955682_-	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000848204.1|2955799_2957266_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.5	1.2e-44
>prophage 219
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2971761	2972619	4735489		Catovirus(100.0%)	1	NA	NA
WP_000873890.1|2971761_2972619_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 220
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2976688	2980474	4735489		Acinetobacter_phage(50.0%)	3	NA	NA
WP_000489244.1|2976688_2978680_+	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
WP_000425438.1|2978711_2979548_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001139613.1|2979805_2980474_+	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
>prophage 221
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	2984168	2985689	4735489		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255042.1|2984168_2985689_+	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 222
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3006022	3015464	4735489		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569326.1|3006022_3006949_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
WP_000783120.1|3006953_3007685_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3007665_3007773_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3007832_3008564_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3008785_3010471_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3010467_3011187_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_073508580.1|3011233_3011704_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	8.8e-82
WP_001295429.1|3011744_3012206_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_009008075.1|3012330_3014331_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_073508581.1|3014327_3015464_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
>prophage 223
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3027975	3093406	4735489	portal,head,capsid,integrase,lysis,plate,tRNA,terminase,holin,tail	Escherichia_phage(42.55%)	75	3055224:3055251	3088322:3088349
WP_001295427.1|3027975_3030009_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|3030140_3031250_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032163827.1|3031512_3031794_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|3032086_3032629_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|3032708_3033383_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_047656950.1|3033398_3035879_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|3035892_3036927_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|3037008_3037347_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134575.1|3037565_3038390_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|3038510_3038783_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_047656951.1|3039005_3039794_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822270.1|3039790_3040591_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_047656952.1|3040655_3041474_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	3.3e-23
WP_000434038.1|3041525_3042272_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011951.1|3042245_3043211_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846217.1|3043207_3044212_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858498.1|3044208_3045486_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|3045742_3046795_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|3047104_3047959_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_001471834.1|3047987_3049250_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182914.1|3049259_3049712_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|3049742_3050027_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|3050030_3051386_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844220.1|3051433_3052474_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3052573_3053353_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|3053434_3054334_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|3054748_3055066_+	hypothetical protein	NA	NA	NA	NA	NA
3055224:3055251	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_077897006.1|3055330_3056344_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	98.8	1.6e-192
WP_000020919.1|3056459_3056759_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|3056880_3057156_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|3057166_3057337_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|3057333_3057834_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557705.1|3057897_3058122_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.4e-32
WP_001277897.1|3058121_3058424_+	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	98.0	8.5e-46
WP_001113264.1|3058423_3058648_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027667.1|3058644_3058920_+	DUF5405 family protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_073508582.1|3058909_3061186_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000744812.1|3062350_3063784_+	AAA family ATPase	NA	A0A2I7RNF1	Vibrio_phage	30.1	3.9e-40
WP_001350078.1|3063776_3064349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038162.1|3064407_3065436_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.1	6.2e-197
WP_033549326.1|3065435_3067208_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_033549327.1|3067381_3068236_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.6	5.6e-135
WP_073508583.1|3068294_3069368_+|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.2	7.4e-201
WP_073508584.1|3069371_3070115_+|terminase	terminase endonuclease subunit	terminase	Q94MH3	Enterobacteria_phage	99.6	3.6e-122
WP_000988633.1|3070214_3070724_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|3070723_3070927_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|3070930_3071212_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3071211_3071709_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_023278422.1|3071723_3072149_+	hypothetical protein	NA	A0A0F7LDU9	Escherichia_phage	93.6	4.7e-58
WP_000040696.1|3072136_3072562_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	96.5	1.4e-65
WP_001440152.1|3072533_3072707_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001774102.1|3072669_3073137_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_023148832.1|3073129_3073582_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_023148831.1|3073684_3074758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024176299.1|3074844_3075474_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	95.2	1.8e-106
WP_000127163.1|3075470_3075818_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121482.1|3075822_3076731_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.0e-162
WP_001285325.1|3076723_3077254_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_073508585.1|3077264_3079286_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.6	9.2e-261
WP_023148826.1|3079287_3079815_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_106424756.1|3080141_3081332_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.7	5.4e-176
WP_023148823.1|3081618_3082809_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_001251408.1|3082821_3083340_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3083396_3083672_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3083704_3083824_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_073508586.1|3083816_3086264_+|tail	phage tail tape measure protein	tail	Q858U7	Yersinia_virus	98.8	0.0e+00
WP_016248270.1|3086278_3086758_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	98.7	2.5e-84
WP_000882953.1|3086757_3087921_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	2.4e-205
WP_000468308.1|3088002_3088221_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476011.1|3088493_3089855_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
3088322:3088349	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001220181.1|3089957_3090254_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001307279.1|3090255_3090552_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_000929408.1|3090760_3091093_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137869.1|3091283_3092006_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.4e-30
WP_000675150.1|3092002_3093406_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
>prophage 224
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3106847	3108200	4735489		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469763.1|3106847_3108200_-	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.3	8.3e-08
>prophage 225
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3112864	3123340	4735489		Catovirus(20.0%)	9	NA	NA
WP_001295424.1|3112864_3113506_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
WP_001234767.1|3113597_3114179_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001252331.1|3114200_3116054_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001300971.1|3116327_3117911_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_162829205.1|3118111_3118261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000978069.1|3118569_3119709_+	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_000482901.1|3119714_3120158_+	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000137136.1|3120160_3122323_+	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000654492.1|3122500_3123340_+	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	1.7e-06
>prophage 226
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3127584	3134378	4735489		Synechococcus_phage(25.0%)	6	NA	NA
WP_000048190.1|3127584_3128706_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
WP_000043623.1|3128708_3129674_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	9.9e-88
WP_029392122.1|3129676_3130156_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_000699701.1|3130152_3131376_+	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000079285.1|3131378_3132815_+	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_032178616.1|3133007_3134378_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
>prophage 227
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3140099	3147423	4735489		Klebsiella_phage(20.0%)	6	NA	NA
WP_047656968.1|3140099_3141494_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	4.4e-20
WP_000183060.1|3141668_3142562_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_047656969.1|3142934_3144011_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.8e-101
WP_047656970.1|3144007_3144874_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	69.4	2.4e-109
WP_047656971.1|3144880_3146308_+	O116 family O-antigen flippase	NA	NA	NA	NA	NA
WP_047656972.1|3146319_3147423_+	dTDP-4-amino-4,6-dideoxy-D-glucose aminotransferase VioA	NA	A0A2D2W2B8	Stenotrophomonas_phage	27.7	3.9e-11
>prophage 228
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3151801	3156925	4735489		Streptococcus_phage(33.33%)	4	NA	NA
WP_047656976.1|3151801_3152908_+	UDP-galactopyranose mutase	NA	E4ZFQ1	Streptococcus_phage	61.2	1.7e-136
WP_047656977.1|3152904_3153810_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_047656978.1|3154103_3155510_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_000704798.1|3155758_3156925_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.2	3.3e-114
>prophage 229
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3165303	3166203	4735489		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|3165303_3166203_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 230
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3172400	3173567	4735489		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830169.1|3172400_3173567_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.7	1.9e-226
>prophage 231
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3199236	3199767	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_001079074.1|3199236_3199767_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
>prophage 232
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3203311	3215902	4735489		Bacillus_phage(28.57%)	12	NA	NA
WP_001339045.1|3203311_3203983_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826769.1|3203982_3205341_+	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_000218209.1|3205448_3206300_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824402.1|3206891_3208106_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.5	5.2e-102
WP_001313057.1|3208673_3209039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365565.1|3209078_3209774_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.1e-07
WP_001157241.1|3209840_3211259_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	4.0e-101
WP_000786004.1|3211239_3211710_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001212248.1|3211698_3212619_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922682.1|3212791_3213709_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009306.1|3213787_3213970_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001351364.1|3214207_3215902_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.7e-18
>prophage 233
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3234378	3235050	4735489		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000334568.1|3234378_3235050_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	1.6e-81
>prophage 234
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3246865	3247618	4735489		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|3246865_3247618_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 235
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3259603	3261118	4735489		Cedratvirus(100.0%)	1	NA	NA
WP_001187810.1|3259603_3261118_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 236
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3271205	3276849	4735489		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_001307261.1|3271205_3272867_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000483220.1|3272912_3274514_+	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_000204335.1|3274532_3275393_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036378.1|3275395_3276445_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|3276459_3276849_+	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
>prophage 237
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3282101	3283835	4735489	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025326.1|3282101_3283835_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
>prophage 238
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3291729	3293780	4735489		Synechococcus_phage(50.0%)	3	NA	NA
WP_000019584.1|3291729_3292473_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252979.1|3292513_3292909_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639271.1|3292961_3293780_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.9e-72
>prophage 239
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3297798	3304862	4735489		Bacillus_virus(50.0%)	9	NA	NA
WP_001295503.1|3297798_3298320_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024917.1|3298321_3298924_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001386853.1|3298994_3299060_+	stress response small protein YobI	NA	NA	NA	NA	NA
WP_000580323.1|3299198_3299810_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568519.1|3299818_3300829_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000571479.1|3300975_3301761_-	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000202996.1|3301757_3302513_-	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_001342995.1|3302591_3303524_+	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_001184045.1|3303539_3304862_+	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
>prophage 240
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3312325	3313453	4735489		Planktothrix_phage(100.0%)	1	NA	NA
WP_000741721.1|3312325_3313453_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.5	3.6e-20
>prophage 241
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3327028	3328504	4735489		Cyanophage(100.0%)	1	NA	NA
WP_000301730.1|3327028_3328504_+	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	5.8e-79
>prophage 242
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3336560	3341030	4735489		Klebsiella_phage(33.33%)	7	NA	NA
WP_000944256.1|3336560_3337223_-	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_000011652.1|3337246_3337903_-	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000916763.1|3338004_3338235_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000204699.1|3338373_3338748_+	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000879285.1|3338751_3339624_+	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000976492.1|3339636_3339978_+	YebY family protein	NA	NA	NA	NA	NA
WP_000812724.1|3340373_3341030_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
>prophage 243
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3348526	3350575	4735489		Moraxella_phage(100.0%)	1	NA	NA
WP_001055778.1|3348526_3350575_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.2e-85
>prophage 244
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3355905	3356115	4735489		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|3355905_3356115_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 245
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3361755	3363312	4735489		Moraxella_phage(100.0%)	1	NA	NA
WP_000394987.1|3361755_3363312_+	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 246
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3367174	3375280	4735489	tRNA	Pandoravirus(33.33%)	8	NA	NA
WP_000854972.1|3367174_3368536_-	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	3.4e-41
WP_000457334.1|3368609_3368789_+	YoaH family protein	NA	NA	NA	NA	NA
WP_001300615.1|3368908_3369268_-	DUF1889 family protein	NA	NA	NA	NA	NA
WP_001295493.1|3369629_3369974_-	RidA family protein	NA	NA	NA	NA	NA
WP_000128858.1|3370105_3372016_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001220981.1|3372073_3372769_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000290576.1|3372808_3373390_+	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_000758422.1|3373594_3375280_+	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
>prophage 247
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3384623	3385832	4735489	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_000826417.1|3384623_3385832_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	2.0e-207
>prophage 248
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3391783	3396360	4735489		Bacillus_phage(100.0%)	3	NA	NA
WP_000766132.1|3391783_3393274_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
WP_000616433.1|3393454_3394930_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000219686.1|3395076_3396360_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
>prophage 249
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3399678	3400533	4735489		Indivirus(100.0%)	1	NA	NA
WP_001186343.1|3399678_3400533_+	methylglyoxal reductase YeaE	NA	A0A1V0SDE7	Indivirus	24.6	1.5e-10
>prophage 250
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3409346	3413431	4735489		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000723710.1|3409346_3410327_+	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
WP_000719096.1|3410463_3411222_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000438810.1|3411338_3412697_+	MFS transporter	NA	NA	NA	NA	NA
WP_001135062.1|3412789_3413431_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.9e-19
>prophage 251
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3418357	3420319	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|3418357_3420319_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 252
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3425917	3426571	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_001299561.1|3425917_3426571_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.7	3.3e-10
>prophage 253
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3433335	3434556	4735489		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|3433335_3434556_+	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 254
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3442032	3442860	4735489		Bacillus_virus(100.0%)	1	NA	NA
WP_000175009.1|3442032_3442860_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.6	5.9e-73
>prophage 255
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3448987	3451249	4735489		Tupanvirus(100.0%)	1	NA	NA
WP_000077848.1|3448987_3451249_-	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.8e-143
>prophage 256
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3462549	3482089	4735489	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_001144192.1|3462549_3464478_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	3.2e-130
WP_001700733.1|3464481_3465024_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|3465120_3465318_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|3465370_3465727_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|3465849_3465894_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018596.1|3466177_3467161_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_000672359.1|3467175_3469563_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|3469567_3469867_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000956530.1|3469967_3470948_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001154183.1|3471010_3471562_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|3471561_3472311_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209795.1|3472388_3472853_+	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_001326034.1|3473099_3473813_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_000175592.1|3473875_3475312_+	YdiU family protein	NA	NA	NA	NA	NA
WP_001270810.1|3475315_3475507_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082226.1|3475638_3476685_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_000368046.1|3476841_3477675_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_000069375.1|3478007_3480386_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000869246.1|3480442_3482089_-	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.8	2.0e-32
>prophage 257
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3500735	3505819	4735489		Lake_Baikal_phage(33.33%)	5	NA	NA
WP_000367160.1|3500735_3501104_+	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
WP_000089364.1|3501112_3502600_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000948872.1|3502609_3503356_+	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	5.1e-07
WP_000908012.1|3503330_3504602_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000144565.1|3504598_3505819_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
>prophage 258
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3514109	3516376	4735489		Escherichia_phage(50.0%)	3	NA	NA
WP_001676577.1|3514109_3514778_+	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	7.7e-23
WP_001069986.1|3514774_3515560_+	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_000587554.1|3515563_3516376_+	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
>prophage 259
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3521880	3530672	4735489		Orpheovirus(20.0%)	9	NA	NA
WP_023140410.1|3521880_3522522_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	34.7	1.7e-22
WP_000098911.1|3522561_3523710_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.7	4.2e-85
WP_001182363.1|3524000_3525212_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|3525324_3526257_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|3526253_3527279_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|3527577_3527667_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701040.1|3527832_3529002_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|3529147_3529729_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101193.1|3529856_3530672_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
>prophage 260
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3539474	3540973	4735489		Indivirus(50.0%)	2	NA	NA
WP_000250661.1|3539474_3540371_+	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	3.6e-07
WP_001296937.1|3540451_3540973_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
>prophage 261
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3547884	3549159	4735489	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|3547884_3549159_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 262
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3569042	3570854	4735489		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|3569042_3570854_+	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 263
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3580748	3582050	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_000732487.1|3580748_3582050_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	7.2e-17
>prophage 264
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3599812	3615250	4735489		Escherichia_phage(44.44%)	15	NA	NA
WP_000148710.1|3599812_3600427_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526492.1|3600469_3601324_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|3601325_3601943_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|3601953_3604377_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041554.1|3604437_3606864_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	2.0e-214
WP_001307224.1|3607062_3607368_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|3607475_3608186_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|3608188_3608749_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|3608783_3609125_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|3609259_3609586_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|3609791_3611006_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|3611017_3612037_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_000151243.1|3612094_3613462_+	MHS family MFS transporter YdfJ	NA	NA	NA	NA	NA
WP_000527797.1|3613550_3615011_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_000214712.1|3615046_3615250_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 265
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3620616	3621507	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_000592826.1|3620616_3621507_+	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.1e-19
>prophage 266
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3629011	3631141	4735489		Pandoravirus(50.0%)	3	NA	NA
WP_000012618.1|3629011_3630451_+	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.1e-29
WP_000803659.1|3630507_3630726_-	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000091199.1|3630757_3631141_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 267
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3638885	3640304	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_073508598.1|3638885_3640304_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
>prophage 268
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3648185	3649721	4735489		Staphylococcus_phage(100.0%)	1	NA	NA
WP_032214759.1|3648185_3649721_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	24.0	2.5e-16
>prophage 269
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3653124	3658545	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_032214761.1|3653124_3658545_+	autotransporter barrel domain-containing lipoprotein	NA	A0A2L1IV18	Escherichia_phage	38.1	3.6e-142
>prophage 270
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3675132	3682068	4735489		Bacillus_phage(50.0%)	3	NA	NA
WP_001296749.1|3675132_3676818_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	23.5	1.7e-10
WP_000832452.1|3676855_3679228_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001245017.1|3679284_3682068_+	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	5.7e-19
>prophage 271
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3687343	3691150	4735489		Bacillus_virus(50.0%)	2	NA	NA
WP_000426265.1|3687343_3688726_+	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_001307211.1|3688750_3691150_+	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
>prophage 272
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3695466	3697372	4735489		Planktothrix_phage(100.0%)	2	NA	NA
WP_000193564.1|3695466_3696453_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
WP_001285536.1|3696445_3697372_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
>prophage 273
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3700645	3702087	4735489		Tupanvirus(50.0%)	2	NA	NA
WP_000642407.1|3700645_3701656_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000781370.1|3701802_3702087_+	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
>prophage 274
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3708099	3708390	4735489		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|3708099_3708390_+	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 275
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3715276	3716821	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_000702567.1|3715276_3716821_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 276
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3729732	3736116	4735489		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_065225630.1|3729732_3733941_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	4.1e-21
WP_065225629.1|3734007_3736116_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	2.8e-26
>prophage 277
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3741025	3743128	4735489		Salmonella_phage(100.0%)	1	NA	NA
WP_000689355.1|3741025_3743128_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.6	1.1e-134
>prophage 278
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3747393	3748203	4735489		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000867987.1|3747393_3748203_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	41.0	7.7e-17
>prophage 279
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3751584	3762250	4735489	transposase	Mycoplasma_phage(20.0%)	10	NA	NA
WP_000220396.1|3751584_3752598_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
WP_000047456.1|3752615_3753761_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760615.1|3754005_3755412_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001270286.1|3755490_3755907_-	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000494244.1|3756328_3756559_+	YncJ family protein	NA	NA	NA	NA	NA
WP_001307191.1|3756650_3758612_-	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.9	7.1e-24
WP_000429155.1|3758684_3759221_-	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001307190.1|3759273_3760488_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_072024275.1|3760527_3761736_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.8e-208
WP_000604937.1|3761743_3762250_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	58.4	9.6e-42
>prophage 280
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3773543	3774492	4735489		Moraxella_phage(50.0%)	2	NA	NA
WP_000731833.1|3773543_3773717_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001307188.1|3773961_3774492_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
>prophage 281
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3778431	3782334	4735489		Klosneuvirus(100.0%)	1	NA	NA
WP_000139567.1|3778431_3782334_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 282
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3813619	3814609	4735489		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762229.1|3813619_3814609_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
>prophage 283
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3819569	3880525	4735489	coat,integrase,lysis,tRNA,terminase,holin,tail	Escherichia_phage(38.78%)	64	3842658:3842674	3886126:3886142
WP_000837924.1|3819569_3820703_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|3820843_3821278_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_120795384.1|3822054_3822168_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3822236_3822470_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_073508603.1|3822786_3823377_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.9e-25
WP_000885611.1|3823474_3824050_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073508439.1|3824049_3827124_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_023909745.1|3827188_3827788_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_073508604.1|3827854_3831253_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_000741591.1|3831313_3831961_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.9	1.4e-109
WP_073508441.1|3831858_3832602_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.3e-148
WP_001152434.1|3832607_3833306_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|3833305_3833644_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_073508605.1|3833636_3836870_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.6	1.7e-107
WP_012565075.1|3837343_3837703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029488565.1|3837853_3838816_-	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	2.6e-56
WP_000144678.1|3838842_3839235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001029815.1|3839231_3839612_-	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000524260.1|3839612_3839996_-	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_000634214.1|3839995_3840391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508606.1|3840606_3841746_-|coat	P22 coat - protein 5 family protein	coat	G8C7P7	Escherichia_phage	74.7	4.8e-158
WP_073508443.1|3841844_3842609_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.1	8.7e-87
3842658:3842674	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_073508444.1|3842713_3843826_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	2.4e-114
WP_000763702.1|3843809_3845216_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_000625348.1|3845218_3846520_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_032085165.1|3846500_3847595_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_172903414.1|3847598_3847850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204033.1|3847785_3848718_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	4.2e-83
WP_073508446.1|3848710_3849499_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	7.4e-49
WP_001703139.1|3849636_3851094_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228696.1|3851290_3851476_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135310.1|3851692_3852190_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	9.3e-90
WP_000839565.1|3852189_3852405_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|3852656_3853031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|3853202_3853631_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|3854675_3855218_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|3855214_3855505_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_000940319.1|3855504_3856104_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000149055.1|3856917_3857256_+	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001634983.1|3857979_3859179_+	MFS transporter	NA	NA	NA	NA	NA
WP_000957772.1|3859190_3859883_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000019009.1|3859879_3860761_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625667.1|3860891_3862169_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001676522.1|3862232_3864230_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_001151151.1|3864570_3864993_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|3865033_3866104_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|3866175_3866601_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|3866584_3866866_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|3866966_3867386_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001169151.1|3867785_3867941_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001312793.1|3867937_3868426_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560225.1|3868867_3869089_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001352098.1|3869088_3869259_+	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000632297.1|3869333_3869609_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105142.1|3869710_3872302_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.0	1.3e-243
WP_000166319.1|3872294_3873104_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001317028.1|3873160_3873355_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000276809.1|3873347_3873557_+	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_000079604.1|3873635_3873851_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_073508607.1|3873852_3875088_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.3e-238
WP_001157407.1|3875139_3876075_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123763.1|3876203_3877577_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	1.1e-52
WP_000387388.1|3878054_3879038_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001307164.1|3879292_3880525_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3886126:3886142	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
>prophage 284
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3886851	3887367	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945005.1|3886851_3887367_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	2.4e-24
>prophage 285
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3905547	3906630	4735489		Indivirus(100.0%)	1	NA	NA
WP_000057977.1|3905547_3906630_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 286
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3920633	3921899	4735489		Klosneuvirus(100.0%)	1	NA	NA
WP_000069228.1|3920633_3921899_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.0	4.6e-24
>prophage 287
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3934814	3940473	4735489		Bacillus_virus(50.0%)	5	NA	NA
WP_000573407.1|3934814_3935621_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000983281.1|3935688_3936042_+	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|3936411_3937200_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001307157.1|3937343_3938471_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000484982.1|3938538_3940473_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
>prophage 288
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3948288	3948879	4735489		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|3948288_3948879_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 289
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3953803	3959095	4735489	protease	Tupanvirus(33.33%)	4	NA	NA
WP_001297122.1|3953803_3956401_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
WP_001031530.1|3956780_3957032_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422045.1|3957067_3958117_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559281.1|3958336_3959095_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	24.5	4.4e-06
>prophage 290
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3964028	3966986	4735489		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000763511.1|3964028_3965624_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_000983912.1|3965624_3966986_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
>prophage 291
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3978643	3980658	4735489		Bacillus_virus(50.0%)	2	NA	NA
WP_000994905.1|3978643_3979648_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
WP_000110945.1|3979644_3980658_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
>prophage 292
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	3990072	4000083	4735489		Citrobacter_phage(25.0%)	10	NA	NA
WP_000068079.1|3990072_3990690_-	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
WP_001287378.1|3991295_3991709_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000718995.1|3991852_3992761_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_000193447.1|3992962_3993976_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_001226476.1|3994067_3994973_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_001307143.1|3995085_3995544_+	YchJ family protein	NA	NA	NA	NA	NA
WP_000555849.1|3995593_3996436_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001160110.1|3997160_3997838_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000571699.1|3997837_3998548_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_000702660.1|3998544_4000083_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
>prophage 293
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4011337	4011568	4735489		Spodoptera_litura_granulovirus(100.0%)	1	NA	NA
WP_001146442.1|4011337_4011568_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
>prophage 294
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4014669	4018677	4735489		Cafeteria_roenbergensis_virus(50.0%)	5	NA	NA
WP_000811065.1|4014669_4015524_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_001257044.1|4015559_4016369_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000200374.1|4016372_4016765_-	SirB family protein	NA	NA	NA	NA	NA
WP_000456467.1|4016761_4017595_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804726.1|4017594_4018677_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
>prophage 295
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4021813	4024565	4735489		Tupanvirus(50.0%)	2	NA	NA
WP_001298109.1|4021813_4022761_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|4022885_4024565_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
>prophage 296
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4051325	4053013	4735489		Salmonella_phage(50.0%)	2	NA	NA
WP_000457616.1|4051325_4052594_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
WP_000897378.1|4052593_4053013_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
>prophage 297
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4061548	4063870	4735489		Escherichia_phage(100.0%)	1	NA	NA
WP_001683996.1|4061548_4063870_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	43.0	3.0e-90
>prophage 298
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4069737	4073466	4735489		Enterobacteria_phage(66.67%)	6	NA	NA
WP_000332303.1|4069737_4070469_+	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
WP_000373101.1|4070689_4071094_+	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_032141808.1|4071146_4071257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795380.1|4071492_4071537_+	protein YmgK	NA	NA	NA	NA	NA
WP_001307134.1|4071789_4072113_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	8.0e-42
WP_000444487.1|4072215_4073466_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
>prophage 299
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4076602	4077973	4735489		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423750.1|4076602_4077973_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	5.5e-108
>prophage 300
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4083093	4085071	4735489		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000531601.1|4083093_4084230_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
WP_000799401.1|4084213_4085071_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
>prophage 301
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4088335	4092058	4735489		Vibrio_phage(50.0%)	4	NA	NA
WP_000952736.1|4088335_4089157_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000291270.1|4089172_4090084_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_047657126.1|4090112_4091357_-	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_001033695.1|4091356_4092058_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
>prophage 302
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4099346	4099604	4735489		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|4099346_4099604_-	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 303
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4111927	4113570	4735489		Streptococcus_virus(50.0%)	2	NA	NA
WP_001267931.1|4111927_4112932_-	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	30.9	8.4e-05
WP_001257000.1|4112928_4113570_-	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
>prophage 304
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4116842	4118024	4735489		Ralstonia_phage(50.0%)	2	NA	NA
WP_000103754.1|4116842_4117079_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
WP_001008535.1|4117289_4118024_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
>prophage 305
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4130381	4131323	4735489		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|4130381_4131323_-	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 306
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4147169	4147415	4735489		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|4147169_4147415_+	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 307
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4152077	4152998	4735489		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|4152077_4152998_+	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 308
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4162306	4162840	4735489		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|4162306_4162840_-	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 309
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4166974	4167808	4735489		Pelagibacter_phage(100.0%)	1	NA	NA
WP_047657123.1|4166974_4167808_+	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	6.6e-40
>prophage 310
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4172860	4175422	4735489	transposase	Acinetobacter_phage(50.0%)	2	NA	NA
WP_085948466.1|4172860_4174022_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000409849.1|4174063_4175422_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.0	1.1e-20
>prophage 311
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4182241	4183030	4735489		Cronobacter_phage(100.0%)	1	NA	NA
WP_000533522.1|4182241_4183030_-	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
>prophage 312
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4197941	4200041	4735489		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001028095.1|4197941_4198436_+	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
WP_001307098.1|4198456_4199785_+	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.9	1.1e-233
WP_001273658.1|4199867_4200041_-	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
>prophage 313
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4204345	4216610	4735489		Klosneuvirus(20.0%)	13	NA	NA
WP_000420631.1|4204345_4205266_+	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	3.2e-11
WP_000024560.1|4205265_4205571_+	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000209869.1|4205663_4206263_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_001062101.1|4206259_4208806_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.2	1.0e-70
WP_001230242.1|4208805_4209978_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001120112.1|4210117_4210810_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001264933.1|4210782_4211811_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_072034717.1|4211893_4214638_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	3.5e-37
WP_000818476.1|4214709_4215783_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_073508616.1|4215830_4216004_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001316982.1|4215993_4216224_-	protein YmcE	NA	NA	NA	NA	NA
WP_071524879.1|4216198_4216387_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|4216397_4216610_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
>prophage 314
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4235875	4236535	4735489	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|4235875_4236535_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 315
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4240768	4242823	4735489		Bacillus_phage(100.0%)	1	NA	NA
WP_000420533.1|4240768_4242823_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	7.7e-21
>prophage 316
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4255422	4257330	4735489		Tupanvirus(100.0%)	1	NA	NA
WP_000053099.1|4255422_4257330_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.9e-54
>prophage 317
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4273252	4281566	4735489	tRNA	Bacillus_virus(25.0%)	5	NA	NA
WP_001090514.1|4273252_4274020_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	1.7e-29
WP_000193844.1|4274226_4276839_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	7.0e-19
WP_001297200.1|4277104_4278307_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_047657242.1|4278475_4279876_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_000977920.1|4280477_4281566_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
>prophage 318
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4285115	4285664	4735489		Rhodobacter_phage(100.0%)	1	NA	NA
WP_001295932.1|4285115_4285664_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
>prophage 319
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4300369	4304910	4735489		Bacillus_phage(100.0%)	3	NA	NA
WP_000551270.1|4300369_4302118_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705706.1|4302154_4304419_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|4304625_4304910_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
>prophage 320
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4309996	4311085	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057149.1|4309996_4311085_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 321
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4315183	4318398	4735489		Tetraselmis_virus(100.0%)	2	NA	NA
WP_001292820.1|4315183_4317466_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000111043.1|4317657_4318398_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
>prophage 322
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4324708	4416014	4735489	portal,protease,head,plate,lysis,capsid,integrase,tRNA,terminase,tail	Salmonella_phage(58.33%)	94	4320980:4320995	4418585:4418600
4320980:4320995	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000213098.1|4324708_4325326_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850313.1|4325336_4327781_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	3.0e-221
WP_000886683.1|4328019_4329312_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067751.1|4329402_4330746_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	4.8e-80
WP_001295343.1|4330756_4331368_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077016.1|4331526_4335594_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|4335728_4336223_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|4336767_4337733_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043587.1|4337855_4339622_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202188.1|4339622_4341344_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	1.9e-20
WP_073508618.1|4341385_4342090_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|4342374_4342593_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|4343277_4345554_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|4345584_4345905_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|4346227_4346452_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188194.1|4346524_4348471_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	5.0e-38
WP_000746460.1|4348467_4349583_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|4349733_4350690_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000599806.1|4350686_4352345_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_005000084.1|4352770_4353466_+	aquaporin Z	NA	NA	NA	NA	NA
WP_001602087.1|4353919_4354819_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458830.1|4354962_4356615_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178673.1|4356626_4357595_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815350.1|4357727_4359446_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000566372.1|4359482_4360484_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|4360494_4361925_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|4362023_4363037_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255144.1|4363033_4363864_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160723.1|4363860_4364184_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270740.1|4364309_4364825_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|4365042_4365771_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|4365788_4366520_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|4366526_4367243_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|4367242_4367911_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|4368202_4368934_+	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_001149732.1|4369108_4370236_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_000389260.1|4370276_4370765_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061657.1|4370824_4371670_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105438.1|4371666_4372620_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996024.1|4372629_4373763_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000126097.1|4373857_4374970_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|4375320_4375797_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|4375884_4376787_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189159.1|4376847_4377570_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201576.1|4377553_4377841_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|4378000_4378258_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|4378287_4378665_-	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001024876.1|4378934_4380620_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|4380855_4381074_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_021515761.1|4381164_4382265_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	7.6e-177
WP_073508619.1|4382261_4382747_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	2.4e-66
WP_073508620.1|4382743_4385821_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.2	0.0e+00
WP_001513105.1|4385813_4385933_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	8.2e-13
WP_001281016.1|4385947_4386250_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_001504081.1|4386304_4386820_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_073508621.1|4386829_4388002_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.7	2.5e-202
WP_016237350.1|4388144_4388711_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	8.4e-87
WP_042018473.1|4388741_4389152_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	94.4	7.2e-64
WP_024008962.1|4389172_4389616_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	97.9	2.7e-80
WP_000639074.1|4389587_4389983_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001682746.1|4389991_4391407_-|tail	phage tail protein	tail	E5G6P0	Salmonella_phage	68.6	3.8e-128
WP_001682745.1|4391403_4392009_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	9.8e-110
WP_001583364.1|4392001_4392910_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_000177591.1|4392896_4393256_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.7	8.0e-51
WP_073508622.1|4393252_4393831_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	2.5e-94
WP_073508623.1|4393954_4395007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000369270.1|4395136_4395592_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.6	1.8e-55
WP_077897009.1|4395584_4396016_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	90.9	9.3e-70
WP_000196204.1|4396111_4396540_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	91.5	1.9e-59
WP_001069898.1|4396536_4397052_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.4	2.8e-89
WP_000171568.1|4397032_4397248_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|4397251_4397455_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673529.1|4397454_4397919_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	8.4e-77
WP_000059191.1|4398014_4398665_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742510.1|4398668_4399727_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_000216237.1|4399743_4400577_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_073508625.1|4400719_4402486_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_077897010.1|4402485_4403523_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.7	1.7e-170
WP_073508627.1|4403570_4404266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508628.1|4404285_4405350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073508629.1|4405346_4406411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|4406733_4406967_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|4406977_4407166_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_073508630.1|4407318_4409733_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004015189.1|4409729_4410587_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.1	1.9e-159
WP_000752619.1|4410583_4410811_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244224.1|4410810_4411044_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_000996717.1|4411111_4411453_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_004015188.1|4411570_4411867_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460951.1|4411874_4412384_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	90.5	4.0e-80
WP_001247705.1|4412416_4412638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047318.1|4412763_4413327_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	46.9	1.5e-40
WP_058905856.1|4413547_4414879_+	NTPase	NA	R9TRQ8	Vibrio_phage	27.4	4.8e-16
WP_004015184.1|4414961_4416014_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
4418585:4418600	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 323
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4422148	4423351	4735489		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000195961.1|4422148_4423351_-	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	8.2e-100
>prophage 324
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4434686	4436558	4735489		Planktothrix_phage(100.0%)	1	NA	NA
WP_001315369.1|4434686_4436558_-	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	4.0e-16
>prophage 325
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4439773	4443904	4735489		Synechococcus_phage(50.0%)	3	NA	NA
WP_000424893.1|4439773_4440436_-	fructose-6-phosphate aldolase	NA	A0A0E3HJ81	Synechococcus_phage	34.6	5.7e-26
WP_001442269.1|4440566_4441466_+	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_000209359.1|4441471_4443904_+	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	6.1e-09
>prophage 326
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4447801	4449394	4735489		Tupanvirus(100.0%)	1	NA	NA
WP_000961458.1|4447801_4449394_-	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
>prophage 327
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4454391	4459616	4735489		Escherichia_phage(33.33%)	7	NA	NA
WP_001295296.1|4454391_4454907_-	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
WP_120795379.1|4454959_4455025_-	protein YliM	NA	NA	NA	NA	NA
WP_001119538.1|4455259_4456147_+	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000100800.1|4456445_4456949_+	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_000843866.1|4457352_4458099_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_001159065.1|4458237_4458897_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000569080.1|4458893_4459616_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	41.8	2.5e-35
>prophage 328
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4463156	4477963	4735489		Erwinia_phage(14.29%)	13	NA	NA
WP_000710619.1|4463156_4463417_+	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
WP_000430036.1|4463676_4465959_+	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000990176.1|4466000_4466678_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|4466751_4467018_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|4467282_4467543_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443509.1|4467771_4468857_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386540.1|4468997_4469960_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_001340191.1|4469987_4472138_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_001145128.1|4472257_4472740_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.7	1.5e-36
WP_000007102.1|4472971_4474336_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001296991.1|4474564_4475236_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_149025603.1|4475238_4476234_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_000996107.1|4476226_4477963_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
>prophage 329
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4489275	4490184	4735489		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|4489275_4490184_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 330
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4496665	4497955	4735489		Klosneuvirus(100.0%)	1	NA	NA
WP_021542060.1|4496665_4497955_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	3.8e-18
>prophage 331
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4508310	4509369	4735489		Planktothrix_phage(100.0%)	1	NA	NA
WP_000891683.1|4508310_4509369_-	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.7	2.6e-20
>prophage 332
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4513869	4514886	4735489		Tupanvirus(100.0%)	1	NA	NA
WP_001265443.1|4513869_4514886_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	1.0e-79
>prophage 333
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4519242	4522762	4735489		Klebsiella_phage(33.33%)	4	NA	NA
WP_001109196.1|4519242_4520295_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
WP_000784351.1|4520610_4520991_+	YbgS-like family protein	NA	NA	NA	NA	NA
WP_000951292.1|4521104_4522046_+	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000345410.1|4522042_4522762_-	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
>prophage 334
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4558801	4559593	4735489		Kaumoebavirus(100.0%)	1	NA	NA
WP_001114025.1|4558801_4559593_-	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	28.8	3.7e-08
>prophage 335
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4562971	4565913	4735489		Acinetobacter_phage(50.0%)	2	NA	NA
WP_001032694.1|4562971_4564453_+	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
WP_000628038.1|4564494_4565913_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	5.2e-61
>prophage 336
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4577117	4583098	4735489		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_000087966.1|4577117_4579166_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	22.8	4.2e-27
WP_001324645.1|4579174_4579747_+	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_023140618.1|4579739_4582424_+	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.5	1.4e-11
WP_000186103.1|4582420_4583098_+	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	31.1	8.9e-27
>prophage 337
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4589753	4590518	4735489		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000773301.1|4589753_4590518_+	esterase	NA	A0A1J0GVH7	Mycobacterium_phage	35.4	4.4e-06
>prophage 338
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4594667	4598481	4735489	tRNA	Escherichia_phage(50.0%)	2	NA	NA
WP_001287154.1|4594667_4596332_-|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
WP_001023134.1|4596534_4598481_-	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
>prophage 339
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4603107	4604772	4735489		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337066.1|4603107_4604772_+	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.3	6.1e-85
>prophage 340
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4608907	4609948	4735489		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|4608907_4609948_+	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 341
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4617844	4621377	4735489		Planktothrix_phage(50.0%)	3	NA	NA
WP_000631384.1|4617844_4618570_+	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
WP_001207522.1|4618687_4619623_+	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_047657148.1|4619706_4621377_+	molecular chaperone HscC	NA	E5EQT9	Bathycoccus_sp._RCC1105_virus	35.9	8.0e-77
>prophage 342
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4628316	4630899	4735489	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001157890.1|4628316_4630899_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.3	5.2e-184
>prophage 343
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4637909	4640349	4735489		Synechococcus_phage(50.0%)	2	NA	NA
WP_001231428.1|4637909_4638998_+	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
WP_001092082.1|4639137_4640349_+	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
>prophage 344
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4645164	4645811	4735489		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_000939738.1|4645164_4645548_+	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
WP_000034825.1|4645601_4645811_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
>prophage 345
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4661236	4663351	4735489		Morganella_phage(50.0%)	2	NA	NA
WP_000278505.1|4661236_4661665_+	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
WP_000887629.1|4661785_4663351_-	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
>prophage 346
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4666460	4668283	4735489		Streptococcus_phage(50.0%)	2	NA	NA
WP_000029802.1|4666460_4667681_+	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.0	1.2e-58
WP_000502941.1|4667653_4668283_+	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
>prophage 347
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4682643	4688686	4735489		Klosneuvirus(50.0%)	3	NA	NA
WP_000140647.1|4682643_4683459_+	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
WP_000096744.1|4683455_4684589_-	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000077701.1|4684804_4688686_-	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.4	5.8e-62
>prophage 348
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4700115	4703259	4735489		Leptospira_phage(100.0%)	1	NA	NA
WP_047657150.1|4700115_4703259_-	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	2.2e-59
>prophage 349
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4706404	4716535	4735489		Bacillus_phage(33.33%)	5	NA	NA
WP_000770941.1|4706404_4707088_+	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	34.7	2.3e-30
WP_000253823.1|4707077_4708526_+	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	NA	NA	NA	NA
WP_000103215.1|4709262_4711164_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.1	6.0e-28
WP_001160804.1|4711191_4711653_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_047657189.1|4711672_4716535_+	PAAR/RHS domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.5	1.1e-20
>prophage 350
NZ_CP010177	Escherichia coli strain H14 chromosome, complete genome	4735489	4729798	4734121	4735489	tail	Enterobacteria_phage(66.67%)	3	NA	NA
WP_060612322.1|4729798_4730383_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.4	1.4e-105
WP_073508439.1|4730382_4733457_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	2.5e-68
WP_023909745.1|4733521_4734121_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
