The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	1059768	1070250	4630919	integrase	Enterobacteria_phage(75.0%)	12	1054844:1054859	1068699:1068714
1054844:1054859	attL	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_073464941.1|1059768_1061028_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.5	1.2e-72
WP_073464939.1|1061129_1061858_-	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_001430678.1|1062538_1063111_-	phage polarity suppression family protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
WP_021038238.1|1063184_1063685_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_052897484.1|1063681_1064416_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	3.0e-129
WP_001149160.1|1064968_1065235_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_073520251.1|1065231_1065822_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	88.8	1.3e-58
WP_001244665.1|1065814_1066102_+	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000459315.1|1066094_1066550_+	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_000168559.1|1068185_1069058_-	HNH endonuclease	NA	NA	NA	NA	NA
1068699:1068714	attR	GTGCTGTTCATCGAAA	NA	NA	NA	NA
WP_001338066.1|1069139_1069262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991447.1|1069269_1070250_-	9-O-acetyl-N-acetylneuraminic acid deacetylase	NA	Q08JA2	Stx2-converting_phage	55.6	3.9e-100
>prophage 2
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	1784286	1799162	4630919	tail	Enterobacteria_phage(62.5%)	18	NA	NA
WP_000858975.1|1784286_1784976_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|1785080_1785311_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182903.1|1785380_1785920_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_077792657.1|1785916_1786936_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.7e-111
WP_044687695.1|1786932_1787634_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	97.8	2.3e-126
WP_073520265.1|1787751_1789725_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_072130790.1|1790358_1790460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774774.1|1790456_1790912_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	1.3e-58
WP_000224907.1|1790911_1791082_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001774775.1|1791074_1791365_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	3.0e-48
WP_044687701.1|1791361_1791724_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_001204780.1|1791842_1792226_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737266.1|1792415_1793513_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_124036338.1|1796312_1797167_+|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	66.5	4.0e-48
WP_000885616.1|1797166_1797742_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|1797839_1798430_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|1798746_1798980_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1799048_1799162_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
>prophage 3
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	2816664	2828264	4630919	tail,holin	Escherichia_phage(27.27%)	12	NA	NA
WP_000527797.1|2816664_2818125_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.1e-42
WP_073520293.1|2819718_2820285_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	64.0	4.9e-63
WP_073520336.1|2820291_2820849_-|tail	tail fiber protein	tail	U5N099	Enterobacteria_phage	97.0	1.7e-07
WP_001398933.1|2821022_2821301_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	94.6	9.0e-42
WP_000799652.1|2822751_2823798_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	85.2	2.8e-176
WP_001355891.1|2823947_2824142_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_000123148.1|2824398_2825682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000532207.1|2825888_2826242_-	antitermination protein Q	NA	A0A0P0ZCW0	Stx2-converting_phage	85.7	1.4e-55
WP_001217451.1|2826231_2826603_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.6	2.3e-37
WP_073520294.1|2826615_2827662_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.0	2.9e-109
WP_001410105.1|2827663_2827942_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_000813254.1|2828108_2828264_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
>prophage 4
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	2831777	2843774	4630919	holin	Escherichia_phage(25.0%)	14	NA	NA
WP_005032116.1|2831777_2833775_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	2.2e-20
WP_001151151.1|2834115_2834538_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	4.8e-63
WP_001262352.1|2834578_2835649_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_000693836.1|2835720_2836146_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391949.1|2836129_2836411_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000362155.1|2836511_2836931_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_053921553.1|2837196_2837352_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171930.1|2837511_2837730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000598292.1|2838625_2838952_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|2839086_2839428_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2839462_2840023_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2840025_2840736_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|2840843_2841149_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041534.1|2841347_2843774_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	7.7e-214
>prophage 5
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	3129296	3204298	4630919	head,terminase,tail,holin,capsid,tRNA,plate,integrase,transposase,portal	Enterobacteria_phage(76.6%)	86	3168104:3168163	3205240:3205363
WP_000564745.1|3129296_3130268_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000399648.1|3130461_3131442_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000176851.1|3131711_3134141_-	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001214272.1|3134165_3135266_-	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001185741.1|3135653_3136400_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001326063.1|3136413_3136980_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025342.1|3137195_3138929_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001297434.1|3139105_3139594_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259583.1|3139713_3140106_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066983.1|3140105_3142184_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278959.1|3142176_3143325_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983609.1|3143526_3144171_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3144181_3144571_-	chemotaxis response regulator CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036386.1|3144585_3145635_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204335.1|3145637_3146498_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483239.1|3146516_3148118_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	6.4e-15
WP_073520303.1|3148163_3149825_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|3149969_3150473_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001355823.1|3150493_3152458_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795639.1|3152462_3153389_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906336.1|3153385_3154273_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3154399_3154978_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|3154980_3155331_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122426.1|3156110_3156539_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3156545_3157970_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001373153.1|3157944_3158745_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|3158911_3159898_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187810.1|3159912_3161427_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548675.1|3161496_3162486_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3163282_3163786_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|3163864_3164116_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3164230_3164317_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237866.1|3164579_3164903_+	YecR-like lipofamily protein	NA	NA	NA	NA	NA
WP_000917208.1|3165073_3165571_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377225.1|3165608_3165848_-	YecH family protein	NA	NA	NA	NA	NA
WP_073520304.1|3166038_3167250_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847902.1|3167311_3167977_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
3168104:3168163	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001720216.1|3168333_3169335_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.8	1.9e-105
WP_032197590.1|3169340_3169688_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_053890543.1|3169717_3170368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001582978.1|3170383_3170788_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	9.4e-24
WP_001673482.1|3170877_3171015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3171086_3171290_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_032197592.1|3171311_3171662_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	2.7e-51
WP_001366180.1|3171672_3171951_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	71.7	1.1e-31
WP_032197593.1|3171962_3172205_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	81.2	1.8e-30
WP_000021660.1|3172201_3172315_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	94.6	1.8e-09
WP_000985159.1|3172401_3172605_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000153684.1|3172601_3172847_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_032197594.1|3172988_3173354_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	67.8	1.1e-36
WP_032197595.1|3173359_3176182_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	93.7	0.0e+00
WP_032197596.1|3176258_3177218_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	3.8e-180
WP_000211256.1|3177222_3177534_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	97.1	5.0e-49
WP_072006115.1|3177597_3177981_+	ead/Ea22-like family protein	NA	Q8HAA6	Salmonella_phage	50.7	1.5e-31
WP_000711112.1|3178071_3178602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087812.1|3179133_3180180_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_032197597.1|3180179_3181931_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.1	0.0e+00
WP_001262666.1|3182085_3182922_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	4.6e-150
WP_001055089.1|3182945_3183998_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_073520305.1|3184043_3184844_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	3.4e-126
WP_000063074.1|3184946_3185441_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	100.0	4.1e-90
WP_032197599.1|3185440_3185641_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	97.0	5.1e-31
WP_000104350.1|3185643_3185967_+|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000072327.1|3185963_3186356_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_032197600.1|3186352_3186760_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	95.6	7.2e-64
WP_000920594.1|3186897_3187365_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_032197601.1|3187357_3187993_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	9.0e-114
WP_077759799.1|3188004_3188571_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	97.9	1.1e-99
WP_001067552.1|3188588_3188918_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	99.1	1.1e-54
WP_032197604.1|3188921_3189818_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.0	1.8e-155
WP_032197605.1|3189810_3190341_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	1.6e-92
WP_053890545.1|3190343_3192170_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	1.3e-109
WP_032197584.1|3192166_3193069_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	68.1	1.4e-96
WP_032197582.1|3193077_3193656_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.5	2.0e-96
WP_000954202.1|3193699_3194272_-	serine acetyltransferase	NA	NA	NA	NA	NA
WP_073520306.1|3194428_3194917_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	6.8e-85
WP_073520307.1|3194929_3197737_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.9	0.0e+00
WP_000333494.1|3197723_3197879_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	98.0	2.0e-22
WP_000665314.1|3197887_3198253_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290450.1|3198307_3198820_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000005390.1|3198819_3200004_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.7	1.5e-226
WP_032197580.1|3200161_3201271_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	98.9	2.5e-204
WP_000824288.1|3201376_3201844_-	TIR domain-containing protein	NA	NA	NA	NA	NA
WP_032197579.1|3201846_3203292_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_000488111.1|3203705_3203966_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|3204157_3204298_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
3205240:3205363	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAA	NA	NA	NA	NA
>prophage 6
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	3419649	3429091	4630919		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|3419649_3420786_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|3420782_3422783_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|3422907_3423369_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3423409_3423880_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3423926_3424646_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3424642_3426328_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3426549_3427281_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216961.1|3427340_3427448_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3427428_3428160_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|3428164_3429091_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 7
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	4012720	4019860	4630919		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|4012720_4015282_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141333.1|4015387_4016044_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	2.8e-49
WP_001297141.1|4016094_4016862_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4017057_4017966_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|4017962_4019225_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4019221_4019860_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 8
NZ_CP010167	Escherichia coli strain H3 chromosome, complete genome	4630919	4250023	4314121	4630919	integrase,tRNA,transposase,protease	Bacillus_virus(33.33%)	59	4283896:4283911	4321847:4321862
WP_000399648.1|4250023_4251004_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000034372.1|4251286_4252366_-	class II fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000111269.1|4252580_4253744_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000218480.1|4253793_4254813_-	erythrose-4-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000988702.1|4255184_4255616_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000124306.1|4255638_4256217_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000553286.1|4256217_4256925_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_000256969.1|4256912_4257590_+	energy-coupling factor ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000956872.1|4257583_4258261_+	sulfate/molybdate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	25.1	4.9e-09
WP_000687750.1|4258232_4258946_-	nucleoside/nucleotide kinase family protein	NA	NA	NA	NA	NA
WP_073520328.1|4258942_4259452_-	fumarase E	NA	NA	NA	NA	NA
WP_000987279.1|4259473_4260439_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000853221.1|4260435_4261713_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_000428805.1|4261727_4263116_-	PTS mannitol transporter subunit IICB	NA	NA	NA	NA	NA
WP_001239650.1|4263143_4263587_-	PTS mannitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000098614.1|4263900_4265892_-	transketolase	NA	NA	NA	NA	NA
WP_001297457.1|4266169_4266928_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
WP_001169551.1|4266983_4267727_-	2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_000193113.1|4267713_4268823_-	D-glucosaminate-6-phosphate ammonia lyase	NA	NA	NA	NA	NA
WP_160342238.1|4268826_4269687_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_000380263.1|4269683_4270433_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_001284302.1|4270458_4270944_-	PTS system mannose/fructose/N-acetylgalactosamine-transporter subunit IIB	NA	NA	NA	NA	NA
WP_000214203.1|4270954_4271383_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_001252647.1|4271501_4274300_-	transcriptional regulator DagR	NA	NA	NA	NA	NA
WP_000105566.1|4274558_4275479_-	agmatinase	NA	NA	NA	NA	NA
WP_000758915.1|4275614_4276346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|4276491_4278468_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4278476_4278608_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|4278743_4278959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4279262_4280417_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4280852_4282247_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|4282323_4282821_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|4282915_4283623_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4283702_4284434_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
4283896:4283911	attL	AGGTGCTGGAAGGCAA	NA	NA	NA	NA
WP_000593273.1|4284446_4285397_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4285505_4286069_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|4286068_4286485_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000399648.1|4286732_4287713_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_001055620.1|4287939_4288920_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4288937_4289642_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4289659_4290226_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4290222_4290513_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|4290520_4291114_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239944.1|4291106_4292243_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000745217.1|4292397_4293405_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|4293521_4294568_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4294743_4295463_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4295646_4295973_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4295972_4296692_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|4296852_4297905_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4297932_4298208_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001365878.1|4298272_4299352_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4299553_4300810_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839746.1|4300859_4302995_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234522.1|4303392_4304100_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218875.1|4304478_4305741_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.6	2.2e-79
WP_000723272.1|4310248_4310977_-	porin family protein	NA	NA	NA	NA	NA
WP_000132652.1|4311452_4311602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072714039.1|4313167_4314121_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
4321847:4321862	attR	TTGCCTTCCAGCACCT	NA	NA	NA	NA
