The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	1031073	1076731	4531885	tRNA,holin,integrase,transposase,protease	Serratia_phage(20.0%)	41	1024066:1024099	1072497:1072530
1024066:1024099	attL	TTGCCGGATGCGGCGTGAACGCCTTATCCGGCCT	NA	NA	NA	NA
WP_032248128.1|1031073_1032021_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_000035052.1|1032072_1035459_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_001288714.1|1035485_1036640_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000599365.1|1036655_1036913_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_050491571.1|1036939_1038526_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_001206281.1|1038579_1038858_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|1038872_1039157_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502008.1|1039174_1039453_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001217009.1|1039972_1040491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270145.1|1040490_1041309_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_032298845.1|1041331_1041910_-	TetR/AcrR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	31.3	3.8e-10
WP_047928846.1|1043821_1044802_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	7.5e-184
WP_000747051.1|1044949_1045300_-|transposase	transposase	transposase	Q716C1	Shigella_phage	98.9	1.8e-39
WP_001616050.1|1045369_1045717_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_001331566.1|1048057_1049527_+	amino acid permease	NA	NA	NA	NA	NA
WP_000671170.1|1049631_1052001_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_071526750.1|1052132_1053575_+	amino acid permease	NA	NA	NA	NA	NA
WP_033554035.1|1054592_1055855_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	6.7e-76
WP_000234514.1|1056233_1056941_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_032298507.1|1057338_1059474_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|1059523_1060780_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|1060981_1062061_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|1062125_1062401_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_032298508.1|1062428_1063481_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786911.1|1063641_1064361_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107564.1|1064360_1064687_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|1064870_1065590_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|1065765_1066812_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_073511791.1|1066928_1067936_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239916.1|1068090_1069227_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174735.1|1069219_1069813_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_053289958.1|1069820_1070111_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|1070107_1070674_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|1070691_1071396_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_071884781.1|1071413_1072394_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017111.1|1072569_1072986_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
1072497:1072530	attR	AGGCCGGATAAGGCGTTCACGCCGCATCCGGCAA	NA	NA	NA	NA
WP_000126441.1|1072985_1073621_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593273.1|1073657_1074608_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222508.1|1074620_1075352_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|1075431_1076139_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|1076233_1076731_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	1268988	1282171	4531885		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1268988_1269750_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1269743_1270370_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1270509_1271649_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1271711_1272704_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104459.1|1272797_1274162_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136916.1|1274250_1275027_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1275031_1275670_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_053289985.1|1275666_1276929_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	6.3e-135
WP_000847974.1|1276925_1277834_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.9e-118
WP_001272546.1|1277999_1278797_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	4.5e-70
WP_001141320.1|1278847_1279504_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
WP_001272928.1|1279609_1282171_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
>prophage 3
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	2424119	2464653	4531885	holin,integrase,lysis,transposase,protease	Escherichia_phage(27.27%)	50	2431695:2431711	2461441:2461457
WP_001260849.1|2424119_2424941_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2425040_2425124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2425216_2425552_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2425948_2427202_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2427308_2428202_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2428336_2429557_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2429681_2430377_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071607222.1|2430329_2431622_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2431695:2431711	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000148710.1|2431780_2432395_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_073511854.1|2432437_2433292_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2433293_2433911_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001433342.1|2433921_2436345_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
WP_032298142.1|2436405_2438832_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.7e-213
WP_001300836.1|2439030_2439336_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2439443_2440154_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2440156_2440717_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2440751_2441093_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2441227_2441554_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2441759_2442974_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836067.1|2442985_2444005_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2444062_2444173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877007.1|2444192_2445473_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	7.3e-155
WP_001296941.1|2445507_2445744_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_033873403.1|2445831_2448303_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	3.2e-58
WP_001083273.1|2448396_2448588_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2448584_2448773_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001328010.1|2449188_2449476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023281935.1|2449444_2449810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050491573.1|2449821_2449947_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000705349.1|2450022_2450544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054483.1|2450524_2451490_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_085947917.1|2451817_2453091_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_073511943.1|2453136_2453265_+	DUF977 family protein	NA	A0A2I6TCA7	Escherichia_phage	85.7	2.5e-15
WP_032298921.1|2453983_2455033_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	4.3e-113
WP_001204787.1|2455050_2455428_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_000780584.1|2455583_2456108_-	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_000592549.1|2456300_2457260_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001146313.1|2458444_2459158_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839588.1|2459348_2459564_+|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_000189900.1|2459568_2460120_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_001557934.1|2460067_2460328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101173.1|2460441_2460975_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001071778.1|2460971_2461469_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
2461441:2461457	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000072434.1|2461832_2462045_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	75.7	2.4e-23
WP_071528545.1|2462055_2462244_+	cold-shock protein	NA	NA	NA	NA	NA
WP_000878218.1|2462430_2463297_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|2463293_2463593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_059328823.1|2463693_2463807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|2463979_2464153_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000548593.1|2464446_2464653_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
>prophage 4
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	2650796	2655452	4531885	lysis	Escherichia_phage(62.5%)	10	NA	NA
WP_001228696.1|2650796_2650982_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001135274.1|2651198_2651696_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	3.2e-90
WP_000839599.1|2651695_2651911_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_000334743.1|2652167_2652407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001741631.1|2653085_2653628_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	9.8e-77
WP_029488571.1|2653624_2653915_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	9.6e-47
WP_001406929.1|2653914_2654514_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	95.5	2.0e-110
WP_032218041.1|2654580_2654841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001406927.1|2655086_2655242_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_122990642.1|2655344_2655452_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	3.2e-08
>prophage 5
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	2661979	2679270	4531885	tRNA,integrase	Escherichia_phage(68.42%)	23	2664965:2664980	2685816:2685831
WP_073511867.1|2661979_2662396_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.1	7.6e-61
WP_073511868.1|2662412_2663138_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	65.6	9.4e-83
WP_073511869.1|2663121_2663907_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.1	7.2e-113
WP_073511870.1|2663913_2664702_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	66.7	1.8e-42
WP_032218026.1|2664780_2665203_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	90.0	4.4e-64
2664965:2664980	attL	ATTGCCAGGATTGCAG	NA	NA	NA	NA
WP_001406917.1|2665186_2665414_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_073511871.1|2665491_2665899_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	1.6e-23
WP_001406915.1|2666086_2666365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052318727.1|2666496_2666652_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000288022.1|2666648_2667077_-	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2667579_2667801_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_077897037.1|2667800_2667971_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	73.2	3.6e-17
WP_000632297.1|2668045_2668321_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_023281732.1|2668422_2671023_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.0e-248
WP_073511874.1|2671015_2671849_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	66.8	5.5e-95
WP_072130784.1|2671905_2672100_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	92.2	9.3e-30
WP_001302840.1|2672092_2672281_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2672380_2672596_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_073511875.1|2672597_2673833_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	1.8e-238
WP_001157377.1|2673884_2674820_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123737.1|2674948_2676322_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2676799_2677783_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628058.1|2678037_2679270_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
2685816:2685831	attR	ATTGCCAGGATTGCAG	NA	NA	NA	NA
>prophage 6
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	3131728	3218614	4531885	tRNA,head,integrase,lysis,capsid,plate,protease,portal,tail,terminase	Salmonella_phage(59.65%)	88	3124692:3124707	3221185:3221200
3124692:3124707	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3131728_3133021_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3133111_3134455_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3134465_3135077_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077006.1|3135231_3139221_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3139355_3139850_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3140394_3141360_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_001043577.1|3141482_3143249_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_023281794.1|3143249_3144971_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	8.4e-21
WP_001241678.1|3145012_3145717_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3146001_3146220_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_033554496.1|3147018_3149295_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.5e-166
WP_000520781.1|3149325_3149646_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|3149968_3150193_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3150265_3152212_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_073511897.1|3152208_3153324_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001380339.1|3153474_3154431_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599802.1|3154427_3156086_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001338421.1|3157700_3158600_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|3158743_3160396_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178660.1|3160407_3161376_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3161508_3163227_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566372.1|3163263_3164265_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136559.1|3164275_3165706_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_033553491.1|3165804_3166818_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_033553478.1|3166814_3167645_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	7.4e-07
WP_001160737.1|3167641_3167965_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|3168090_3168606_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3168823_3169552_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3169569_3170301_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3170307_3171024_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3171023_3171692_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295905.1|3171917_3172649_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149740.1|3172847_3173975_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|3174015_3174504_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|3174563_3175409_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000105444.1|3175405_3176359_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3176368_3177502_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126069.1|3177596_3178709_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|3179059_3179536_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3179623_3180526_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000189162.1|3180586_3181309_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|3181292_3181580_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195225.1|3181739_3181997_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	3.0e-23
WP_000681108.1|3182026_3182404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3182673_3184359_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|3184594_3184813_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001011804.1|3184903_3186004_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.2e-175
WP_001552644.1|3186000_3186486_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	3.7e-67
WP_001282787.1|3186482_3189560_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000763311.1|3189552_3189672_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001552643.1|3189686_3189989_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	87.0	1.7e-38
WP_001207660.1|3190043_3190559_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_000046120.1|3190568_3191741_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001535207.1|3191883_3192450_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.9e-86
WP_006655262.1|3192832_3193258_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	60.0	3.3e-43
WP_047340714.1|3193260_3194667_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	75.0	9.8e-153
WP_073511898.1|3194663_3195269_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	91.5	2.9e-109
WP_001552638.1|3195261_3196170_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	1.6e-143
WP_000177581.1|3196156_3196516_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	86.6	2.8e-51
WP_001552634.1|3196512_3197091_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.5	1.1e-94
WP_047340712.1|3197159_3197606_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.2	1.3e-61
WP_088458319.1|3197598_3198030_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	4.9e-71
WP_001080918.1|3198125_3198554_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.4e-46
WP_047340710.1|3198550_3198928_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	1.8e-16
WP_001069905.1|3198929_3199442_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|3199422_3199638_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|3199641_3199845_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673530.1|3199844_3200309_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000059191.1|3200404_3201055_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_000742511.1|3201058_3202117_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_053264080.1|3202133_3202967_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	1.8e-122
WP_001098428.1|3203109_3204876_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_077897034.1|3204875_3205901_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.9	5.3e-172
WP_063082207.1|3205938_3207000_-	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_073511900.1|3207467_3209045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073511901.1|3209332_3209566_-	DinI family protein	NA	E5G6M1	Salmonella_phage	97.4	5.2e-35
WP_001154434.1|3209576_3209765_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_073511902.1|3209918_3212333_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_073511903.1|3212329_3213187_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.9	4.6e-161
WP_000752613.1|3213183_3213411_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_001244231.1|3213410_3213644_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_000996717.1|3213711_3214053_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956176.1|3214170_3214467_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460951.1|3214474_3214984_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	90.5	4.0e-80
WP_001247705.1|3215016_3215238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047318.1|3215363_3215927_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	46.9	1.5e-40
WP_001058144.1|3216147_3217479_+	NTPase	NA	R9TRQ8	Vibrio_phage	27.4	4.8e-16
WP_073511904.1|3217561_3218614_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	2.1e-107
3221185:3221200	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 7
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	3268459	3327987	4531885	transposase,tail,integrase	Enterobacteria_phage(21.05%)	54	3276594:3276628	3311179:3311213
WP_001300563.1|3268459_3269572_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000990177.1|3269773_3270451_+	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_000146343.1|3270524_3270791_+	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000849301.1|3271055_3271316_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000443530.1|3271544_3272630_-	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000386551.1|3272770_3273733_-	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_033553495.1|3273760_3275911_-	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	2.2e-42
WP_001145126.1|3276030_3276513_+	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
3276594:3276628	attL	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_000007101.1|3276744_3278109_-	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001741451.1|3278337_3279009_+	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000976400.1|3279008_3280007_+	secretion protein HlyD	NA	NA	NA	NA	NA
WP_024250156.1|3279999_3281736_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000070131.1|3281728_3282862_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000469031.1|3282872_3283979_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000871982.1|3283940_3284351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001113347.1|3284483_3285245_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000650314.1|3285241_3286483_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_000045446.1|3286482_3287439_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_000446897.1|3287474_3288188_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000373624.1|3288393_3289098_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_000852297.1|3289234_3289687_-	molybdopterin synthase catalytic subunit MoaE	NA	NA	NA	NA	NA
WP_000598619.1|3289688_3289934_-	molybdopterin synthase sulfur carrier subunit	NA	NA	NA	NA	NA
WP_000080888.1|3289926_3290412_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_000084639.1|3290414_3290927_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_001408763.1|3290948_3291938_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_001741442.1|3292334_3293243_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
WP_000042533.1|3293434_3295456_-	excinuclease ABC subunit B	NA	NA	NA	NA	NA
WP_000044837.1|3296034_3296712_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000246761.1|3296704_3297460_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_000118797.1|3297446_3298601_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_000951213.1|3298597_3299638_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_001300379.1|3299724_3301014_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.0	7.7e-19
WP_000767389.1|3301072_3301549_+	kinase inhibitor	NA	NA	NA	NA	NA
WP_001741422.1|3302294_3303626_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.6	1.4e-20
WP_001741474.1|3303699_3304284_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.8	2.5e-102
WP_071830731.1|3304283_3307511_-|tail	phage tail protein	tail	X2KTY7	Enterobacteria_phage	58.8	6.4e-06
WP_032259927.1|3307575_3308175_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	2.6e-110
WP_024167981.1|3308241_3308427_-	hypothetical protein	NA	Q687E8	Enterobacteria_phage	93.1	3.1e-06
WP_001303849.1|3308478_3308697_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_053287127.1|3308674_3309745_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.5e-201
WP_001091569.1|3309879_3311163_+	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_001338385.1|3311396_3313508_-	hydratase	NA	NA	NA	NA	NA
3311179:3311213	attR	TGCCGGATGCGGCGTAAACGCCTTATCCGGCCTAC	NA	NA	NA	NA
WP_024262939.1|3314309_3314507_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000427623.1|3314946_3315951_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000837725.1|3316676_3317174_-	heat resistance protein PsiE-GI	NA	NA	NA	NA	NA
WP_033554001.1|3317176_3318886_-	heat resistance system K+/H+ antiporter KefB-GI	NA	NA	NA	NA	NA
WP_000786815.1|3318889_3319330_-	heat resistance system thioredoxin Trx-GI	NA	A0A1J0GW78	Streptomyces_phage	37.2	5.8e-11
WP_004118192.1|3319319_3320465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000896642.1|3320488_3320701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033554000.1|3320700_3323550_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.2	3.1e-129
WP_000350436.1|3323655_3324225_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_000643630.1|3324259_3324541_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077817174.1|3324689_3324776_+	hypothetical protein	NA	U5P0U6	Shigella_phage	96.4	3.4e-08
WP_077817193.1|3327018_3327987_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	2.9e-172
>prophage 8
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	3536443	3539001	4531885	protease	Stx_converting_phage(66.67%)	6	NA	NA
WP_063122259.1|3536443_3536812_+	DUF2528 family protein	NA	A0A1I9LJN3	Stx_converting_phage	96.7	3.2e-63
WP_001198861.1|3536884_3537049_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_001741311.1|3537017_3537161_+	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	97.9	5.1e-17
WP_000995439.1|3537236_3537533_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3537538_3538324_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_023281837.1|3538320_3539001_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	5.1e-131
>prophage 9
NZ_CP010163	Escherichia coli strain H2 chromosome, complete genome	4531885	3759591	3810054	4531885	holin,transposase	Escherichia_phage(21.43%)	43	NA	NA
WP_000878218.1|3759591_3760458_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|3760454_3760754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001741693.1|3760816_3761611_-	putative protein YneK	NA	NA	NA	NA	NA
WP_000366502.1|3761688_3762570_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001338596.1|3762670_3764059_+	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000257409.1|3764122_3765049_+	glutaminase B	NA	NA	NA	NA	NA
WP_001191019.1|3765048_3765408_+	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000878970.1|3765519_3766467_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	9.6e-19
WP_073511859.1|3766693_3768145_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000637082.1|3768351_3769266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001286597.1|3769269_3770028_-	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_000558527.1|3770084_3770375_-	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_000774189.1|3770398_3771274_-	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000172488.1|3771300_3772323_-	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_001222721.1|3772334_3773327_-	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000911192.1|3773326_3774355_-	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_033554413.1|3774348_3775884_-	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000154352.1|3776132_3777086_+	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_023281919.1|3777164_3778757_+	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_001515737.1|3781900_3783178_-	serine dehydratase subunit alpha family protein	NA	NA	NA	NA	NA
WP_000948259.1|3783525_3784167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449980.1|3784166_3785105_-	MCE family protein	NA	NA	NA	NA	NA
WP_000254595.1|3785106_3785910_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	27.7	1.8e-10
WP_001325018.1|3785903_3787049_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_077897038.1|3788056_3788488_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_000928911.1|3789382_3789733_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073511921.1|3789894_3790149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072657381.1|3790312_3792835_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_072657383.1|3793026_3793944_-|transposase	IS5-like element ISEc35 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	59.5	3.3e-101
WP_000654804.1|3794122_3795091_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.0e-185
WP_072657384.1|3795626_3796691_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	1.3e-104
WP_072657385.1|3796705_3797575_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.4	5.2e-112
WP_072657386.1|3797606_3798497_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	4.8e-28
WP_072657387.1|3798511_3799066_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.0	1.9e-51
WP_073511922.1|3799157_3799988_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_072657389.1|3800017_3800851_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_023318679.1|3800840_3802163_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.6	1.4e-12
WP_073511923.1|3802166_3805550_+	hypothetical protein	NA	F2Y0P4	Organic_Lake_phycodnavirus	31.0	4.5e-18
WP_023318677.1|3805625_3806225_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_072657391.1|3806218_3806512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|3806761_3807466_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_123059508.1|3807625_3807715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131044.1|3808020_3810054_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
