The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	69471	72353	4818512		uncultured_Caudovirales_phage(33.33%)	7	NA	NA
WP_000780584.1|69471_69996_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	52.9	1.0e-46
WP_001204787.1|70151_70529_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001515373.1|70786_71065_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	9.7e-12
WP_001463433.1|71131_71383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|71599_71755_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|71826_72114_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|72113_72353_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
>prophage 2
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	76660	92312	4818512	lysis	Escherichia_phage(16.67%)	22	NA	NA
WP_001315552.1|76660_77017_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	71.4	6.3e-40
WP_001151262.1|77013_77436_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_073544560.1|77476_78442_-	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.5e-54
WP_000705355.1|78422_78944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073544561.1|78927_79155_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|79236_79644_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379588.1|79812_79968_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	6.8e-07
WP_001171952.1|80127_80346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|80913_81102_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|81098_81290_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_073544563.1|81383_83855_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.9e-58
WP_000005552.1|83927_84179_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_024201519.1|84213_85494_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.6	2.3e-156
WP_001360138.1|85513_85624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|85681_86701_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001619484.1|86712_87927_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|88132_88459_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705197.1|88593_88935_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|88969_89530_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_072104773.1|89532_90243_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|90350_90656_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_073544564.1|90854_92312_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.1	5.1e-120
>prophage 3
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	869606	885195	4818512	tail,tRNA	Enterobacteria_phage(90.0%)	15	NA	NA
WP_001283585.1|869606_870419_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289167.1|870418_871432_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000004836.1|871497_872655_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	6.0e-23
WP_060615039.1|874447_875047_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	1.3e-101
WP_001100987.1|875141_876320_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_000979945.1|876416_876905_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_073544650.1|876917_879725_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	92.2	0.0e+00
WP_000333503.1|879711_879867_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651572.1|879875_880250_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	73.2	9.0e-37
WP_000290462.1|880305_880818_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_073544651.1|880817_882002_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.7	5.3e-224
WP_073544652.1|882159_883269_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.5	1.0e-192
WP_000532200.1|883389_884412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073544653.1|884603_884864_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078920.1|885054_885195_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
>prophage 4
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	914304	922820	4818512	integrase	Enterobacteria_phage(55.56%)	9	912278:912294	926495:926511
912278:912294	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|914304_915237_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_073544657.1|915548_916706_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.5	8.2e-222
WP_073544658.1|916857_917220_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	90.8	4.1e-55
WP_073544659.1|917216_918131_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	93.4	2.2e-161
WP_127447344.1|918127_919438_+	hypothetical protein	NA	U5P0I5	Shigella_phage	38.9	3.2e-73
WP_073544661.1|919447_920665_-	hypothetical protein	NA	A0A1I9SEA9	Escherichia_phage	83.2	1.7e-209
WP_001368678.1|922059_922359_+	hypothetical protein	NA	Q9G076	Enterobacteria_phage	100.0	2.4e-53
WP_032353309.1|922394_922562_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	96.4	3.2e-26
WP_001163428.1|922619_922820_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
926495:926511	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 5
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	1152345	1243361	4818512	tail,portal,tRNA,terminase,protease,lysis	Enterobacteria_phage(34.55%)	90	NA	NA
WP_001295363.1|1152345_1153083_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|1153214_1154549_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|1154757_1155639_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|1155741_1156329_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|1156384_1156768_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|1157072_1157762_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|1157809_1158847_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|1159053_1159473_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001300438.1|1159541_1160240_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000083005.1|1160271_1162932_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|1163045_1164401_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_064735377.1|1164446_1164770_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|1164766_1166065_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|1171936_1174510_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040169.1|1174639_1175371_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|1175367_1176348_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|1176482_1177220_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|1177490_1177832_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_010723158.1|1177935_1177983_+	phe operon leader peptide	NA	NA	NA	NA	NA
WP_000200120.1|1178081_1179242_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|1179284_1180406_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168037.1|1180416_1181487_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|1181696_1182062_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_073544675.1|1182990_1183506_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|1183495_1184722_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589847.1|1184737_1185220_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|1185295_1185643_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|1185684_1186452_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|1186482_1187031_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|1187049_1187298_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|1187546_1188908_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|1189074_1189866_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|1189886_1191173_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|1191227_1191821_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_032083618.1|1191943_1192822_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|1192907_1194569_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|1194717_1195059_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|1195120_1195411_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|1195400_1195877_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|1196008_1196491_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|1197296_1198511_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_072095179.1|1198545_1199949_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_000355482.1|1200385_1201159_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_046080967.1|1201228_1201813_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	9.5e-102
WP_073544676.1|1201812_1205163_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	35.5	1.8e-11
WP_071686009.1|1205227_1205827_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.0e-110
WP_073544677.1|1205893_1209292_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.1	0.0e+00
WP_149025944.1|1209352_1209955_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	2.0e-86
WP_073544679.1|1209891_1210635_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	4.7e-146
WP_073544680.1|1210640_1211339_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447248.1|1211348_1211678_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_073544681.1|1211677_1214743_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.4	0.0e+00
WP_001161009.1|1214714_1215044_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001351445.1|1215052_1215439_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
WP_073544682.1|1215499_1216243_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	99.6	3.9e-132
WP_001079398.1|1216254_1216656_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677108.1|1216652_1217231_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001283144.1|1217242_1217518_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_001097050.1|1217510_1217834_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_077897049.1|1217920_1219948_-|protease	Clp protease ClpP	protease	A0A291AWT6	Escherichia_phage	99.7	0.0e+00
WP_073544684.1|1219892_1221401_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	2.5e-287
WP_001072975.1|1221400_1221613_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934130.1|1221609_1223712_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.3	0.0e+00
WP_000373425.1|1223711_1224206_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_032213815.1|1224540_1224861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001356226.1|1225241_1225685_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	77.9	7.1e-57
WP_001135250.1|1225681_1226179_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839597.1|1226178_1226394_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_000799656.1|1226461_1227514_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000917724.1|1227664_1227868_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_063090559.1|1228091_1228517_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	97.2	5.2e-73
WP_001547994.1|1228797_1229550_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	100.0	2.8e-138
WP_073544685.1|1229563_1230553_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	2.1e-194
WP_001709862.1|1230560_1231358_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	4.4e-150
WP_000767115.1|1231377_1231767_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_149025945.1|1231821_1232247_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	8.9e-41
WP_001305611.1|1232246_1232741_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	99.4	1.5e-87
WP_023993851.1|1232737_1233694_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	91.5	6.1e-138
WP_001250272.1|1233683_1233863_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_073544686.1|1234038_1234590_-	hypothetical protein	NA	U5P4K1	Shigella_phage	99.5	4.5e-101
WP_032198020.1|1234582_1234843_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	7.1e-41
WP_001020632.1|1234940_1235633_+	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	6.4e-121
WP_000135680.1|1236335_1236698_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|1236763_1237588_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|1237715_1238240_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|1238348_1239215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|1239256_1239463_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_073544688.1|1239423_1240590_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	8.7e-147
WP_073545054.1|1240648_1242382_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_059334294.1|1242461_1243361_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	22.8	1.9e-08
>prophage 6
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	1333260	1341369	4818512	integrase	Escherichia_phage(50.0%)	7	1320880:1320892	1337585:1337597
1320880:1320892	attL	GACGCATGTAGTT	NA	NA	NA	NA
WP_042999552.1|1333260_1333827_+	MarR family transcriptional regulator	NA	M1PL54	Cellulophaga_phage	43.8	8.0e-37
WP_042999551.1|1333916_1334492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058679578.1|1334488_1335958_-|integrase	integrase	integrase	A0A0R6PHE0	Moraxella_phage	28.3	2.2e-22
WP_001530778.1|1336117_1338685_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
1337585:1337597	attR	AACTACATGCGTC	NA	NA	NA	NA
WP_001141320.1|1338790_1339447_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	6.6e-51
WP_001295181.1|1339497_1340265_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847985.1|1340460_1341369_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
>prophage 7
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	3323852	3435749	4818512	holin,coat,tail,portal,integrase,protease,lysis,transposase	Enterobacteria_phage(45.31%)	120	3387717:3387764	3392942:3392989
WP_073544871.1|3323852_3324989_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001118036.1|3325029_3325800_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|3325953_3326427_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973083.1|3326469_3328914_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|3329153_3329732_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|3329937_3330705_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|3330675_3331416_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000729704.1|3331843_3332104_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001355630.1|3332289_3333063_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.3e-20
WP_000006256.1|3333238_3333736_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_073544872.1|3333951_3336045_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000785661.1|3336028_3337168_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_001260503.1|3337157_3337940_-	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_000958542.1|3337941_3338214_-	flagellar type III secretion system protein FliQ	NA	NA	NA	NA	NA
WP_000830273.1|3338216_3338969_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000043127.1|3338965_3339337_-	FliM/FliN family flagellar motor switch protein	NA	NA	NA	NA	NA
WP_001293003.1|3341298_3342756_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|3343016_3343475_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189541.1|3343566_3344811_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|3344868_3345270_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|3345308_3346364_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|3346651_3347755_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_073544873.1|3347766_3349020_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	5.8e-96
WP_000023575.1|3349224_3350385_-|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	100.0	1.2e-228
WP_000545737.1|3350960_3351128_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_073544874.1|3351216_3351498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073544875.1|3351612_3352185_-	ead/Ea22-like family protein	NA	A0A088CPS0	Enterobacteria_phage	72.6	1.7e-66
WP_073545067.1|3352181_3352748_-	HNH endonuclease	NA	C6ZR32	Salmonella_phage	88.6	1.2e-93
WP_016063198.1|3352989_3353568_-	HNH endonuclease	NA	K7PHS8	Enterobacteria_phage	100.0	1.7e-111
WP_001614322.1|3353554_3353731_-	DUF2737 family protein	NA	K7PL43	Enterobacteria_phage	100.0	3.7e-25
WP_001111303.1|3353741_3354035_-	DUF2856 family protein	NA	K7P7E6	Enterobacteria_phage	100.0	5.0e-51
WP_000951325.1|3354058_3354442_-	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	100.0	3.8e-67
WP_001404855.1|3354441_3355047_-	ERF family protein	NA	K7P6W7	Enterobacteria_phage	99.5	9.2e-108
WP_001243355.1|3355303_3355456_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|3355440_3355572_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_073544876.1|3355596_3356565_-	cell envelope biogenesis protein TolA	NA	G5DA88	Enterobacteria_phage	99.7	1.7e-55
WP_073545068.1|3356699_3356900_-	hypothetical protein	NA	A0A088CQ77	Enterobacteria_phage	98.5	1.4e-28
WP_073544877.1|3356899_3357178_-	hypothetical protein	NA	K7PHN6	Enterobacterial_phage	97.8	5.1e-45
WP_073544878.1|3357209_3357452_-	hypothetical protein	NA	G9IIJ7	Escherichia_phage	57.1	4.2e-19
WP_187658844.1|3357655_3357826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012817806.1|3357744_3358017_-	hypothetical protein	NA	K7PH69	Enterobacterial_phage	98.9	1.0e-26
WP_000394871.1|3358537_3358834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000846394.1|3358874_3359582_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C1P9	Escherichia_phage	85.1	5.2e-110
WP_001054987.1|3359693_3359918_+	helix-turn-helix domain-containing protein	NA	A0A0N7C1T6	Escherichia_phage	86.3	1.4e-29
WP_015966855.1|3360027_3360306_+	lambda phage CII family protein	NA	K7P8A8	Enterobacteria_phage	100.0	1.1e-42
WP_000166961.1|3360340_3360502_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_073544879.1|3360488_3361379_+	DNA replication protein	NA	G5DA89	Enterobacteria_phage	98.6	6.4e-158
WP_016063203.1|3361368_3362805_+	AAA family ATPase	NA	K7P7N4	Enterobacteria_phage	100.0	6.1e-275
WP_039022135.1|3363115_3363538_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	80.7	4.8e-63
WP_073544881.1|3363534_3364062_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	98.9	6.2e-100
WP_001254255.1|3364058_3364235_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_187658845.1|3364237_3364648_+	DUF2591 family protein	NA	A0A088CQ65	Enterobacteria_phage	97.1	8.2e-76
WP_073544883.1|3364640_3364817_+	protein ninF	NA	G9L691	Escherichia_phage	98.2	4.8e-25
WP_073544884.1|3364809_3365421_+	recombination protein NinG	NA	A0A088CQ20	Enterobacteria_phage	98.0	1.8e-98
WP_073544885.1|3365417_3365624_+	phage NinH family protein	NA	Q716C0	Shigella_phage	98.5	6.2e-32
WP_021566244.1|3365601_3366273_+	serine/threonine protein phosphatase	NA	Q716B9	Shigella_phage	96.9	2.5e-130
WP_000512810.1|3366263_3366782_+	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	2.0e-95
WP_000783734.1|3367243_3367567_+|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000229389.1|3367550_3368027_+	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_005760024.1|3368023_3368461_+|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	97.2	5.0e-71
WP_149025948.1|3368448_3368601_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	98.0	6.2e-21
WP_000807785.1|3369014_3369257_+	DUF2560 family protein	NA	A0A0M4R322	Salmonella_phage	100.0	7.5e-37
WP_025765985.1|3369259_3369697_+	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	95.3	1.2e-64
WP_048264270.1|3369696_3371157_+	hypothetical protein	NA	W6MW26	Pseudomonas_phage	76.2	8.2e-219
WP_073544887.1|3371156_3373325_+|portal	portal protein	portal	A0A2D1GLJ6	Escherichia_phage	98.5	0.0e+00
WP_073544888.1|3373338_3374250_+	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.0	4.1e-160
WP_073544889.1|3374249_3375545_+|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	98.4	5.2e-241
WP_024180326.1|3375589_3375850_+	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	96.6	2.4e-25
WP_021514122.1|3375827_3376328_+	hypothetical protein	NA	G8EYJ2	Enterobacteria_phage	100.0	1.7e-91
WP_073544890.1|3376328_3377747_+	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	99.4	3.5e-275
WP_073544891.1|3377746_3378448_+|tail	phage tail protein	tail	A0A2H4FWI9	Salmonella_phage	97.0	1.8e-78
WP_073544892.1|3378447_3378903_+	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	98.7	2.6e-86
WP_000964852.1|3378905_3379598_+	hypothetical protein	NA	G5DA80	Enterobacteria_phage	99.1	3.9e-110
WP_073544893.1|3379607_3380903_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	90.7	2.6e-184
WP_073544894.1|3380902_3382900_+	DNA transfer protein	NA	Q716G2	Shigella_phage	95.9	0.0e+00
WP_000287053.1|3382989_3383250_-	Arc family DNA-binding protein	NA	A0A088CPT2	Enterobacteria_phage	98.8	3.6e-37
WP_073544895.1|3385312_3387100_-	acyltransferase	NA	B5WZU0	Pseudomonas_phage	34.4	4.0e-74
WP_073545069.1|3387295_3387472_-|integrase	integrase	integrase	E7DYQ6	Enterobacteria_phage	73.2	3.7e-17
3387717:3387764	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
WP_073544645.1|3388626_3388935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947148.1|3389304_3390255_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_073544896.1|3391776_3392850_-|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	39.2	2.2e-48
WP_000523418.1|3393213_3394071_+	hypothetical protein	NA	NA	NA	NA	NA
3392942:3392989	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATT	NA	NA	NA	NA
WP_073544897.1|3394192_3394465_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001037132.1|3394532_3395600_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000119302.1|3395586_3396300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000919795.1|3396821_3400064_-	DEAD/DEAH box helicase	NA	A0A1B1ISM1	uncultured_Mediterranean_phage	25.9	2.2e-30
WP_001067855.1|3401189_3401894_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_073544898.1|3402348_3403659_-	guanine deaminase	NA	NA	NA	NA	NA
WP_073544899.1|3403760_3405257_-	NCS1 family nucleobase:cation symporter-1	NA	NA	NA	NA	NA
WP_073544900.1|3405400_3406117_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065810083.1|3406872_3407805_+	allantoinase PuuE	NA	NA	NA	NA	NA
WP_073544902.1|3407893_3408685_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_073544903.1|3408794_3409562_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073545071.1|3409765_3409990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073544905.1|3412243_3412630_-	oxalurate catabolism protein HpxZ	NA	NA	NA	NA	NA
WP_073544906.1|3412626_3414024_-	AtzE family amidohydrolase	NA	NA	NA	NA	NA
WP_004179955.1|3414020_3414206_-	oxalurate catabolism protein HpxX	NA	NA	NA	NA	NA
WP_073544907.1|3414216_3415803_-	oxamate amidohydrolase	NA	NA	NA	NA	NA
WP_048991470.1|3415982_3416822_+	MurR/RpiR family transcriptional regulator HpxU	NA	NA	NA	NA	NA
WP_004143665.1|3417036_3417822_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004176117.1|3417831_3418497_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_073544908.1|3418496_3419153_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_004143660.1|3419133_3419871_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.9	5.1e-36
WP_004224900.1|3419886_3421128_+	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_073544909.1|3421124_3422384_+	allantoate amidohydrolase	NA	NA	NA	NA	NA
WP_004179941.1|3422416_3423394_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_000854680.1|3425495_3425837_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070396.1|3425857_3426175_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_001568590.1|3426193_3426415_-	DUF987 domain-containing protein	NA	NA	NA	NA	NA
WP_000811693.1|3426423_3426900_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|3426915_3427374_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	32.8	2.0e-14
WP_000194654.1|3427471_3427711_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001385283.1|3427787_3428255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649865.1|3428277_3428721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001144031.1|3428720_3428957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000189411.1|3428997_3429699_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_000197387.1|3429915_3430737_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.1	2.1e-46
WP_001568592.1|3430828_3431692_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000323727.1|3433607_3434759_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.3	9.9e-26
WP_000196689.1|3434783_3435749_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 8
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	3909541	3916046	4818512	integrase,transposase	Escherichia_phage(50.0%)	8	3909454:3909468	3914117:3914131
3909454:3909468	attL	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_000533643.1|3909541_3910612_-|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
WP_001303849.1|3910589_3910808_-	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000545745.1|3910847_3911015_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001348592.1|3911257_3911860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763367.1|3912070_3912292_-	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_073544578.1|3912584_3913565_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_000767389.1|3914221_3914698_-	kinase inhibitor	NA	NA	NA	NA	NA
3914117:3914131	attR	GCTTTTTTATACTAA	NA	NA	NA	NA
WP_001295303.1|3914756_3916046_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 9
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	3995620	4029565	4818512	tail,portal,plate,integrase,capsid,head,terminase,lysis	Salmonella_phage(80.95%)	48	3985773:3985787	4017795:4017809
3985773:3985787	attL	CCTGCTGGACGTGGT	NA	NA	NA	NA
WP_000290937.1|3995620_3996673_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001513672.1|3996861_3997053_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|3997068_3997638_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|3997763_3997985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|3998017_3998527_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|3998534_3998735_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001352070.1|3998698_3999040_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_001244216.1|3999107_3999341_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	9.2e-32
WP_000752613.1|3999340_3999568_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000104157.1|3999564_4000422_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_073544958.1|4000418_4002833_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.1	0.0e+00
WP_001154431.1|4002986_4003175_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_001217566.1|4003185_4003419_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	92.2	3.7e-33
WP_001726291.1|4003609_4003753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366631.1|4003801_4004413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032301626.1|4004663_4005569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050488517.1|4005718_4006693_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_077897063.1|4006708_4007737_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	88.5	3.1e-172
WP_073544960.1|4007736_4009503_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216246.1|4009645_4010479_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	1.4e-122
WP_000742511.1|4010495_4011554_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_073544961.1|4011557_4012208_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.4	3.6e-110
WP_077897064.1|4012303_4012768_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	88.3	9.3e-76
WP_000868175.1|4012767_4012971_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|4012974_4013190_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069905.1|4013170_4013683_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_077897065.1|4013684_4014062_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	38.4	1.1e-15
WP_073544964.1|4014058_4014487_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	77.3	1.3e-47
WP_001039943.1|4014582_4015014_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	7.6e-72
WP_058101142.1|4015006_4015450_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.4	2.8e-61
WP_058101143.1|4015468_4016230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058101144.1|4016322_4016901_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	84.9	1.0e-92
WP_040091093.1|4016897_4017257_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	89.1	6.5e-53
WP_058101145.1|4017243_4018152_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	2.7e-143
4017795:4017809	attR	CCTGCTGGACGTGGT	NA	NA	NA	NA
WP_058101146.1|4018144_4018750_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_073544965.1|4018746_4020168_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	70.4	1.5e-180
WP_023281046.1|4020188_4020632_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	96.6	7.8e-80
WP_073544966.1|4020603_4021206_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.2	1.1e-92
WP_073544967.1|4021205_4021682_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.3	3.0e-53
WP_000905032.1|4021709_4022276_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_000046120.1|4022418_4023591_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	2.1e-204
WP_001207660.1|4023600_4024116_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_007866361.1|4024170_4024473_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	2.7e-39
WP_000763311.1|4024487_4024607_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001282787.1|4024599_4027677_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980413.1|4027673_4028159_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_034167057.1|4028155_4029256_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.7	2.9e-176
WP_000972391.1|4029346_4029565_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
>prophage 10
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	4540055	4603523	4818512	holin,tail,integrase,tRNA,terminase,lysis,transposase	Escherichia_phage(38.78%)	64	4534481:4534496	4578934:4578949
4534481:4534496	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_073545075.1|4540055_4541288_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|4541542_4542526_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|4543003_4544377_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|4544505_4545441_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_073545014.1|4545492_4546728_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	2.1e-239
WP_000079604.1|4546729_4546945_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|4547023_4547233_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_050491434.1|4547225_4547420_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	7.6e-32
WP_000166319.1|4547476_4548286_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_073545015.1|4548278_4550879_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.0e-248
WP_000632297.1|4550980_4551256_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|4551330_4551501_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|4551500_4551722_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|4552940_4553429_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|4553425_4553581_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000362155.1|4553980_4554400_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391949.1|4554500_4554782_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693836.1|4554765_4555191_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262352.1|4555262_4556333_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	4.7e-62
WP_073545016.1|4556373_4556796_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	87.8	1.1e-62
WP_001676522.1|4557136_4559134_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.2	3.3e-21
WP_073545017.1|4559197_4560475_+	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_000019009.1|4560605_4561487_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000957772.1|4561483_4562176_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_001117226.1|4562187_4563387_-	MFS transporter	NA	NA	NA	NA	NA
WP_000149055.1|4564110_4564449_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_001702268.1|4565262_4565862_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	2.9e-106
WP_001741607.1|4565861_4566152_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_085947771.1|4566521_4567684_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001208722.1|4568173_4568743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|4568711_4569014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029488570.1|4569090_4569432_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	89.2	6.9e-52
WP_029488569.1|4569435_4569912_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	1.5e-84
WP_001228696.1|4570128_4570314_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097893.1|4570510_4571968_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291093.1|4572105_4572897_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204028.1|4572889_4573822_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|4573757_4574009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016242650.1|4574012_4575107_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	2.2e-112
WP_000625348.1|4575087_4576389_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763702.1|4576391_4577798_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_073545019.1|4577781_4578894_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_073545020.1|4578998_4579763_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	1.5e-83
4578934:4578949	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918487.1|4579861_4581001_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|4581043_4581220_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|4581223_4581619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|4581618_4582002_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029819.1|4582002_4582383_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_073545021.1|4582379_4582772_+	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_073545022.1|4582798_4583761_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.8	5.0e-55
WP_012565075.1|4583911_4584271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073544578.1|4586779_4587760_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	1.5e-184
WP_073545076.1|4587971_4589177_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	37.5	2.3e-57
WP_000024051.1|4589169_4589508_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_073545023.1|4589507_4590206_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	94.0	2.3e-126
WP_001379783.1|4590211_4590955_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	8.0e-146
WP_073545024.1|4590852_4591500_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	8.9e-109
WP_001230352.1|4595026_4595626_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.3e-109
WP_000885587.1|4599041_4599617_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	2.0e-104
WP_000086527.1|4599714_4600305_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|4600621_4600855_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4600923_4601037_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001295593.1|4601814_4602249_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837924.1|4602389_4603523_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
>prophage 11
NZ_CP010160	Escherichia coli strain H1 chromosome, complete genome	4818512	4713326	4781112	4818512	integrase,transposase	Planktothrix_phage(22.22%)	50	4765997:4766011	4782258:4782272
WP_085947770.1|4713326_4714696_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_000781370.1|4714926_4715211_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|4715355_4716366_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
WP_000433476.1|4716499_4718197_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_000841554.1|4718353_4718491_-	stationary-phase-induced ribosome-associated protein	NA	NA	NA	NA	NA
WP_000495771.1|4718592_4718808_-	biofilm-dependent modulation protein	NA	NA	NA	NA	NA
WP_000152305.1|4719152_4719584_+	peroxiredoxin OsmC	NA	NA	NA	NA	NA
WP_001285555.1|4719639_4720566_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	1.2e-13
WP_000193568.1|4720558_4721545_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.2	7.2e-17
WP_000979630.1|4721541_4722438_-	D,D-dipeptide ABC transporter permease	NA	NA	NA	NA	NA
WP_000145104.1|4722434_4723457_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000830565.1|4723458_4725009_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001285821.1|4725022_4725604_-	D-alanyl-D-alanine dipeptidase	NA	NA	NA	NA	NA
WP_073528465.1|4728284_4729667_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
WP_000350395.1|4730038_4731358_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_000246019.1|4731488_4733024_-	acid resistance gamma-aminobutyrate antiporter GadC	NA	NA	NA	NA	NA
WP_000358930.1|4733179_4734580_-	glutamate decarboxylase	NA	NA	NA	NA	NA
WP_001244979.1|4734941_4737725_-	insulinase family protein	NA	A0A167R9K4	Powai_lake_megavirus	24.0	3.3e-19
WP_085947771.1|4741708_4742870_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_120795387.1|4743339_4743462_+	protein YneP	NA	NA	NA	NA	NA
WP_001301030.1|4743427_4744585_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_073545036.1|4744636_4746319_-	sulfatase	NA	NA	NA	NA	NA
WP_000060500.1|4746720_4747482_-	acid stress response transcriptional regulator YdeO	NA	NA	NA	NA	NA
WP_000543394.1|4747555_4747753_-	two-component system connector SafA	NA	NA	NA	NA	NA
WP_000726695.1|4748000_4750280_-	acid resistance putative oxidoreductase YdeP	NA	NA	NA	NA	NA
WP_073545037.1|4750613_4751528_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000825452.1|4751586_4752090_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876763.1|4752102_4752633_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000108589.1|4754980_4755538_+	OsmC family protein	NA	NA	NA	NA	NA
WP_008502230.1|4755679_4756261_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000888080.1|4756265_4756604_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_073545038.1|4756633_4756963_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_006687059.1|4757175_4758282_+	alkene reductase	NA	NA	NA	NA	NA
WP_008502228.1|4758347_4759049_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_001091224.1|4759114_4759888_+	SDR family oxidoreductase	NA	A0A0M4JSW6	Mollivirus	25.7	1.3e-08
WP_000872613.1|4760073_4761297_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000090196.1|4761427_4762300_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000734115.1|4762541_4763294_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032175021.1|4763733_4764738_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
4765997:4766011	attL	TCAGGTCGGCAACCA	NA	NA	NA	NA
WP_013036336.1|4766390_4766471_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_042201197.1|4766636_4770764_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001459743.1|4770899_4772042_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_016245986.1|4772558_4773494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379666.1|4773582_4773879_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001543770.1|4774186_4774747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024189840.1|4774844_4775177_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001214175.1|4775381_4775816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000788503.1|4775815_4778182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006810651.1|4778165_4779731_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_001543774.1|4779717_4781112_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4782258:4782272	attR	TCAGGTCGGCAACCA	NA	NA	NA	NA
