The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	797542	851608	4637555	plate,transposase,tail	Shigella_phage(35.29%)	46	NA	NA
WP_000246443.1|797542_798874_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|798876_799401_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|799397_800678_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|800702_801785_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|801748_803599_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|803602_804016_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073503183.1|804022_805498_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|805548_805773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|805807_806308_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|807002_807521_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_073503184.1|807730_809872_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.9	1.2e-24
WP_149026212.1|809947_814180_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|814157_814550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118036.1|816157_816928_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|817081_817555_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973083.1|817597_820042_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|820281_820860_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|821065_821833_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|821803_822544_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|822699_822978_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|822980_823241_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|823450_824200_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|824375_824873_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_073503185.1|825096_826836_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|826780_827566_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|827636_828692_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|828743_829037_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263488.1|829039_829438_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|829447_829900_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|830997_832455_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|832715_833174_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|833265_834510_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|834567_834969_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749867.1|835007_836063_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_001285288.1|836350_837454_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|837465_838719_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_073503187.1|840902_842738_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.5e-307
WP_149026213.1|842798_844127_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.1	1.1e-246
WP_000612626.1|846184_846532_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|846528_846933_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001752126.1|847665_848214_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	8.1e-95
WP_000424732.1|848213_848639_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_032281334.1|848625_849684_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	1.2e-200
WP_023568522.1|849674_850259_+	YmfQ family protein	NA	O22003	Shigella_phage	97.9	1.6e-112
WP_053889465.1|850262_851021_+	hypothetical protein	NA	U5P0I1	Shigella_phage	98.1	4.5e-51
WP_032361617.1|851020_851608_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	56.1	5.3e-60
>prophage 2
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	1344661	1374815	4637555	lysis,capsid,terminase,tail,head,portal	Enterobacteria_phage(59.46%)	37	NA	NA
WP_073503223.1|1344661_1345117_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	65.6	8.6e-58
WP_000224914.1|1345116_1345287_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774473.1|1345279_1345570_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_073503224.1|1345566_1345929_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	6.2e-59
WP_000971055.1|1345925_1346066_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|1346151_1346535_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737280.1|1346724_1347822_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|1348394_1348610_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_021534987.1|1348609_1349107_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	3.5e-89
WP_021537017.1|1349103_1349571_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	92.3	3.1e-71
WP_001139682.1|1349558_1349711_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059339.1|1349913_1350438_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001537735.1|1350740_1351151_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_032336848.1|1351209_1351443_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
WP_000453587.1|1351831_1352377_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_073503225.1|1352351_1354277_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_053276504.1|1354273_1354480_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	1.3e-29
WP_001345555.1|1354476_1356078_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_073503226.1|1356058_1357378_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001358225.1|1357387_1357720_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_073503227.1|1357775_1358801_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	2.2e-186
WP_000158882.1|1358842_1359238_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
WP_000752960.1|1359249_1359603_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_001398561.1|1359614_1360193_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000683128.1|1360189_1360585_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001317730.1|1360592_1361333_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_073503228.1|1361348_1361771_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	3.8e-60
WP_073503229.1|1361752_1362187_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_073503230.1|1362179_1364741_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.7	0.0e+00
WP_000847379.1|1364737_1365067_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_073503231.1|1365066_1365765_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	2.1e-132
WP_073503232.1|1365770_1366514_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.5e-147
WP_133301132.1|1366450_1367059_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.0	4.4e-102
WP_073503234.1|1367119_1370533_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|1370603_1371203_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_073503535.1|1371267_1374231_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
WP_073503235.1|1374230_1374815_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.7e-103
>prophage 3
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	1457594	1530857	4637555	plate,lysis,integrase,capsid,protease,tRNA,terminase,tail,head,portal	Salmonella_phage(66.67%)	85	1448524:1448538	1479869:1479883
1448524:1448538	attL	CCTGCTGGACGTGGT	NA	NA	NA	NA
WP_000290933.1|1457594_1458647_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|1458833_1459025_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047324.1|1459040_1459610_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001247707.1|1459735_1459957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1459989_1460499_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|1460506_1460707_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|1460670_1461012_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|1461079_1461313_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|1461312_1461540_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104146.1|1461536_1462391_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.1	2.9e-147
WP_001420002.1|1462396_1463218_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_021537010.1|1463217_1465590_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.7	0.0e+00
WP_001154434.1|1465751_1465940_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1465950_1466184_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_073503240.1|1466426_1467590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047204265.1|1467591_1468128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920990.1|1468487_1469543_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_063082208.1|1469586_1470612_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	3.1e-172
WP_001098428.1|1470611_1472378_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_032175287.1|1472520_1473354_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
WP_000742511.1|1473370_1474429_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059198.1|1474432_1475083_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_063085725.1|1475178_1475643_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|1475642_1475846_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171569.1|1475849_1476065_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_073503243.1|1476045_1476558_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.6e-87
WP_000727854.1|1476559_1476937_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001589059.1|1476933_1477362_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.9e-46
WP_149026215.1|1477457_1477889_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	1.9e-70
WP_073503246.1|1477881_1478328_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	5.6e-62
WP_044328442.1|1478396_1478975_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	2.1e-93
WP_073503247.1|1478971_1479331_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268301.1|1479317_1480226_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
1479869:1479883	attR	CCTGCTGGACGTGGT	NA	NA	NA	NA
WP_001086842.1|1480218_1480824_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	7.5e-110
WP_073503248.1|1480820_1482218_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.1	1.4e-151
WP_000500075.1|1482219_1482657_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	1.9e-46
WP_000639071.1|1482628_1483024_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001345660.1|1483032_1483440_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	42.3	3.6e-15
WP_073503249.1|1483467_1484034_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	4.9e-87
WP_000046124.1|1484176_1485349_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207660.1|1485358_1485874_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281013.1|1485928_1486231_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1486245_1486365_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_073503250.1|1486357_1489435_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
WP_000980404.1|1489431_1489917_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.9	2.2e-67
WP_001011786.1|1489913_1491014_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.1e-175
WP_000972391.1|1491104_1491323_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_073503251.1|1491558_1493244_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1493513_1493891_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195240.1|1493920_1494178_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1494337_1494625_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1494608_1495331_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1495391_1496294_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1496381_1496858_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1497208_1498321_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1498415_1499549_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|1499558_1500512_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1500508_1501354_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1501413_1501902_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1501942_1503070_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_001295339.1|1503268_1504000_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|1504290_1504959_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1504958_1505675_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1505681_1506413_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1506430_1507159_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1507376_1507892_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1508017_1508341_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1508337_1509168_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1509164_1510178_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1510276_1511707_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566376.1|1511717_1512719_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|1512755_1514474_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178677.1|1514606_1515575_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_073503252.1|1515586_1517239_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1517382_1518282_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1518776_1519472_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|1519897_1521556_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001380339.1|1521552_1522509_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|1522659_1523775_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_073503253.1|1523771_1525718_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1525790_1526015_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1526337_1526658_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1526688_1528965_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1529649_1529868_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1530152_1530857_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	2001632	2045245	4637555	lysis,integrase,transposase,tRNA,terminase	Escherichia_phage(43.59%)	49	2001267:2001282	2038067:2038082
2001267:2001282	attL	GCTGGATAAGCTGCGC	NA	NA	NA	NA
WP_000628058.1|2001632_2002865_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_073503286.1|2003119_2004103_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|2004580_2005954_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_073503287.1|2006082_2007018_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|2007069_2008305_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|2008306_2008522_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|2008600_2008810_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|2008802_2008997_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|2009053_2009863_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001532611.1|2009855_2012456_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|2012557_2012833_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|2012907_2013078_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|2013077_2013299_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|2013740_2014229_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|2014225_2014381_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|2014834_2015311_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|2015434_2015731_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000899748.1|2016187_2017045_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|2017051_2017798_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_073503288.1|2017820_2018582_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	6.1e-117
WP_001141106.1|2018597_2018975_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.8	1.6e-54
WP_073503289.1|2019265_2020948_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000505828.1|2021475_2022525_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021554378.1|2023099_2023255_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	89.6	1.3e-13
WP_074014158.1|2023448_2024561_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000940319.1|2025067_2025667_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247762.1|2025666_2025957_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	2.4e-45
WP_000640161.1|2025953_2026496_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_073503291.1|2027540_2027969_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|2028140_2028515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|2028766_2028982_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135280.1|2028981_2029479_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228696.1|2029695_2029881_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|2030077_2031535_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_016232661.1|2031672_2032464_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	3.7e-48
WP_001742940.1|2032456_2033389_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	9.3e-83
WP_187649179.1|2033324_2033576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073503294.1|2033579_2034674_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	3.8e-112
WP_073503295.1|2034654_2035956_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	5.2e-148
WP_000839179.1|2037141_2037546_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2037542_2037890_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|2037938_2039477_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
2038067:2038082	attR	GCTGGATAAGCTGCGC	NA	NA	NA	NA
WP_085949154.1|2039602_2040750_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_000086527.1|2041435_2042026_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2042342_2042576_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2042644_2042758_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|2043097_2043271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|2043536_2043971_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_073503298.1|2044111_2045245_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.4e-117
>prophage 5
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	2823993	2833434	4637555		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2823993_2825130_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_073503402.1|2825126_2827127_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2827251_2827713_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2827752_2828223_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2828269_2828989_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2828985_2830671_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_073503403.1|2830892_2831624_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	4.1e-110
WP_001216963.1|2831683_2831791_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2831771_2832503_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_073503404.1|2832507_2833434_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	8.2e-23
>prophage 6
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	2959241	2967850	4637555	transposase	Stx2-converting_phage(42.86%)	7	NA	NA
WP_001075164.1|2959241_2961527_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|2961760_2962891_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|2962890_2963145_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000839179.1|2963924_2964329_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|2964325_2964673_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|2964721_2966260_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_000779105.1|2966773_2967850_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 7
NZ_CP010152	Escherichia coli strain D9 chromosome, complete genome	4637555	3433388	3446571	4637555		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|3433388_3435950_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|3436055_3436712_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3436762_3437530_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3437725_3438634_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3438630_3439893_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3439889_3440528_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3440532_3441309_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3441397_3442762_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3442855_3443848_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3443910_3445050_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3445189_3445816_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3445809_3446571_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
NZ_CP010153	Escherichia coli strain D9 plasmid A, complete sequence	114159	2277	35151	114159	terminase,portal,tail	Salmonella_phage(100.0%)	35	NA	NA
WP_072652154.1|2277_7005_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.0	0.0e+00
WP_001293195.1|7022_7616_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_001405045.1|7603_8401_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_000511445.1|8393_9092_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|9174_9510_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_073503551.1|9552_14130_-	tape measure protein	NA	J9Q712	Salmonella_phage	82.8	0.0e+00
WP_000952686.1|14137_14362_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163860.1|14487_14805_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	3.3e-48
WP_000072375.1|14866_15613_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	6.2e-106
WP_000469440.1|15687_16071_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|16072_16546_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|16536_16881_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057117.1|16960_17794_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.0e-141
WP_000801186.1|17793_18228_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_021520523.1|18272_19193_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	78.6	5.3e-123
WP_001130339.1|19266_20142_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_073503552.1|20167_21055_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.9	2.3e-131
WP_073503553.1|21076_22651_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	2.4e-285
WP_001007299.1|22677_23934_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|23933_24566_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|24762_25029_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|25038_25929_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_001717191.1|25925_26591_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|26587_27256_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|27255_27936_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_039052494.1|28018_29578_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.3	8.3e-278
WP_021520518.1|29580_29859_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	61.5	6.4e-24
WP_024189780.1|30033_30633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021520104.1|30629_31151_+	hypothetical protein	NA	J9Q6L0	Salmonella_phage	68.2	7.3e-53
WP_021520516.1|31448_32099_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.7e-99
WP_000470243.1|32146_32377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|32992_33475_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_021512333.1|33825_34200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073503554.1|34317_34713_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
WP_000749406.1|34839_35151_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
>prophage 2
NZ_CP010153	Escherichia coli strain D9 plasmid A, complete sequence	114159	42730	95549	114159	integrase	Salmonella_phage(82.98%)	51	54136:54159	106624:106647
WP_001755496.1|42730_44287_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.9e-104
WP_001293038.1|44283_45531_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000149672.1|45652_48769_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	2.2e-27
WP_001090450.1|48827_49304_-	hypothetical protein	NA	J9Q747	Salmonella_phage	89.2	6.0e-78
WP_000467663.1|49407_50022_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.4	2.7e-99
WP_000335122.1|50360_50930_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_000893471.1|51069_51228_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900262.1|51227_51653_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.1	4.4e-56
WP_001104328.1|51746_51935_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_001348724.1|51944_52439_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	5.2e-24
WP_000208893.1|52587_53178_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.2	5.8e-91
WP_000121544.1|53764_53995_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
54136:54159	attL	TTATTTATATATACAGAAGCAGGC	NA	NA	NA	NA
WP_073503556.1|54181_54775_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	2.9e-98
WP_000099880.1|54958_55768_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
WP_016607532.1|55926_56484_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_001718079.1|56493_56913_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_000386469.1|56974_57619_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_073503557.1|57618_58095_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.9	2.9e-80
WP_000289389.1|58091_58493_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.2	5.1e-62
WP_073503558.1|58506_59610_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	88.0	1.5e-193
WP_073503559.1|59781_60651_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	81.0	9.1e-133
WP_000122502.1|60728_61871_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_073503560.1|61977_64293_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|64366_64936_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_053902540.1|64945_65689_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.6	9.4e-54
WP_000670359.1|65678_67595_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.9	8.4e-248
WP_000174803.1|67824_68910_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|69164_69809_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_162739249.1|70010_71225_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.1e-75
WP_073503561.1|71804_72017_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|72016_72352_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_073503562.1|72567_72843_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	4.4e-33
WP_000125192.1|72898_73324_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_073503563.1|73403_75743_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920225.1|75745_76012_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
WP_001717299.1|76011_76956_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	91.7	2.5e-168
WP_025670478.1|77016_78045_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001090697.1|78162_78594_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
WP_001240351.1|79133_79697_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_000066497.1|80026_80242_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
WP_073503564.1|80545_84052_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	88.4	0.0e+00
WP_073503565.1|84232_85468_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	81.0	2.0e-197
WP_073503566.1|85563_87672_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.1	4.8e-228
WP_024269779.1|87770_87983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|88234_88621_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|88615_89719_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|89929_90175_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_025670480.1|90171_90522_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	4.6e-27
WP_000067985.1|92175_92466_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_073503567.1|92823_94146_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	96.6	1.9e-251
WP_032187677.1|94736_95549_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	85.6	5.5e-124
106624:106647	attR	TTATTTATATATACAGAAGCAGGC	NA	NA	NA	NA
>prophage 3
NZ_CP010153	Escherichia coli strain D9 plasmid A, complete sequence	114159	102344	112030	114159		Salmonella_phage(72.73%)	14	NA	NA
WP_001603498.1|102344_102566_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053291281.1|102565_102943_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	9.3e-58
WP_032187668.1|103076_104192_-	DNA primase	NA	J9Q720	Salmonella_phage	94.9	1.5e-209
WP_073503572.1|104348_105689_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.7	5.5e-246
WP_073503573.1|105749_106475_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	3.0e-137
WP_000342417.1|106757_107525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160378290.1|107577_107931_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|107936_108605_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|108923_109193_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000072677.1|109200_109722_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000901559.1|109890_110142_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_032084069.1|110143_110836_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	94.3	1.0e-123
WP_032084070.1|110849_111173_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
WP_072647505.1|111247_112030_-	receptor-recognizing protein	NA	C4MYP9	Escherichia_phage	85.0	4.9e-53
>prophage 1
NZ_CP010154	Escherichia coli strain D9 plasmid B, complete sequence	78557	41847	59074	78557	transposase	Enterobacteria_phage(54.55%)	13	NA	NA
WP_049100257.1|41847_44787_-	AAA family ATPase	NA	A0A2K9L5A2	Tupanvirus	23.8	9.9e-22
WP_000861580.1|44864_45056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|45064_45451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022248.1|46971_47481_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	98.8	1.1e-90
WP_029396071.1|47492_48074_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	100.0	5.9e-104
WP_039022247.1|48109_48925_-	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	96.3	3.9e-109
WP_039022246.1|48934_50524_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	98.7	3.4e-303
WP_039022245.1|50584_52291_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.6	0.0e+00
WP_023338075.1|52555_53521_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	98.8	6.3e-167
WP_039022244.1|53517_54723_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	99.8	9.7e-226
WP_001076427.1|55122_55983_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_073503525.1|56777_57944_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_088765928.1|57953_59074_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
