The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	693171	749034	4711358	integrase,tRNA,head,terminase,lysis,protease,tail,portal,capsid	Enterobacteria_phage(44.44%)	64	692702:692748	739315:739361
692702:692748	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201810.1|693171_694125_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|694374_695124_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000239874.1|695986_696655_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|697020_697134_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|697202_697436_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000078177.1|697752_698343_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885602.1|698440_699016_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073520177.1|699015_702414_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_001233114.1|702478_703078_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_073520180.1|703145_706625_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_000090891.1|706684_707317_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140727.1|707253_707997_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.7e-149
WP_001152632.1|708002_708701_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847379.1|708700_709030_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840246.1|709026_711606_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.6	0.0e+00
WP_000459457.1|711598_712033_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479142.1|712014_712437_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	1.1e-70
WP_001358372.1|712452_713193_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000683105.1|713200_713596_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975081.1|713592_714171_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|714182_714536_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158863.1|714547_714943_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	7.4e-58
WP_000063250.1|714984_716010_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001358225.1|716065_716398_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123248.1|716407_717727_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_001316285.1|717707_719309_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	2.9e-310
WP_000198149.1|719305_719512_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027270.1|719508_721434_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_073516185.1|721408_721954_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	3.1e-94
WP_000105084.1|722342_722576_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|722632_723043_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001028465.1|723392_723914_-	DNA-binding protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_001082750.1|724118_724556_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	94.5	7.9e-69
WP_001135277.1|724552_725050_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|725049_725265_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737266.1|725853_726951_+	porin	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_001204780.1|727140_727524_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_001439538.1|727541_728531_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.8	3.1e-193
WP_001061414.1|728538_729336_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	7.5e-150
WP_000767113.1|729355_729745_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210170.1|729741_730068_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_001433188.1|730064_730718_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_001393497.1|730717_731212_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000104942.1|731208_732150_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|732139_732319_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_001440240.1|732494_733046_-	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	5.8e-101
WP_000205494.1|733083_733284_-	cell division protein	NA	NA	NA	NA	NA
WP_000450737.1|733381_734008_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	1.9e-47
WP_000549623.1|734255_734462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016389.1|734433_734868_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.4e-79
WP_000135682.1|735336_735699_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|735764_736589_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_039023311.1|736716_737253_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	8.2e-100
WP_001242715.1|737243_737606_+	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	7.5e-65
WP_000206814.1|737605_737911_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	4.1e-48
WP_000433949.1|737910_738282_+	helix-turn-helix domain-containing protein	NA	M1FJ59	Enterobacteria_phage	81.0	2.8e-46
WP_001298992.1|738137_739301_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_001402083.1|740269_740785_-	fimbria assembly protein	NA	NA	NA	NA	NA
739315:739361	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001402082.1|740795_741803_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_000776555.1|744880_745423_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729154.1|745903_746770_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|746771_746984_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143552.1|747091_747613_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001402080.1|747648_749034_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 2
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	1054232	1101890	4711358	plate,transposase	Clostridioides_phage(16.67%)	44	NA	NA
WP_000006256.1|1054232_1054730_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_024172591.1|1054905_1055664_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
WP_001225679.1|1055955_1056696_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000333380.1|1056666_1057434_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|1057639_1058218_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973065.1|1058457_1060902_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|1060944_1061418_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001402036.1|1061571_1062342_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_001366128.1|1062649_1063381_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_000917883.1|1063445_1063913_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001307587.1|1063909_1064632_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001402035.1|1064665_1065421_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|1065492_1066851_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001402034.1|1066898_1067669_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001230983.1|1067746_1068547_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_001402033.1|1068787_1069702_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001402032.1|1069698_1069902_-	2,5-diketo-D-gluconic acid reductase B domain protein	NA	NA	NA	NA	NA
WP_000420795.1|1069879_1071016_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
WP_001402130.1|1071472_1071856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402129.1|1072015_1076527_-	RHS repeat-associated core domain protein	NA	NA	NA	NA	NA
WP_001402128.1|1076557_1076989_-	DUF1795 domain-containing protein	NA	NA	NA	NA	NA
WP_001402127.1|1077016_1079236_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_100224276.1|1079260_1079608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402126.1|1079628_1080195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024170797.1|1080411_1081188_-	DUF2094 domain-containing protein	NA	NA	NA	NA	NA
WP_001402124.1|1081187_1085054_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_000522897.1|1085053_1085299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001060994.1|1085349_1086024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402123.1|1086029_1087346_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_000118770.1|1087342_1088686_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001402122.1|1088689_1089223_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000119441.1|1089290_1089776_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_000871595.1|1089889_1090261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533466.1|1090257_1090743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000245849.1|1090795_1092310_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000996814.1|1092334_1092880_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000144225.1|1092941_1093232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402121.1|1093234_1093798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001542643.1|1093810_1096444_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.8	2.5e-80
WP_001402119.1|1096776_1097691_+	type VI secretion system-associated protein TagK	NA	NA	NA	NA	NA
WP_001402118.1|1097677_1098508_+	impE family protein	NA	NA	NA	NA	NA
WP_001402117.1|1098504_1098999_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001402116.1|1099014_1100898_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001402115.1|1100894_1101890_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 3
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	1703641	1767359	4711358	plate,tail,integrase,tRNA	Burkholderia_phage(24.0%)	63	1693689:1693703	1708695:1708709
1693689:1693703	attL	ACGCCGCTGCCTGCT	NA	NA	NA	NA
WP_001050717.1|1703641_1705240_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_044067894.1|1705236_1706412_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_000168305.1|1706629_1707166_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
WP_000357740.1|1707419_1710242_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
1708695:1708709	attR	ACGCCGCTGCCTGCT	NA	NA	NA	NA
WP_000155648.1|1710276_1710633_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_001402774.1|1710636_1711053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402773.1|1711163_1711877_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_001402770.1|1713022_1714216_-	aromatic amino acid transaminase	NA	NA	NA	NA	NA
WP_001402769.1|1714297_1715302_-	AAA family ATPase	NA	A0A1L2CV87	Pectobacterium_phage	29.5	3.5e-27
WP_001402768.1|1715298_1715856_-	nicotinamide mononucleotide transporter	NA	I6W764	Vibriophage	27.7	2.5e-14
WP_001402767.1|1715878_1716958_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	28.2	4.0e-29
WP_000918363.1|1717010_1718426_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_000235516.1|1718508_1719492_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|1719657_1719900_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001725182.1|1720033_1721071_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001402764.1|1721433_1722438_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_001295691.1|1722756_1723272_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030593.1|1723313_1723523_-	CsbD family protein	NA	NA	NA	NA	NA
WP_073520192.1|1723638_1725018_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|1725036_1725645_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|1725754_1726123_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|1726293_1728717_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455228.1|1728871_1729744_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001295693.1|1729756_1730254_-	chorismate lyase	NA	NA	NA	NA	NA
WP_001402762.1|1730476_1732057_-	SopA family protein	NA	NA	NA	NA	NA
WP_001402761.1|1732285_1733206_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_001402760.1|1733448_1734789_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|1734860_1735976_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|1736340_1737531_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001365426.1|1737684_1739229_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252058.1|1739243_1740134_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001097274.1|1740505_1741981_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000202902.1|1742024_1742435_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000487766.1|1742560_1742704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295279.1|1742704_1742983_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000745708.1|1743029_1745126_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000595534.1|1745125_1745863_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_001296632.1|1745859_1746498_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_000757333.1|1746611_1746854_-	polysaccharide production threonine-rich protein	NA	NA	NA	NA	NA
WP_000789985.1|1747208_1748858_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001290317.1|1749382_1750732_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_001402759.1|1750793_1751135_-	mor transcription activator family protein	NA	Q6QIE8	Burkholderia_phage	48.1	2.2e-21
WP_001402757.1|1751671_1751959_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	48.6	1.8e-16
WP_001402756.1|1751961_1752567_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.7	2.5e-57
WP_000777272.1|1752579_1752894_+	membrane protein	NA	Q5ZQY8	Pseudomonas_phage	43.2	9.2e-19
WP_001402755.1|1753040_1753496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875310.1|1753492_1753690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001402754.1|1753679_1755104_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.6	6.4e-192
WP_000907502.1|1755103_1755628_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	9.5e-69
WP_001402753.1|1755678_1755996_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_086722008.1|1755955_1756084_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001402752.1|1756185_1758561_+|tail	phage-related minor tail family protein	tail	A4JWL0	Burkholderia_virus	25.4	9.1e-58
WP_001402751.1|1758560_1759514_+	phage P2 GpU family protein	NA	A4JWL1	Burkholderia_virus	50.8	1.9e-35
WP_001402750.1|1759513_1759723_+	phage Tail protein X family protein	NA	A4JWL2	Burkholderia_virus	58.8	3.7e-16
WP_001402749.1|1759710_1760751_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.4	3.0e-74
WP_001402748.1|1760760_1761462_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	36.3	6.4e-12
WP_001093498.1|1761560_1761920_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	4.7e-35
WP_000951745.1|1761910_1763026_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	51.7	2.0e-100
WP_001755399.1|1763018_1763651_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	53.0	3.1e-21
WP_001402746.1|1763653_1765480_+|tail	phage tail fiber repeat family protein	tail	A0A0M3ULH6	Salmonella_phage	43.5	2.1e-54
WP_001402745.1|1765486_1766101_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_001402744.1|1766097_1766553_+	hypothetical protein	NA	F6MIM0	Haemophilus_phage	43.3	3.0e-26
WP_001402743.1|1766567_1767359_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	45.1	9.1e-47
>prophage 4
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	3213182	3226365	4711358		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|3213182_3213944_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|3213937_3214564_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|3214703_3215843_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|3215905_3216898_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001402448.1|3216991_3218356_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|3218444_3219221_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|3219225_3219864_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|3219860_3221123_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|3221119_3222028_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272549.1|3222193_3222991_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_001141314.1|3223041_3223698_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_073520210.1|3223803_3226365_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.9e-30
>prophage 5
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	3837569	3847010	4711358		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569327.1|3837569_3838496_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|3838500_3839232_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3839212_3839320_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|3839379_3840111_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|3840332_3842018_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3842014_3842734_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|3842780_3843251_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|3843290_3843752_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001402348.1|3843876_3845877_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.5	0.0e+00
WP_001292770.1|3845873_3847010_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
>prophage 6
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	3863283	3927390	4711358	integrase,tRNA,plate,head,tail,holin,terminase,lysis,capsid,portal	Escherichia_phage(40.91%)	71	3890532:3890559	3923065:3923092
WP_001295427.1|3863283_3865317_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|3865448_3866558_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001307891.1|3866820_3867102_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830468.1|3867394_3867937_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677395.1|3868016_3868691_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945406.1|3868706_3871187_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001026151.1|3871200_3872235_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|3872316_3872655_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134576.1|3872873_3873698_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|3873818_3874091_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195590.1|3874313_3875102_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822274.1|3875098_3875899_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001297420.1|3875963_3876782_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.5	2.3e-24
WP_000434038.1|3876833_3877580_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011973.1|3877553_3878519_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846231.1|3878515_3879520_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.0	6.4e-13
WP_000858477.1|3879516_3880794_-	nucleoside permease	NA	NA	NA	NA	NA
WP_000129551.1|3881050_3882103_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289788.1|3882412_3883267_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853892.1|3883295_3884558_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182904.1|3884567_3885020_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823272.1|3885050_3885335_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|3885338_3886694_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844200.1|3886741_3887782_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|3887881_3888661_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|3888742_3889642_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_000716757.1|3890056_3890374_+	hypothetical protein	NA	NA	NA	NA	NA
3890532:3890559	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|3890638_3891652_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|3891767_3892067_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|3892181_3892457_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|3892634_3893135_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|3893198_3893423_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277958.1|3893422_3893725_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	5.0e-46
WP_114143999.1|3893724_3893961_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	97.0	2.5e-29
WP_000027664.1|3893944_3894220_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_073520217.1|3894209_3896483_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
WP_021563763.1|3896686_3899281_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_000038193.1|3899772_3900807_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	2.1e-200
WP_000156872.1|3900806_3902579_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	100.0	0.0e+00
WP_001085972.1|3902752_3903607_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	100.0	1.3e-139
WP_001752370.1|3903665_3904739_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	2.5e-201
WP_073520218.1|3904742_3905486_+|terminase	terminase endonuclease subunit	terminase	Q83VT2	Escherichia_phage	98.8	1.5e-120
WP_000988633.1|3905585_3906095_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|3906094_3906298_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|3906301_3906583_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|3906582_3907080_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736597.1|3907094_3907520_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.0	4.7e-58
WP_073520219.1|3907507_3907933_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	3.0e-65
WP_001440152.1|3907904_3908078_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001774102.1|3908040_3908508_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_001001786.1|3908500_3908953_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	100.0	8.2e-77
WP_053276450.1|3909019_3909655_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.2	4.6e-110
WP_001532465.1|3909651_3909999_+|plate	baseplate assembly protein W	plate	A0A0F7L9X3	Escherichia_phage	98.3	7.2e-57
WP_001532463.1|3910003_3910912_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	2.8e-161
WP_001285325.1|3910904_3911435_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_053276451.1|3911445_3913656_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	93.8	0.0e+00
WP_042036472.1|3913659_3914187_+|tail	tail fiber assembly protein	tail	U5N0T1	Enterobacteria_phage	96.0	1.4e-91
WP_000002748.1|3914407_3914686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042036469.1|3914738_3914918_-	DUF3606 domain-containing protein	NA	NA	NA	NA	NA
WP_040090665.1|3916361_3917552_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	1.8e-224
WP_001251408.1|3917564_3918083_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|3918139_3918415_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|3918447_3918567_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_044068781.1|3918559_3921007_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.9	0.0e+00
WP_053276583.1|3921021_3921501_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	3.3e-84
WP_000882969.1|3921500_3922664_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	100.0	2.8e-206
WP_000468308.1|3922745_3922964_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|3923236_3924598_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
3923065:3923092	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|3924744_3925077_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137873.1|3925267_3925990_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	1.9e-30
WP_000675146.1|3925986_3927390_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 7
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	4415607	4479132	4711358	integrase,holin,terminase,lysis,protease,tail,portal	Enterobacteria_phage(40.0%)	70	4427788:4427803	4465364:4465379
WP_001260849.1|4415607_4416429_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|4416528_4416612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|4416704_4417040_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|4417436_4418690_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|4418796_4419690_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|4419824_4421045_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919226.1|4421169_4421865_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071524606.1|4421817_4423110_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|4423268_4423883_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|4423925_4424780_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|4424781_4425399_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001433342.1|4425409_4427833_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	2.8e-208
4427788:4427803	attL	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_000041556.1|4427893_4430320_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001307224.1|4430518_4430824_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|4430931_4431642_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|4431644_4432205_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|4432239_4432581_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|4432715_4433042_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|4433247_4434462_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836037.1|4434473_4435493_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_072133799.1|4435550_4435661_+	transporter	NA	NA	NA	NA	NA
WP_000877001.1|4435680_4436961_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|4436995_4437232_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048357.1|4437319_4439791_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|4439884_4440076_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000783095.1|4440072_4440261_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000344950.1|4440747_4441323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4441324_4441480_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003381.1|4441672_4442080_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476993.1|4442157_4442385_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705360.1|4442368_4442890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054496.1|4442870_4443836_+	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	3.4e-56
WP_001151185.1|4443876_4444302_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	5.4e-62
WP_023156363.1|4444674_4445382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001402181.1|4445391_4445658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000096969.1|4446890_4448240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122653675.1|4448663_4448771_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_000813254.1|4448873_4449029_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000981001.1|4449245_4449497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032151735.1|4449563_4449842_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001755071.1|4449843_4450899_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.3	5.4e-87
WP_000140005.1|4450899_4451280_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	1.7e-35
WP_000762931.1|4451276_4452098_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.4	1.7e-80
WP_000839572.1|4452533_4452749_+|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193284.1|4452753_4453098_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.1e-36
WP_000369848.1|4453063_4453336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992051.1|4453441_4453984_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.2	9.5e-96
WP_000700650.1|4453980_4454517_+	hypothetical protein	NA	K7PHH7	Enterobacteria_phage	83.5	4.2e-72
WP_050485393.1|4454685_4455378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421825.1|4455947_4456487_+	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_000507029.1|4456495_4458595_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.0	0.0e+00
WP_001072975.1|4458591_4458804_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001724604.1|4458803_4460312_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.2	4.3e-287
WP_001613113.1|4460256_4462284_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.2	0.0e+00
WP_001097050.1|4462370_4462694_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|4462686_4462962_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677108.1|4462973_4463552_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	7.2e-102
WP_001079398.1|4463548_4463950_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211109.1|4463961_4464705_+|tail	tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001297778.1|4464765_4465152_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	3.6e-65
WP_001161009.1|4465160_4465490_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
4465364:4465379	attR	GGCTGATTTCAGCCTT	NA	NA	NA	NA
WP_001613112.1|4465461_4468527_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.2	0.0e+00
WP_000447248.1|4468526_4468856_+|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_001724602.1|4468865_4469564_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	5.6e-133
WP_000140727.1|4469569_4470313_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	2.7e-149
WP_000090891.1|4470249_4470882_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_073520180.1|4470941_4474421_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001233114.1|4474488_4475088_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
WP_073520177.1|4475152_4478551_+	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_073520223.1|4478550_4479132_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.7	8.0e-101
>prophage 8
NZ_CP010148	Escherichia coli strain D6 chromosome, complete genome	4711358	4700559	4709032	4711358	tail	Enterobacteria_phage(50.0%)	7	NA	NA
WP_000837924.1|4700559_4701693_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|4701833_4702268_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_001157925.1|4702532_4702706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000586336.1|4702980_4704312_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000885615.1|4704385_4704970_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.3	1.5e-102
WP_073520177.1|4704969_4708368_-	short-chain fatty acid transporter	NA	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_001233114.1|4708432_4709032_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	2.5e-105
>prophage 1
NZ_CP010149	Escherichia coli strain D6 plasmid A, complete sequence	199494	87077	109466	199494	transposase,protease,integrase	Escherichia_phage(50.0%)	20	73302:73316	100429:100443
73302:73316	attL	AAAACCTGCTCATAC	NA	NA	NA	NA
WP_001066954.1|87077_87818_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001312821.1|87938_88127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|88500_89409_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|89471_90581_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|91013_91967_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|93239_93398_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_072834405.1|94630_94912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339650.1|95052_96879_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_001015823.1|96881_97367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072714138.1|97356_98457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|99313_100507_-	hypothetical protein	NA	NA	NA	NA	NA
100429:100443	attR	GTATGAGCAGGTTTT	NA	NA	NA	NA
WP_114144001.1|101729_102020_-|transposase	transposase	transposase	Q9ZXG3	Shigella_phage	95.7	3.6e-33
WP_001067858.1|101990_102695_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000557454.1|103792_104653_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|104665_105208_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|105689_105881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|105904_106132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|106182_107319_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_014342212.1|107285_107435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067858.1|108761_109466_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 2
NZ_CP010149	Escherichia coli strain D6 plasmid A, complete sequence	199494	125708	176135	199494	bacteriocin,transposase,integrase	Escherichia_phage(35.29%)	52	152691:152750	181875:182695
WP_001312845.1|125708_126524_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864812.1|126573_126927_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016493.1|127104_127896_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000796228.1|127892_128582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|128625_128976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343102.1|129544_129805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194555.1|129801_130392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142424.1|130409_130757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000762580.1|130875_131223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283356.1|131240_133121_-	colicin	NA	NA	NA	NA	NA
WP_001132019.1|133399_134746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517689.1|135099_135702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001442119.1|135757_136252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031610367.1|136994_137411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001138064.1|137419_140386_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_050491481.1|140388_140838_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	2.5e-49
WP_073520228.1|140862_141567_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.4e-138
WP_000454193.1|141902_142253_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|142455_143469_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|143626_144100_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|144230_145019_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|145224_145572_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|145565_146405_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|146532_146736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|146891_148097_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|148107_148413_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|148639_149404_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|149896_150481_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|150480_151719_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|151715_152621_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
152691:152750	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATT	NA	NA	NA	NA
WP_001067858.1|152743_153448_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_024192851.1|153472_153685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|153992_154808_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|154868_155672_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480972.1|155671_156508_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_042005022.1|156561_156798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001493764.1|156829_157480_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|157585_158785_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|158816_159701_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001351729.1|159838_160231_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_001039464.1|162743_163130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030005799.1|163269_164238_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
WP_072196731.1|166578_166704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776034.1|168589_169021_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|169020_170292_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
WP_000064119.1|170373_171348_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	54.1	5.0e-87
WP_000368714.1|171347_172553_-	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|172968_173238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|173414_174281_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|174810_174915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000764642.1|175043_175301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015958.1|175358_176135_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
181875:182695	attR	AATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCATTTATGAATGTTCCTGTTATGGCTTATGTTCAAGAAAGCATTGCCCCTGAAATGATGGGCAAGGTGTTTTCCCTTTTGATGACCGCCATGACTCTTTCTATGCCGATAGGCTTACTTGTTGCAGGTCCGGTTGTTGAGGTTATAGGTGTTAATACATGGTTTTTCTGGTCTGGTGTTGCGTTGATAGTAAACGCTGTTCTCTGCCGCATTCTGACACGACGCTATGACAAAGTAACAATGAAACCGCAAGTGGACTGAAAAAAGGACCGGGTTGATGATAATTTGTAGTGGTGAGCTTCTGGGAGTACAAAACAAAGTGCTCAAAATTGTCGGGCTCATGGCGTTTAACGGTATTAATTTCGCTTATAATAATCTTTCTATAATAGCCTAAAGGAGAATATCTATGATACCTAATAGCGAAAATAAAAGAGTATGGTTTATTACCGGAGCAAGCAAGGGGCTTGGCTATGCTTTTACATGCGCCGCCTTGAAAGCCGGGGATAAAGTTGTTGCAGTTGCAAGGACTATCGATAATTTGGCGAAGCTAGAAGAAACATATCAAGAGAGCTTACTGCCATTAAACCTCGATGTTACAGATAGGGAGGCTGTTTTTTCTACGGTTGAAACAGCAGTTAAACATTTCGGTAGGCTTGATATTGTTGTTAATAATGCGGGTATCATGACTATGGGTATGATTGAAGAACTAAACGAATCCGATGCTCGGAAACTAATGGACACAAACTTTTTTGGAGCTCTTTGG	NA	NA	NA	NA
