The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010145	Escherichia coli strain D5 chromosome, complete genome	4817460	151897	220785	4817460	tail,lysis,terminase,head,capsid,plate,integrase,portal	Salmonella_phage(70.83%)	75	143718:143732	222192:222206
143718:143732	attL	GCACTGCGGGGCGTT	NA	NA	NA	NA
WP_000290937.1|151897_152950_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_073511453.1|153023_154793_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_073511454.1|154836_155775_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.7	4.0e-33
WP_000188448.1|155862_156084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|156116_156626_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956192.1|156633_156930_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	88.5	1.9e-21
WP_000996717.1|157047_157389_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244224.1|157456_157690_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.9e-32
WP_073511455.1|157689_157917_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	97.3	1.7e-35
WP_073511456.1|157913_158771_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.5	6.6e-160
WP_073511458.1|158767_161182_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.4	0.0e+00
WP_001154434.1|161334_161523_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|161533_161767_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_073511460.1|162115_163177_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_063082208.1|163214_164240_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	3.1e-172
WP_073511461.1|164239_166006_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_073511463.1|166148_166982_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	84.8	6.3e-123
WP_021523864.1|166998_168054_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.3	2.4e-180
WP_073511464.1|168057_168708_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_028985766.1|168803_169268_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	9.3e-76
WP_000868192.1|169267_169471_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000171568.1|169474_169690_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001069909.1|169670_170183_+	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000727856.1|170184_170562_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_073511467.1|170558_170987_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	78.7	2.2e-47
WP_001039944.1|171082_171514_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	4.4e-72
WP_073511469.1|171506_171953_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_073511470.1|172021_172600_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	85.4	6.8e-92
WP_064485169.1|172596_172956_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	3.6e-51
WP_064485170.1|172942_173851_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001518816.1|173843_174449_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.2e-109
WP_073511472.1|174445_176029_+|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	52.5	7.6e-85
WP_000994386.1|176028_176442_+|tail	tail assembly chaperone	tail	U5P0S4	Shigella_phage	74.3	1.5e-21
WP_021534461.1|176548_177721_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	1.3e-203
WP_064485171.1|177730_178246_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	3.7e-89
WP_053289807.1|178300_178603_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	1.8e-40
WP_000763311.1|178617_178737_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_073511474.1|178729_181807_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980394.1|181803_182289_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_064485173.1|182285_183386_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.3	4.5e-177
WP_000972391.1|183476_183695_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024867.1|183930_185616_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|185885_186263_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195240.1|186292_186550_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|186709_186997_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000684321.1|188540_189443_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|189530_190007_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|190358_191471_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996025.1|191565_192699_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.4	5.0e-30
WP_000105430.1|192708_193662_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061657.1|193658_194504_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|194563_195052_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149733.1|195092_196220_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.6	3.5e-28
WP_001295905.1|196394_197126_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|197417_198086_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|198085_198802_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|198808_199540_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|199557_200286_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270740.1|200503_201019_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|201144_201468_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001255144.1|201464_202295_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|202291_203305_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|203403_204834_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566372.1|204844_205846_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815350.1|205882_207601_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	4.0e-31
WP_000178677.1|207733_208702_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458817.1|208713_210366_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|210509_211409_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001297311.1|211903_212599_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599806.1|213024_214683_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001355621.1|214679_215636_-	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_000746460.1|215786_216902_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188180.1|216898_218845_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|218917_219142_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000092880.1|219546_220785_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.5	3.7e-127
222192:222206	attR	AACGCCCCGCAGTGC	NA	NA	NA	NA
>prophage 2
NZ_CP010145	Escherichia coli strain D5 chromosome, complete genome	4817460	1492059	1556980	4817460	tail,lysis,holin,terminase,head,capsid,transposase,plate,portal,tRNA	Escherichia_phage(44.74%)	61	NA	NA
WP_000675150.1|1492059_1493463_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137877.1|1493459_1494182_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_038999770.1|1494372_1494705_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1494851_1496213_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000468308.1|1496485_1496704_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001461865.1|1496785_1497949_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.6e-204
WP_000978897.1|1497948_1498428_-|tail	phage tail protein	tail	O64315	Escherichia_phage	100.0	5.1e-85
WP_015979590.1|1498442_1500890_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	98.5	0.0e+00
WP_000785970.1|1500882_1501002_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031307.1|1501034_1501310_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_001251408.1|1501366_1501885_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286743.1|1501897_1503088_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.1e-224
WP_040072566.1|1503478_1505065_+	hypothetical protein	NA	P79669	Escherichia_phage	99.8	6.4e-310
WP_001164113.1|1505458_1505986_-|tail	tail fiber assembly protein	tail	A0A0A7NRZ7	Enterobacteria_phage	95.4	2.3e-91
WP_073511527.1|1505989_1507999_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	97.8	0.0e+00
WP_001285325.1|1508009_1508540_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_040072569.1|1508532_1509441_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	1.3e-161
WP_000127163.1|1509445_1509793_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001093716.1|1509789_1510425_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.1	2.0e-113
WP_015979586.1|1510508_1511294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297845.1|1511365_1511818_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.3e-76
WP_073511528.1|1511810_1512278_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	7.4e-81
WP_001300730.1|1512240_1512414_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_015979583.1|1512385_1512811_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	95.0	1.4e-65
WP_050939240.1|1512798_1513224_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.0	2.8e-58
WP_001144101.1|1513238_1513736_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123124.1|1513735_1514017_-|holin	phage holin family protein	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|1514020_1514224_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|1514223_1514733_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_001298859.1|1515562_1517104_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1517118_1517865_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001248558.1|1518165_1519239_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	100.0	6.7e-202
WP_001085953.1|1519297_1520152_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	100.0	4.6e-137
WP_073511530.1|1520325_1522098_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_015979580.1|1522097_1523132_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	2.1e-200
WP_000675356.1|1523465_1524350_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_073511531.1|1524419_1525925_-	hypothetical protein	NA	Q858T2	Yersinia_virus	28.3	1.5e-05
WP_000807356.1|1529282_1530182_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.7e-12
WP_000178552.1|1530263_1531043_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000844219.1|1531142_1532183_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000823270.1|1533590_1533875_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182899.1|1533905_1534358_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000853882.1|1534367_1535630_-	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_001307281.1|1535658_1536513_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|1536820_1537873_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858484.1|1538129_1539407_+	nucleoside permease	NA	NA	NA	NA	NA
WP_032247697.1|1539403_1540408_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	28.7	2.4e-12
WP_032247696.1|1540404_1541370_+	sugar kinase	NA	NA	NA	NA	NA
WP_032247695.1|1541343_1542090_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032247694.1|1542141_1542960_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.9e-23
WP_000822274.1|1543024_1543825_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195564.1|1543821_1544610_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|1544832_1545105_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000153067.1|1547606_1547945_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_073511532.1|1548026_1549061_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000945454.1|1549076_1551557_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677393.1|1551572_1552247_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830456.1|1552326_1552869_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001324851.1|1553161_1553443_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|1553705_1554815_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001300883.1|1554946_1556980_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.3e-54
>prophage 3
NZ_CP010145	Escherichia coli strain D5 chromosome, complete genome	4817460	1565224	1574666	4817460		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001351788.1|1565224_1566361_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	8.5e-163
WP_073511536.1|1566357_1568358_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|1568482_1568944_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|1568984_1569455_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|1569501_1570221_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|1570217_1571903_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|1572124_1572856_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|1572915_1573023_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|1573003_1573735_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569357.1|1573739_1574666_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 4
NZ_CP010145	Escherichia coli strain D5 chromosome, complete genome	4817460	2034868	2141529	4817460	tail,lysis,terminase,protease,transposase,integrase,portal,tRNA	Enterobacteria_phage(31.67%)	104	2097176:2097191	2126172:2126187
WP_001298974.1|2034868_2035606_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2035737_2037072_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|2037280_2038162_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189206.1|2038264_2038852_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|2038906_2039290_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262723.1|2039594_2040284_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997411.1|2040331_2041369_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2041575_2041995_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|2042063_2042762_+|tRNA	tRNA-uridine aminocarboxypropyltransferase	tRNA	NA	NA	NA	NA
WP_000082949.1|2042793_2045454_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2045567_2046923_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001300818.1|2046968_2047292_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|2047288_2048587_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_001235102.1|2054457_2057031_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000040149.1|2057160_2057892_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079107.1|2057888_2058869_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2059003_2059741_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2060011_2060353_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2060456_2060504_+	pheA operon leader peptide PheL	NA	NA	NA	NA	NA
WP_000200116.1|2060602_2061763_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|2061805_2062927_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168044.1|2062937_2064008_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|2064217_2064583_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|2064732_2065251_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969032.1|2065240_2066467_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|2066482_2066965_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2067041_2067389_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2067430_2068198_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2068228_2068777_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2068795_2069044_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2069180_2070542_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001407013.1|2070708_2071500_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|2071520_2072807_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|2072861_2073455_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|2073577_2074456_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|2074541_2076203_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2076351_2076693_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|2076754_2077045_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600190.1|2077034_2077511_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2077642_2078125_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_012602456.1|2078930_2080145_+	type II restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_072095179.1|2080179_2081583_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_000355482.1|2082019_2082793_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072195243.1|2082862_2082991_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_073511541.1|2083045_2086825_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A2D1UII2	Escherichia_phage	80.2	0.0e+00
WP_073511542.1|2086889_2087489_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.0	2.9e-106
WP_073511543.1|2087557_2091037_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.1	0.0e+00
WP_001309913.1|2091097_2091745_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	2.5e-111
WP_073511544.1|2091642_2092386_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	1.9e-147
WP_001152385.1|2092391_2093090_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_073511545.1|2093099_2093429_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	98.2	5.1e-60
WP_073511546.1|2093428_2096494_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.6	0.0e+00
WP_001161009.1|2096465_2096795_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001440689.1|2096803_2097190_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	6.1e-65
2097176:2097191	attL	CTGTTTCAGAAACATC	NA	NA	NA	NA
WP_000211109.1|2097250_2097994_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	100.0	7.8e-133
WP_001079398.1|2098005_2098407_-|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000677106.1|2098403_2098982_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	100.0	4.2e-102
WP_001283144.1|2098993_2099269_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	8.6e-45
WP_064773609.1|2099261_2099585_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	1.5e-51
WP_001136590.1|2099671_2101699_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_000985945.1|2101643_2103152_-|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	99.8	7.8e-289
WP_001072975.1|2103151_2103364_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_073511547.1|2103360_2105463_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.0	0.0e+00
WP_000373425.1|2105462_2105957_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_001139681.1|2106632_2106785_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	4.7e-21
WP_029700804.1|2106772_2107240_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	97.4	6.1e-75
WP_001135250.1|2107236_2107734_-	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_000839596.1|2107733_2107949_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_073511548.1|2108016_2109069_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.7	6.1e-208
WP_000917724.1|2109219_2109423_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000868396.1|2109687_2110614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531322.1|2110600_2111149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029700797.1|2111161_2111503_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	89.4	1.6e-56
WP_001360050.1|2111520_2112510_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061404.1|2112517_2113315_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_000767113.1|2113334_2113724_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|2113720_2114047_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_000066917.1|2114043_2114697_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_072165319.1|2114696_2115191_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
WP_021527492.1|2115187_2116006_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_001504950.1|2116002_2116239_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	1.9e-37
WP_063084591.1|2116231_2117068_-	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	6.0e-150
WP_000521508.1|2117064_2117616_-	hypothetical protein	NA	A0A291AWW8	Escherichia_phage	100.0	4.5e-101
WP_000649477.1|2117659_2117860_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848749.1|2117950_2118625_+	LexA family transcriptional regulator	NA	U5P0T5	Shigella_phage	99.6	6.0e-132
WP_000008160.1|2119369_2119906_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	6.9e-99
WP_001242730.1|2119896_2120259_+	phage protein	NA	K7PH61	Enterobacteria_phage	97.5	6.8e-66
WP_001331173.1|2120255_2120471_+	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	65.1	1.2e-14
WP_001331174.1|2120530_2120737_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_063082126.1|2120697_2121864_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	66.5	5.7e-146
WP_063082127.1|2121876_2122506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032083255.1|2122507_2122849_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_032083256.1|2122841_2123765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113815.1|2124141_2125383_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
WP_001317263.1|2125521_2126616_-	hypothetical protein	NA	NA	NA	NA	NA
2126172:2126187	attR	CTGTTTCAGAAACATC	NA	NA	NA	NA
WP_000532680.1|2129050_2130349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085947771.1|2130366_2131529_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000871156.1|2131556_2131790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963924.1|2132257_2136109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000443183.1|2136154_2136901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925811.1|2136887_2137067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655916.1|2137334_2138216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001367084.1|2138329_2138569_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_085950812.1|2140316_2141529_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.8	2.4e-99
>prophage 5
NZ_CP010145	Escherichia coli strain D5 chromosome, complete genome	4817460	2216021	2223161	4817460		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|2216021_2218583_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141330.1|2218688_2219345_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_001297141.1|2219395_2220163_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|2220358_2221267_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|2221263_2222526_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|2222522_2223161_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 6
NZ_CP010145	Escherichia coli strain D5 chromosome, complete genome	4817460	4602272	4667929	4817460	lysis,tail,terminase,head,capsid,protease,transposase,integrase,portal,tRNA	Enterobacteria_phage(54.84%)	78	4612434:4612480	4659403:4659449
WP_021548567.1|4602272_4603658_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|4603693_4604215_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|4604322_4604535_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|4604536_4605403_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_001315309.1|4605883_4606426_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988375.1|4606645_4607338_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001306954.1|4607368_4609978_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691056.1|4609990_4610998_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|4611008_4611524_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|4611526_4612159_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
4612434:4612480	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_000051902.1|4612493_4613657_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	3.0e-200
WP_000488407.1|4613855_4614134_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763385.1|4614181_4614400_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_001443983.1|4614498_4614780_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|4614790_4614982_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|4614954_4615137_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|4615133_4615814_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100847.1|4615810_4616596_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|4616601_4616898_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|4616972_4617116_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|4617084_4617249_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000213971.1|4617493_4617673_-	antirestriction Ral family protein	NA	M1FQU1	Enterobacteria_phage	100.0	6.6e-30
WP_000281856.1|4617939_4618422_+	superinfection exclusion B family protein	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_170992679.1|4618422_4618800_-	antitermination protein	NA	J3JZZ6	Escherichia_phage	99.1	6.6e-56
WP_000191544.1|4619180_4619942_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	46.3	1.1e-09
WP_001274755.1|4619973_4620687_-	LexA family transcriptional regulator	NA	A4KWS8	Enterobacteria_phage	100.0	2.1e-127
WP_000437875.1|4620787_4620988_+	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_000251069.1|4621106_4621400_+	lambda phage CII family protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000185505.1|4621432_4622332_+	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	100.0	3.8e-174
WP_000788837.1|4622328_4623030_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	7.1e-128
WP_000145931.1|4623026_4623317_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000736903.1|4623390_4623831_+	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_000153280.1|4623827_4624355_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254223.1|4624351_4624528_+	NinE family protein	NA	K7PHE6	Enterobacteria_phage	98.3	1.4e-27
WP_000386643.1|4624530_4624872_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099522.1|4625078_4625441_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	5.6e-60
WP_000971068.1|4625437_4625578_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|4625663_4626047_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737266.1|4626236_4627334_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	76.5	2.2e-155
WP_000839596.1|4627922_4628138_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|4628137_4628635_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|4628851_4629034_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738423.1|4629124_4629418_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001415975.1|4629777_4629972_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.9	4.3e-27
WP_000453587.1|4630360_4630906_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027283.1|4630880_4632806_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|4632802_4633009_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001369921.1|4633005_4634607_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.9e-309
WP_000123273.1|4634587_4635907_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.6e-232
WP_001369910.1|4635916_4636249_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.1e-54
WP_000063218.1|4636304_4637330_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	1.4e-188
WP_000158868.1|4637371_4637767_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	5.7e-58
WP_000753019.1|4637778_4638132_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000975051.1|4638143_4638722_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	3.5e-80
WP_000683105.1|4638718_4639114_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001345558.1|4639121_4639862_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	2.0e-128
WP_000479154.1|4639877_4640300_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	9.7e-72
WP_000459458.1|4640281_4640716_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	1.5e-64
WP_000840258.1|4640708_4643270_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.6	0.0e+00
WP_000847379.1|4643266_4643596_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|4643595_4644294_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|4644299_4645043_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_071532093.1|4644979_4645612_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	1.4e-95
WP_000515725.1|4645672_4649086_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001233071.1|4649156_4649756_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	4.4e-110
WP_000279163.1|4649820_4652781_+|tail	phage tail protein	tail	A0A0K2FIZ6	Escherichia_phage	53.7	4.0e-55
WP_000885616.1|4652780_4653356_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_000086514.1|4653453_4654044_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000836768.1|4654360_4654594_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|4654662_4654776_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239874.1|4655141_4655810_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001226378.1|4656355_4657840_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|4658026_4658980_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177469.1|4659492_4660254_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
4659403:4659449	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224567.1|4660436_4661327_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_000662366.1|4661327_4664300_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001614159.1|4664286_4666524_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420925.1|4666792_4667929_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP010146	Escherichia coli strain D5 plasmid A, complete sequence	112874	0	36887	112874	terminase,integrase,transposase	Escherichia_phage(53.85%)	31	19684:19743	41359:42127
WP_073511583.1|628_1504_+	CTX-M family class A extended-spectrum beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	98.6	2.0e-151
WP_013362812.1|1538_2507_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|4828_5533_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050858703.1|6144_7032_+	hypothetical protein	NA	Q71TI8	Escherichia_phage	99.7	2.4e-157
WP_050858702.1|7047_7407_+	hypothetical protein	NA	A0A1B0V7L1	Salmonella_phage	100.0	2.8e-64
WP_000021766.1|7479_7986_+	hypothetical protein	NA	A0A1B0VAK0	Salmonella_phage	100.0	4.8e-94
WP_016231376.1|8250_11367_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.3	4.4e-28
WP_073511585.1|11488_12097_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016231378.1|12112_13669_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	2.9e-105
WP_001190712.1|13851_14073_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216045.1|14072_14453_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	100.0	1.9e-63
WP_000113019.1|14457_14637_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	2.7e-23
WP_016231380.1|14664_15708_+	DUF968 domain-containing protein	NA	A0A1B0VBU2	Salmonella_phage	98.8	2.0e-206
WP_050858701.1|15796_16249_+	Late promoter-activating protein	NA	Q71T63	Escherichia_phage	98.7	4.3e-78
WP_000124150.1|16887_18372_+|terminase	terminase	terminase	Q71T61	Escherichia_phage	100.0	1.5e-292
WP_000611656.1|18396_19248_-	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.6	6.1e-158
WP_000874156.1|19358_19568_-	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
19684:19743	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000542335.1|21874_22096_+	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	98.6	1.3e-35
WP_050858708.1|22103_23135_+|integrase	tyrosine-type recombinase/integrase	integrase	Q71TG5	Escherichia_phage	99.1	1.9e-193
WP_001224243.1|23185_23497_+	hypothetical protein	NA	Q5XLQ4	Enterobacteria_phage	94.2	1.3e-44
WP_050858709.1|23744_24305_+	Ref family protein	NA	Q71TG3	Escherichia_phage	96.2	1.6e-98
WP_001615576.1|24351_24906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050858710.1|25188_25833_+	hypothetical protein	NA	A0A1B0VAG4	Salmonella_phage	85.4	3.3e-95
WP_050858711.1|25886_26576_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000747846.1|27569_27818_-	hypothetical protein	NA	Q71TG0	Escherichia_phage	100.0	1.8e-41
WP_023352064.1|27814_28255_-	hypothetical protein	NA	Q71TR9	Escherichia_phage	99.3	3.8e-79
WP_001139206.1|30718_30970_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222771.1|30966_31254_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
WP_000896262.1|31543_31744_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_001038839.1|32113_35611_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.8	3.5e-98
WP_085959875.1|35658_36887_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
41359:42127	attR	GCCACTGGAGCACCTCAAAAACACCATCATACACTAAATCAGTAAGTTGGCAGCATCACCTATCAATGGCCTGGGCAATACTTTCCGTCGAAAATGATTGCAACATATTGCCGATATCCTCAAATCCAAGTGATTTGAGAGCCTCACCAATGGCGCTGCTAATACCAGATACCAGTCCCCCCATATCAAGAACATTAGCTAACGTATAAGCGGCTTTTTGCTGGAATGATGGATCTTGTCCTGATTTAAGCCCAAACGCTCGACGTTGCGCTTCTGTATCATTCCAACCGGTTACCGCATCATAAATACCTCCAGCCACTGTGCCGACTAGGGGAATTGCGCGTAACGCCCCTTTACCAACTGCCTTTAATCCAAGTTTACCTGCTGCCCGGGCAGCCAAATCTCCGCCTTCATGGGCGAGAGTCTTCTTGCCACCACCGCGTAGCATTCCTACAAGTTTCTTTGCCCCCAGAGCGCCAAAAGCGAGTGCTCCAGCTTTTTTCAGCATGCCACGCCCCATTAACAACGACGCGACGCCACCGGCCCCCTTCCCTAACAGGCTAAATAGTTTGGACAGCAAGCCGCCCTTCTTTTTCCCGGTGTTTTTGGCTATCTGATCAAGGGCACGGAGAATCTTGTCATTGCCCTCTTTAATTTCGCTGGTCTGCTCCTGAAGTTCCTGAACCGTCCGTTTTTGGGTGTTAACCTGAACGACATCGGCACTATTTTGCGATTTACGCCTAAAAAAACCTTTTCTACGGCTGTTATC	NA	NA	NA	NA
>prophage 2
NZ_CP010146	Escherichia coli strain D5 plasmid A, complete sequence	112874	42973	80656	112874	plate	Escherichia_phage(61.54%)	41	NA	NA
WP_000926346.1|42973_43855_-	hypothetical protein	NA	Q71TC9	Escherichia_phage	99.7	6.3e-174
WP_000523980.1|43869_44481_-	hypothetical protein	NA	Q71TN8	Escherichia_phage	99.5	2.9e-109
WP_000188920.1|44491_45058_-	hypothetical protein	NA	A0A077SK12	Escherichia_phage	99.5	6.6e-100
WP_001033469.1|45138_45678_-	DUF5384 family protein	NA	A0A077SL46	Escherichia_phage	100.0	1.8e-46
WP_000039791.1|45681_46194_-	hypothetical protein	NA	A0A077SK39	Escherichia_phage	100.0	4.5e-55
WP_000245703.1|46815_47037_+	host cell division inhibitor Icd-like protein	NA	Q38557	Escherichia_phage	97.3	3.6e-38
WP_032167064.1|47033_48068_+	phage antirepressor KilAC domain-containing protein	NA	A0A077SLI1	Escherichia_phage	98.8	1.7e-186
WP_001187871.1|48231_49032_+	phage antirepressor KilAC domain-containing protein	NA	Q1MVK4	Enterobacteria_phage	99.6	5.4e-148
WP_032167063.1|49061_49907_+	hypothetical protein	NA	Q1MVK3	Enterobacteria_phage	98.2	1.8e-149
WP_032167114.1|49957_50203_+	hypothetical protein	NA	A0A1B0VDM5	Salmonella_phage	45.0	7.7e-13
WP_001313475.1|50384_50540_+	type I toxin-antitoxin system toxin HokD	NA	A0A1I9LJU7	Stx_converting_phage	92.2	1.0e-15
WP_000944483.1|50894_51887_-	MazG-like family protein	NA	NA	NA	NA	NA
WP_000509939.1|52184_52694_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	100.0	1.3e-91
WP_000035301.1|52705_53287_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	97.4	7.3e-102
WP_024236438.1|53322_54138_-	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	98.5	2.4e-111
WP_050858685.1|54147_55737_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	99.4	1.4e-304
WP_000067710.1|55797_57504_-	hypothetical protein	NA	Q71TM1	Escherichia_phage	100.0	0.0e+00
WP_050858684.1|57770_58736_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	99.1	6.3e-167
WP_000817632.1|58732_59938_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_001076427.1|60337_61198_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_001281125.1|61516_61909_-	hypothetical protein	NA	Q1MVJ1	Enterobacteria_phage	100.0	1.2e-71
WP_000007769.1|62086_62509_-	hypothetical protein	NA	A0A1B0VCB0	Salmonella_phage	100.0	2.7e-58
WP_050858683.1|62548_63337_-	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	90.8	1.1e-108
WP_001177860.1|63799_64084_+	hypothetical protein	NA	Q71TA2	Escherichia_phage	100.0	3.5e-49
WP_050858682.1|64076_64982_+	recombination-associated protein RdgC	NA	A0A077SK17	Escherichia_phage	96.3	1.0e-158
WP_050858680.1|65188_68266_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A077SL51	Escherichia_phage	98.4	0.0e+00
WP_000467133.1|69826_70261_+	tellurite resistance TerB family protein	NA	Q1MVI3	Enterobacteria_phage	100.0	8.1e-74
WP_166512916.1|70260_70425_+	DUF3927 family protein	NA	Q1MVI2	Enterobacteria_phage	96.3	1.2e-17
WP_001276605.1|70897_72262_+	replicative DNA helicase	NA	O80281	Escherichia_phage	99.6	1.8e-252
WP_001189128.1|72261_72564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050858716.1|72560_73535_+	hypothetical protein	NA	A0A077SL52	Escherichia_phage	98.8	5.0e-188
WP_000535202.1|73581_74214_-|plate	baseplate protein	plate	Q71TK2	Escherichia_phage	100.0	6.9e-90
WP_050858715.1|74206_75223_-	hypothetical protein	NA	A0A077SLQ1	Escherichia_phage	99.4	1.3e-191
WP_000602717.1|75224_76010_-	hypothetical protein	NA	Q71T90	Escherichia_phage	99.6	4.6e-144
WP_000896801.1|75996_76725_-	hypothetical protein	NA	A0A077SK19	Escherichia_phage	100.0	9.3e-139
WP_001141908.1|76728_77946_-	hypothetical protein	NA	A0A077SL53	Escherichia_phage	100.0	1.1e-224
WP_000235786.1|77955_78333_-	hypothetical protein	NA	Q38620	Escherichia_phage	100.0	2.2e-67
WP_000840930.1|78479_78725_+	hypothetical protein	NA	A0A1B0VDU5	Salmonella_phage	100.0	1.5e-40
WP_050858714.1|78727_79306_+	VRR-NUC domain-containing protein	NA	Q71T85	Escherichia_phage	99.5	1.5e-107
WP_000095381.1|79372_79528_+	hypothetical protein	NA	Q71TJ4	Escherichia_phage	96.1	2.7e-19
WP_000484110.1|80029_80656_+	norphogenetic protein	NA	Q71T82	Escherichia_phage	100.0	6.1e-123
>prophage 3
NZ_CP010146	Escherichia coli strain D5 plasmid A, complete sequence	112874	86640	102353	112874	transposase	Escherichia_phage(42.86%)	14	NA	NA
WP_001067855.1|86640_87345_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|87462_87666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|87793_88633_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|88813_88978_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|90368_91073_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_015344976.1|91644_94596_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_046788546.1|94604_95006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|95090_95795_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|96719_97604_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|97820_99035_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|99062_99368_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|99479_100973_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|101003_101255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|101537_102353_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 4
NZ_CP010146	Escherichia coli strain D5 plasmid A, complete sequence	112874	106025	106778	112874	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_073511589.1|106025_106778_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
>prophage 5
NZ_CP010146	Escherichia coli strain D5 plasmid A, complete sequence	112874	109901	111546	112874	integrase	Virus_Rctr41k(50.0%)	2	109281:109294	112256:112269
109281:109294	attL	GGCACTGTTGCAAA	NA	NA	NA	NA
WP_000845048.1|109901_110915_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|111072_111546_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
112256:112269	attR	GGCACTGTTGCAAA	NA	NA	NA	NA
