The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	625010	721371	4821305	tail,transposase,holin,plate	Shigella_phage(28.57%)	81	NA	NA
WP_000246443.1|625010_626342_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|626344_626869_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|626865_628146_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|628170_629253_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393852.1|629216_631067_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611744.1|631070_631484_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073503183.1|631490_632966_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|633016_633241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037397.1|633275_633776_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|634470_634989_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_073503184.1|635198_637340_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.9	1.2e-24
WP_149026212.1|637415_641648_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
WP_001101839.1|641625_642018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001118036.1|643625_644396_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|644549_645023_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973083.1|645065_647510_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|647749_648328_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|648533_649301_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|649271_650012_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|650167_650446_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|650448_650709_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|650918_651668_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
WP_000006255.1|651843_652341_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_073503185.1|652564_654304_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|654248_655034_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|655104_656160_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|656211_656505_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263488.1|656507_656906_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|656915_657368_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001292994.1|658465_659923_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|660183_660642_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|660733_661978_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|662035_662437_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749867.1|662475_663531_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	1.6e-118
WP_001285288.1|663818_664922_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|664933_666187_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_073503187.1|668368_670204_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.5e-307
WP_149026213.1|670264_671593_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.1	1.1e-246
WP_000099202.1|672062_673601_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_000612626.1|673649_673997_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000839179.1|673993_674398_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_001752126.1|675130_675679_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.7	8.1e-95
WP_000424732.1|675678_676104_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_032281334.1|676090_677149_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.1	1.2e-200
WP_023568522.1|677139_677724_+	YmfQ family protein	NA	O22003	Shigella_phage	97.9	1.6e-112
WP_053889465.1|677727_678486_+	hypothetical protein	NA	U5P0I1	Shigella_phage	98.1	4.5e-51
WP_032361617.1|678485_679073_+|tail	tail fiber assembly protein	tail	K7PMC4	Enterobacterial_phage	56.1	5.3e-60
WP_073503532.1|679308_679977_+	NeuD/PglB/VioB family sugar acetyltransferase	NA	NA	NA	NA	NA
WP_032361616.1|679978_680404_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_053889466.1|683063_683594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073503189.1|683593_684061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001111348.1|684788_685199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|685177_686134_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_073503190.1|688338_689295_-	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000070700.1|689291_689981_-	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_001019920.1|690398_691013_+	YagU family protein	NA	NA	NA	NA	NA
WP_001303809.1|691260_691590_-	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001350485.1|691902_692613_-	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001310578.1|692581_694225_-	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001131096.1|694214_696740_-	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_000716398.1|696765_697434_-	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_000730972.1|697491_698079_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_001301257.1|698153_698696_-	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_001147279.1|699518_699746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866436.1|699780_699921_-	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000803998.1|699920_700184_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000662258.1|700547_700649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000020219.1|701763_706020_+	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_073503191.1|706159_707011_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|707600_708194_-	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_073503192.1|708205_708442_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001046307.1|708550_709876_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000339594.1|710101_710956_+	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001102108.1|711482_712202_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000023927.1|712212_713640_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_000370307.1|713632_714328_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001209100.1|714570_715239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001159094.1|715451_717122_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|717135_718608_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|718621_719209_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|719337_721371_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 2
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	1172121	1202275	4821305	head,portal,terminase,tail,lysis,capsid	Enterobacteria_phage(59.46%)	37	NA	NA
WP_073503223.1|1172121_1172577_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	65.6	8.6e-58
WP_000224914.1|1172576_1172747_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774473.1|1172739_1173030_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.1e-47
WP_073503224.1|1173026_1173389_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	94.8	6.2e-59
WP_000971055.1|1173385_1173526_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204780.1|1173611_1173995_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	84.2	4.0e-56
WP_000737280.1|1174184_1175282_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.1	6.7e-157
WP_000839596.1|1175854_1176070_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_021534987.1|1176069_1176567_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	3.5e-89
WP_021537017.1|1176563_1177031_+|lysis	lysis protein	lysis	Q9AZ06	Salmonella_phage	92.3	3.1e-71
WP_001139682.1|1177018_1177171_+	hypothetical protein	NA	Q716B2	Shigella_phage	100.0	2.1e-21
WP_001059339.1|1177373_1177898_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_001537735.1|1178200_1178611_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	77.8	2.7e-55
WP_032336848.1|1178669_1178903_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.1	1.5e-21
WP_000453587.1|1179291_1179837_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_073503225.1|1179811_1181737_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_053276504.1|1181733_1181940_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	1.3e-29
WP_001345555.1|1181936_1183538_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.4	1.3e-310
WP_073503226.1|1183518_1184838_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	4.0e-233
WP_001358225.1|1184847_1185180_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_073503227.1|1185235_1186261_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	2.2e-186
WP_000158882.1|1186302_1186698_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	3.1e-56
WP_000752960.1|1186709_1187063_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_001398561.1|1187074_1187653_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	97.9	8.6e-79
WP_000683128.1|1187649_1188045_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_001317730.1|1188052_1188793_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	5.2e-129
WP_073503228.1|1188808_1189231_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.0	3.8e-60
WP_073503229.1|1189212_1189647_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_073503230.1|1189639_1192201_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	91.7	0.0e+00
WP_000847379.1|1192197_1192527_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_073503231.1|1192526_1193225_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	2.1e-132
WP_073503232.1|1193230_1193974_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	1.5e-147
WP_133301132.1|1193910_1194519_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.0	4.4e-102
WP_073503234.1|1194579_1197993_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_001230523.1|1198063_1198663_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.8e-108
WP_073503535.1|1198727_1201691_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.6e-54
WP_073503235.1|1201690_1202275_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.7e-103
>prophage 3
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	1285054	1358317	4821305	integrase,head,tRNA,portal,terminase,tail,lysis,protease,plate,capsid	Salmonella_phage(66.67%)	85	1275984:1275998	1307329:1307343
1275984:1275998	attL	CCTGCTGGACGTGGT	NA	NA	NA	NA
WP_000290933.1|1285054_1286107_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.3	3.6e-107
WP_001321204.1|1286293_1286485_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_001047324.1|1286500_1287070_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001247707.1|1287195_1287417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1287449_1287959_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|1287966_1288167_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963472.1|1288130_1288472_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.3e-55
WP_001244230.1|1288539_1288773_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_000752619.1|1288772_1289000_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_000104146.1|1288996_1289851_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	90.1	2.9e-147
WP_001420002.1|1289856_1290678_+	hypothetical protein	NA	A0A0M4RCP6	Salmonella_phage	75.7	1.1e-122
WP_021537010.1|1290677_1293050_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	96.7	0.0e+00
WP_001154434.1|1293211_1293400_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1293410_1293644_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_073503240.1|1293886_1295050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047204265.1|1295051_1295588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920990.1|1295947_1297003_+	DUF4935 domain-containing protein	NA	NA	NA	NA	NA
WP_063082208.1|1297046_1298072_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.2	3.1e-172
WP_001098428.1|1298071_1299838_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_032175287.1|1299980_1300814_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.3	2.4e-122
WP_000742511.1|1300830_1301889_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_000059198.1|1301892_1302543_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	2.5e-111
WP_063085725.1|1302638_1303103_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.4e-76
WP_000868175.1|1303102_1303306_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171569.1|1303309_1303525_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	78.9	3.1e-26
WP_073503243.1|1303505_1304018_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	2.6e-87
WP_000727854.1|1304019_1304397_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001589059.1|1304393_1304822_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	1.9e-46
WP_149026215.1|1304917_1305349_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	1.9e-70
WP_073503246.1|1305341_1305788_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	5.6e-62
WP_044328442.1|1305856_1306435_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	2.1e-93
WP_073503247.1|1306431_1306791_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_000268301.1|1306777_1307686_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
1307329:1307343	attR	CCTGCTGGACGTGGT	NA	NA	NA	NA
WP_001086842.1|1307678_1308284_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	7.5e-110
WP_073503248.1|1308280_1309678_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	79.1	1.4e-151
WP_000500075.1|1309679_1310117_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.9	1.9e-46
WP_000639071.1|1310088_1310484_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001345660.1|1310492_1310900_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	42.3	3.6e-15
WP_073503249.1|1310927_1311494_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	4.9e-87
WP_000046124.1|1311636_1312809_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.3	4.6e-204
WP_001207660.1|1312818_1313334_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281013.1|1313388_1313691_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	7.0e-40
WP_000763311.1|1313705_1313825_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_073503250.1|1313817_1316895_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.8	0.0e+00
WP_000980404.1|1316891_1317377_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.9	2.2e-67
WP_001011786.1|1317373_1318474_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	1.1e-175
WP_000972391.1|1318564_1318783_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_073503251.1|1319018_1320704_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1320973_1321351_+	inner membrane protein YbjM	NA	NA	NA	NA	NA
WP_001195240.1|1321380_1321638_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_001201560.1|1321797_1322085_+	DUF1418 family protein	NA	NA	NA	NA	NA
WP_000189159.1|1322068_1322791_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_000684321.1|1322851_1323754_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1323841_1324318_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1324668_1325781_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1325875_1327009_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|1327018_1327972_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1327968_1328814_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1328873_1329362_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1329402_1330530_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_001295339.1|1330728_1331460_-	ABC transporter substrate-binding protein ArtJ	NA	NA	NA	NA	NA
WP_000464491.1|1331750_1332419_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1332418_1333135_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1333141_1333873_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1333890_1334619_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1334836_1335352_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1335477_1335801_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1335797_1336628_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1336624_1337638_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1337736_1339167_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566376.1|1339177_1340179_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_000815337.1|1340215_1341934_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	2.3e-31
WP_000178677.1|1342066_1343035_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_073503252.1|1343046_1344699_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1344842_1345742_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1346236_1346932_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|1347357_1349016_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001380339.1|1349012_1349969_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|1350119_1351235_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_073503253.1|1351231_1353178_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1353250_1353475_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1353797_1354118_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1354148_1356425_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1357109_1357328_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1357612_1358317_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	1829267	1865526	4821305	integrase,tRNA,terminase,transposase,lysis	Escherichia_phage(53.12%)	41	1828902:1828917	1865703:1865718
1828902:1828917	attL	GCTGGATAAGCTGCGC	NA	NA	NA	NA
WP_000628058.1|1829267_1830500_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_073503286.1|1830754_1831738_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1832215_1833589_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_073503287.1|1833717_1834653_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000040852.1|1834704_1835940_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1835941_1836157_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1836235_1836445_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1836437_1836632_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1836688_1837498_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001532611.1|1837490_1840091_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	3.9e-248
WP_000632297.1|1840192_1840468_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1840542_1840713_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1840712_1840934_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1841375_1841864_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1841860_1842016_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1842469_1842946_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1843069_1843366_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000899748.1|1843822_1844680_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1844686_1845433_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_073503288.1|1845455_1846217_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	6.1e-117
WP_001141106.1|1846232_1846610_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.8	1.6e-54
WP_073503289.1|1846900_1848583_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_000505828.1|1849110_1850160_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_021554378.1|1850734_1850890_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	89.6	1.3e-13
WP_001300563.1|1851083_1852196_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000940319.1|1852702_1853302_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	1.1e-105
WP_000247762.1|1853301_1853592_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	86.5	2.4e-45
WP_000640161.1|1853588_1854131_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_073503291.1|1855175_1855604_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_001348108.1|1855775_1856150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839565.1|1856401_1856617_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001135280.1|1856616_1857114_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.6	1.1e-90
WP_001228696.1|1857330_1857516_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1857712_1859170_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_016232661.1|1859307_1860099_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	3.7e-48
WP_001742940.1|1860091_1861024_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.5	9.3e-83
WP_187649179.1|1860959_1861211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073503294.1|1861214_1862309_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	3.8e-112
WP_073503295.1|1862289_1863591_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.3	5.2e-148
WP_000839179.1|1864777_1865182_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|1865178_1865526_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
1865703:1865718	attR	GCTGGATAAGCTGCGC	NA	NA	NA	NA
>prophage 5
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	1868970	1877523	4821305	tail	Enterobacteria_phage(42.86%)	8	NA	NA
WP_073503187.1|1868970_1870806_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.5e-307
WP_073503297.1|1873052_1873616_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	2.1e-90
WP_000086527.1|1873713_1874304_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1874620_1874854_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1874922_1875036_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001157925.1|1875375_1875549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300461.1|1875814_1876249_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_073503298.1|1876389_1877523_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.4e-117
>prophage 6
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	2656266	2665707	4821305		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001333512.1|2656266_2657403_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
WP_073503402.1|2657399_2659400_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001295429.1|2659524_2659986_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2660025_2660496_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2660542_2661262_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2661258_2662944_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_073503403.1|2663165_2663897_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	4.1e-110
WP_001216963.1|2663956_2664064_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2664044_2664776_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_073503404.1|2664780_2665707_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	8.2e-23
>prophage 7
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	2791853	2800463	4821305	transposase	Stx2-converting_phage(42.86%)	7	NA	NA
WP_001075164.1|2791853_2794139_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|2794372_2795503_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|2795502_2795757_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_149026219.1|2796536_2796749_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.4e-33
WP_000612626.1|2796938_2797286_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|2797334_2798873_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_000779105.1|2799386_2800463_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 8
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	3265986	3279169	4821305		Escherichia_phage(50.0%)	12	NA	NA
WP_001272928.1|3265986_3268548_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141322.1|3268653_3269310_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3269360_3270128_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847985.1|3270323_3271232_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590403.1|3271228_3272491_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_001278994.1|3272487_3273126_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136934.1|3273130_3273907_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104441.1|3273995_3275360_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3275453_3276446_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3276508_3277648_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3277787_3278414_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3278407_3279169_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 9
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	4639554	4678926	4821305	transposase	Escherichia_phage(33.33%)	47	NA	NA
WP_063609966.1|4639554_4640511_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	45.9	3.4e-72
WP_001255015.1|4640872_4641178_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058100717.1|4641205_4642420_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_015344975.1|4643544_4645038_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|4645248_4645473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073503516.1|4645545_4646250_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
WP_001282381.1|4647498_4647948_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_000059893.1|4648010_4648415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038976852.1|4648782_4649421_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.4	8.2e-06
WP_000864791.1|4649706_4650327_+	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	31.5	1.1e-12
WP_000051064.1|4650378_4650609_+	partitioning protein	NA	NA	NA	NA	NA
WP_015060510.1|4650624_4650918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249520.1|4650919_4651888_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.0e-185
WP_031942371.1|4651947_4652370_-	DNA distortion polypeptide 3	NA	NA	NA	NA	NA
WP_001074386.1|4652437_4652884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001050931.1|4652923_4653760_-	replication initiation protein	NA	NA	NA	NA	NA
WP_000121743.1|4655015_4655267_+	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_000220560.1|4655256_4655538_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	62.4	3.8e-24
WP_001181903.1|4655683_4656007_+	hypothetical protein	NA	A0A0K1LL53	Rhodobacter_phage	46.1	9.2e-14
WP_000356546.1|4656051_4656297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001180116.1|4656286_4656502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000866648.1|4656594_4656924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000003880.1|4657210_4657360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000160399.1|4657372_4657645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038976855.1|4657971_4658517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000538023.1|4658519_4659677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000872475.1|4660037_4660529_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000953539.1|4660753_4661398_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000921916.1|4661381_4661672_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_000108725.1|4661695_4664455_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000737859.1|4664456_4665194_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_001228869.1|4665203_4665464_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_000235774.1|4665475_4666531_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000394570.1|4666720_4667443_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_000776689.1|4667448_4668378_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_073503517.1|4668374_4669589_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_000217791.1|4669606_4670644_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_000053826.1|4670648_4672484_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_000733627.1|4672480_4672876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073503548.1|4673001_4673211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018321.1|4673453_4674269_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	98.2	4.8e-160
WP_073503518.1|4674345_4675221_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_073503519.1|4675312_4675642_+	ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	31.9	4.2e-06
WP_073503520.1|4675688_4676393_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_077898834.1|4676338_4676998_-	SprT-like domain-containing protein	NA	NA	NA	NA	NA
WP_012537714.1|4677281_4677938_-	quinolone resistance pentapeptide repeat protein QnrS2	NA	NA	NA	NA	NA
WP_001067858.1|4678221_4678926_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 10
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	4688448	4760690	4821305	integrase,transposase	Enterobacteria_phage(23.33%)	56	4675624:4675683	4718335:4719156
4675624:4675683	attL	GGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGC	NA	NA	NA	NA
WP_063073394.1|4688448_4689477_-|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	42.4	2.2e-61
WP_048659773.1|4689874_4690912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105278499.1|4692887_4693145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077783444.1|4693181_4694150_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	8.5e-172
WP_000843497.1|4694493_4694691_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_001398208.1|4694731_4697209_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000758229.1|4697306_4697747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020219104.1|4697833_4700980_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	NA	NA	NA	NA
WP_001381488.1|4700990_4702283_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_053885803.1|4702396_4702750_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_000475512.1|4702777_4704163_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697969.1|4704352_4705033_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_000555737.1|4705025_4706501_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|4706751_4707183_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_025670887.1|4707326_4707635_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.6	8.8e-14
WP_000612791.1|4708430_4709294_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001354008.1|4709331_4709577_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|4710045_4710837_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_109023896.1|4710839_4711115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|4712016_4712349_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_001206316.1|4712518_4713310_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|4713402_4714662_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|4714923_4715715_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|4715720_4716011_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|4716122_4716620_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_073503516.1|4717024_4717729_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	7.6e-138
WP_073503520.1|4718399_4719104_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_073503523.1|4719457_4719640_-	hypothetical protein	NA	NA	NA	NA	NA
4718335:4719156	attR	GGGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTGACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCATCAGTTACCGTGAGCTGCAGGAGATGCTGGCTGAACGCGGAGTGAATGTCGATCACTCCACGATTTACCGCTGGGTTCAGCGTTATGCGCCTGAAATGGAAAAACGGCTGCGCTGGTACTGGCGTAACCCTTCCGATCTTTGCCCGTGGCACATGGATGAAACCTACGGGAAGGTCAATGGCCGCTGGGCGTATCTGTACCGGGCCGTCGACAGCCGGGGCCGCACTGTCGATTTTTATCTCTCCTCCCGTCGTAACAGCAAAGCTGCATACCGGTTTCTGGGTAAAATCCTCAACAACGTGAAGAAGTGGCAGATCCCACGATTCATCAACACGGATAAAGCGCCCGCCTATGGTCGCGCGCTTGCTCTGCTCAAACGCGAAGGCCGGTGCCCGTCTGACGTTGAACACCGACAGATTAAGTACCGGAACAACGTGATTGAATGCGATCATGGCAAACTGAAACGGATAATCGGCGCCACGCTGGGATTTAAATCCATGAAGACGGCTTACGCCACCATCAAAGGTATTGAGGTGATGCGTGCACTACGCAAAGGCCAGGCCTCAGCATTTTATTATGGTGATCCCCTGGGCGAAATGCGCCTGGTAAGCAGAGTTTTTGAAATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCC	NA	NA	NA	NA
WP_031942297.1|4719636_4720605_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	1.5e-184
WP_073503524.1|4720791_4722216_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_049100257.1|4722212_4725152_-	AAA family ATPase	NA	U5J9B0	Bacillus_phage	25.5	7.1e-12
WP_000861580.1|4725229_4725421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039463.1|4725429_4725816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039022248.1|4727336_4727846_-	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	98.8	1.1e-90
WP_029396071.1|4727857_4728439_-	hypothetical protein	NA	Q1MVJ8	Enterobacteria_phage	100.0	5.9e-104
WP_039022247.1|4728474_4729290_-	hypothetical protein	NA	Q1MVJ7	Enterobacteria_phage	96.3	3.9e-109
WP_039022246.1|4729299_4730889_-	hypothetical protein	NA	A0A077SLN8	Escherichia_phage	98.7	3.4e-303
WP_039022245.1|4730949_4732656_-	hypothetical protein	NA	Q1MVJ5	Enterobacteria_phage	99.6	0.0e+00
WP_023338075.1|4732920_4733886_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	98.8	6.3e-167
WP_039022244.1|4733882_4735088_-	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	99.8	9.7e-226
WP_001076427.1|4735487_4736348_-	replication protein RepA	NA	Q71TL8	Escherichia_phage	100.0	4.7e-158
WP_073503525.1|4737142_4738309_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_149026220.1|4738318_4739439_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_031942368.1|4740316_4741285_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	3.2e-179
WP_000428546.1|4743286_4743880_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|4743992_4745198_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|4745279_4745903_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001348255.1|4746254_4747223_+|transposase	IS5-like element IS903 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
WP_032494872.1|4748413_4749382_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.5e-179
WP_032494871.1|4749407_4752011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032494870.1|4752013_4754188_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_149026220.1|4754435_4755556_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.8	1.7e-51
WP_000428546.1|4756753_4757347_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|4757459_4758665_-	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000088605.1|4758746_4759370_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001348255.1|4759721_4760690_+|transposase	IS5-like element IS903 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	2.7e-178
>prophage 11
NZ_CP010143	Escherichia coli strain D4 chromosome, complete genome	4821305	4773362	4780786	4821305	tail,transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_000839179.1|4773362_4773767_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4773763_4774111_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099202.1|4774159_4775698_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	99.4	1.3e-294
WP_149026213.1|4776167_4777496_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	99.1	1.1e-246
WP_073503187.1|4777556_4779392_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.5	1.5e-307
WP_085949154.1|4779639_4780786_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
>prophage 1
NZ_CP010144	Escherichia coli strain D4 plasmid A, complete sequence	114159	2355	35229	114159	terminase,portal,tail	Salmonella_phage(100.0%)	35	NA	NA
WP_072652154.1|2355_7083_-	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.0	0.0e+00
WP_001293195.1|7100_7694_-|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	90.9	2.0e-99
WP_001405045.1|7681_8479_-	C40 family peptidase	NA	J9Q7R4	Salmonella_phage	94.0	1.3e-154
WP_000511445.1|8471_9170_-|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	96.6	1.5e-133
WP_000442113.1|9252_9588_-|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	86.4	3.0e-52
WP_073503551.1|9630_14208_-	tape measure protein	NA	J9Q712	Salmonella_phage	82.8	0.0e+00
WP_000952686.1|14215_14440_-	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_000163860.1|14565_14883_-	hypothetical protein	NA	J9Q7R3	Salmonella_phage	95.2	3.3e-48
WP_000072375.1|14944_15691_-	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	83.0	6.2e-106
WP_000469440.1|15765_16149_-	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_000523628.1|16150_16624_-	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_001027663.1|16614_16959_-	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000057117.1|17038_17872_-	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.0e-141
WP_000801186.1|17871_18306_-	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	81.9	1.9e-59
WP_021520523.1|18350_19271_-	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	78.6	5.3e-123
WP_001130339.1|19344_20220_-	hypothetical protein	NA	J9Q710	Salmonella_phage	93.8	4.2e-154
WP_073503552.1|20245_21133_-	hypothetical protein	NA	J9Q7F4	Salmonella_phage	88.9	2.3e-131
WP_073503553.1|21154_22729_-|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	92.9	2.4e-285
WP_001007299.1|22755_24012_-|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.4	7.5e-245
WP_000215413.1|24011_24644_-	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_000176292.1|24840_25107_-	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000129633.1|25116_26007_-	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.6	2.6e-167
WP_001717191.1|26003_26669_-	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	2.8e-110
WP_000161986.1|26665_27334_-	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.6	5.6e-106
WP_000382660.1|27333_28014_-	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_039052494.1|28096_29656_+	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	92.3	8.3e-278
WP_021520518.1|29658_29937_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	61.5	6.4e-24
WP_024189780.1|30111_30711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021520104.1|30707_31229_+	hypothetical protein	NA	J9Q6L0	Salmonella_phage	68.2	7.3e-53
WP_021520516.1|31526_32177_+	hypothetical protein	NA	J9Q754	Salmonella_phage	84.7	1.7e-99
WP_000470243.1|32224_32455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001009193.1|33070_33553_-	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	7.9e-62
WP_021512333.1|33903_34278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073503554.1|34395_34791_-	hypothetical protein	NA	J9Q7I1	Salmonella_phage	53.8	1.2e-31
WP_000749406.1|34917_35229_-	hypothetical protein	NA	J9Q7T7	Salmonella_phage	64.1	3.3e-29
>prophage 2
NZ_CP010144	Escherichia coli strain D4 plasmid A, complete sequence	114159	42808	95627	114159	integrase	Salmonella_phage(82.98%)	51	54214:54237	106702:106725
WP_001755496.1|42808_44365_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.9	1.9e-104
WP_001293038.1|44361_45609_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_000149672.1|45730_48847_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.2	2.2e-27
WP_001090450.1|48905_49382_-	hypothetical protein	NA	J9Q747	Salmonella_phage	89.2	6.0e-78
WP_000467663.1|49485_50100_-	hypothetical protein	NA	A0A0E3GMH9	Enterobacteria_phage	82.4	2.7e-99
WP_000335122.1|50438_51008_-	hypothetical protein	NA	J9Q7H6	Salmonella_phage	61.4	1.4e-52
WP_000893471.1|51147_51306_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000900262.1|51305_51731_-	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	80.1	4.4e-56
WP_001104328.1|51824_52013_-	hypothetical protein	NA	J9Q800	Salmonella_phage	51.6	9.4e-11
WP_001348724.1|52022_52517_-	hypothetical protein	NA	J9Q6J9	Salmonella_phage	55.4	5.2e-24
WP_000208893.1|52665_53256_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	82.2	5.8e-91
WP_000121544.1|53842_54073_-	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
54214:54237	attL	TTATTTATATATACAGAAGCAGGC	NA	NA	NA	NA
WP_073503556.1|54259_54853_-	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	85.8	2.9e-98
WP_000099880.1|55036_55846_-	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
WP_016607532.1|56004_56562_-	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_001718079.1|56571_56991_-	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_000386469.1|57052_57697_-	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_073503557.1|57696_58173_-	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.9	2.9e-80
WP_000289389.1|58169_58571_-	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	87.2	5.1e-62
WP_073503558.1|58584_59688_-	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	88.0	1.5e-193
WP_073503559.1|59859_60729_-	phosphoribosyl-ATP pyrophosphohydrolase	NA	J9Q742	Salmonella_phage	81.0	9.1e-133
WP_000122502.1|60806_61949_-	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_073503560.1|62055_64371_-	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.3	0.0e+00
WP_000037962.1|64444_65014_-	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	86.8	1.1e-91
WP_053902540.1|65023_65767_-	hypothetical protein	NA	J9Q6J5	Salmonella_phage	47.6	9.4e-54
WP_000670359.1|65756_67673_-	AAA family ATPase	NA	J9Q741	Salmonella_phage	72.9	8.4e-248
WP_000174803.1|67902_68988_-	metallophosphoesterase	NA	J9Q7S9	Salmonella_phage	87.5	8.0e-187
WP_000364573.1|69242_69887_-	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_162739249.1|70088_71303_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	1.1e-75
WP_073503561.1|71882_72095_-	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_000644408.1|72094_72430_-	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	6.6e-39
WP_073503562.1|72645_72921_-	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	4.4e-33
WP_000125192.1|72976_73402_-	hypothetical protein	NA	J9Q7G9	Salmonella_phage	75.4	5.0e-60
WP_073503563.1|73481_75821_-	recombinase RecA	NA	J9Q736	Salmonella_phage	85.1	1.8e-29
WP_000920225.1|75823_76090_-	hypothetical protein	NA	J9Q7G8	Salmonella_phage	78.4	6.8e-31
WP_001717299.1|76089_77034_-	5'-3' exonuclease SAM fold family protein	NA	J9Q7S6	Salmonella_phage	91.7	2.5e-168
WP_025670478.1|77094_78123_-	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001090697.1|78240_78672_-	hypothetical protein	NA	J9Q6I8	Salmonella_phage	83.9	9.9e-64
WP_001240351.1|79211_79775_+	hypothetical protein	NA	J9Q7G7	Salmonella_phage	67.7	1.3e-66
WP_000066497.1|80104_80320_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	77.1	2.9e-24
WP_073503564.1|80623_84130_-	DNA polymerase III subunit alpha	NA	J9Q7Z2	Salmonella_phage	88.4	0.0e+00
WP_073503565.1|84310_85546_-	AAA family ATPase	NA	J9Q733	Salmonella_phage	81.0	2.0e-197
WP_073503566.1|85641_87750_-	cobalamin biosynthesis protein CobT	NA	J9Q7G6	Salmonella_phage	67.1	4.8e-228
WP_024269779.1|87848_88061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001282577.1|88312_88699_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000797845.1|88693_89797_-|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_000156433.1|90007_90253_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	44.9	4.5e-13
WP_025670480.1|90249_90600_-	hypothetical protein	NA	Q716B1	Shigella_phage	51.7	4.6e-27
WP_000067985.1|92253_92544_-	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
WP_073503567.1|92901_94224_-	DNA ligase	NA	J9Q7G5	Salmonella_phage	96.6	1.9e-251
WP_032187677.1|94814_95627_-	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	85.6	5.5e-124
106702:106725	attR	TTATTTATATATACAGAAGCAGGC	NA	NA	NA	NA
>prophage 3
NZ_CP010144	Escherichia coli strain D4 plasmid A, complete sequence	114159	102422	112108	114159		Salmonella_phage(72.73%)	14	NA	NA
WP_001603498.1|102422_102644_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	94.5	8.1e-30
WP_053291281.1|102643_103021_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	92.0	9.3e-58
WP_032187668.1|103154_104270_-	DNA primase	NA	J9Q720	Salmonella_phage	94.9	1.5e-209
WP_073503572.1|104426_105767_-	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	98.7	5.5e-246
WP_073503573.1|105827_106553_-	hypothetical protein	NA	J9Q7R8	Salmonella_phage	96.3	3.0e-137
WP_000342417.1|106835_107603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160378290.1|107655_108009_-	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_000161228.1|108014_108683_-	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_001351987.1|109001_109271_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_000072677.1|109278_109800_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000901559.1|109968_110220_-	hypothetical protein	NA	J9Q7R6	Salmonella_phage	75.6	2.0e-24
WP_032084069.1|110221_110914_-	membrane protein	NA	J9Q7Y7	Salmonella_phage	94.3	1.0e-123
WP_032084070.1|110927_111251_-	hypothetical protein	NA	J9Q6E7	Salmonella_phage	97.2	8.0e-50
WP_072647505.1|111325_112108_-	receptor-recognizing protein	NA	C4MYP9	Escherichia_phage	85.0	4.9e-53
