The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	260078	327758	4971154	transposase,protease,tRNA	Vibrio_phage(18.75%)	56	NA	NA
WP_001162171.1|260078_261431_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232255.1|261613_262000_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106226.1|262044_262509_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|262666_264805_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
WP_001301172.1|265198_266854_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_072301410.1|266903_268325_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181312.1|268443_269391_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|269575_269629_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|269769_272466_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|272671_273058_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|273130_273592_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|273604_274540_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|274543_274678_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|274958_275354_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500689.1|275484_276198_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|276268_276862_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001326836.1|277006_277459_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_064774521.1|277677_279177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354155.1|279232_280237_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|280398_280815_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059412.1|280860_281364_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079655.1|281556_282753_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416382.1|282808_285664_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|285663_286107_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|286460_287972_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|288238_289339_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|289338_290421_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016245206.1|290539_292042_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	6.7e-83
WP_001309159.1|292119_293118_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128335.1|293184_294504_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|294565_295330_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_023568197.1|295353_296385_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|296601_297165_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|297168_298188_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000483767.1|302745_304092_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|304700_305918_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|305929_307048_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|307090_307216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|307268_307526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|307839_309006_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|308941_309355_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|309417_311415_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000336726.1|311568_312387_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|312422_312725_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|313658_313916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|314472_315240_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|315240_316197_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|316193_317192_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|317188_318091_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|318135_320460_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|320546_321500_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|321496_322018_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|323767_324025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937727.1|324187_324397_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	5.9e-06
WP_000823243.1|324775_326134_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998067.1|326372_327758_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	5.3e-260
>prophage 2
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	340560	345698	4971154	transposase	Stx2-converting_phage(33.33%)	8	NA	NA
WP_000080200.1|340560_342174_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_000624722.1|342204_342555_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|342551_342977_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_109554637.1|343038_343134_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234656.1|343288_344107_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	1.6e-46
WP_001350782.1|344448_344922_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_001186775.1|344937_345414_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|345476_345698_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
>prophage 3
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	439928	517745	4971154	capsid,terminase,lysis,tail,portal,head,tRNA,integrase	Enterobacteria_phage(44.26%)	85	432552:432567	496708:496723
432552:432567	attL	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_001218286.1|439928_441152_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.0	9.5e-237
WP_078071578.1|441336_442578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024193627.1|443054_443351_-	hypothetical protein	NA	U5P0J0	Shigella_phage	72.2	1.1e-24
WP_000335009.1|443398_444277_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	93.1	8.2e-166
WP_073545245.1|444267_444804_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	1.4e-99
WP_001404195.1|444931_445756_-	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.3	1.0e-149
WP_001398518.1|445821_446184_-	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	3.3e-60
WP_000859460.1|446852_447527_-	LexA family transcriptional regulator	NA	Q8SBF6	Shigella_phage	99.1	1.7e-131
WP_000649477.1|447617_447818_+	transcriptional regulator	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|447861_448413_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_001087352.1|448409_449246_+	hypothetical protein	NA	Q8SBF3	Shigella_phage	98.9	5.1e-149
WP_015364394.1|449250_449475_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	91.9	1.2e-33
WP_000061519.1|449471_450290_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_000055042.1|450292_450781_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	94.4	6.3e-83
WP_046660195.1|450780_451434_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	7.3e-127
WP_000210170.1|451430_451757_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_016240453.1|451753_452143_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	2.7e-68
WP_073545246.1|452162_452972_+	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	2.4e-151
WP_073545247.1|452979_453969_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.3e-195
WP_085949407.1|453983_454352_+	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	87.5	9.4e-55
WP_001208502.1|454387_454837_-	hypothetical protein	NA	A5LH78	Enterobacteria_phage	43.8	8.0e-24
WP_001446998.1|454858_455800_-	hypothetical protein	NA	A5LH79	Enterobacteria_phage	44.2	5.0e-68
WP_000917724.1|456068_456272_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799656.1|456422_457475_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_000839596.1|457542_457758_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_016063397.1|457762_458077_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	100.0	1.7e-52
WP_032151852.1|458132_458666_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	98.9	1.9e-101
WP_001300226.1|458662_459130_+|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	100.0	2.9e-77
WP_001139678.1|459117_459270_+	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000079508.1|459621_460032_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001309326.1|460089_460323_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	2.5e-21
WP_000453576.1|460711_461257_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001027308.1|461231_463157_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|463153_463360_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001307653.1|463356_464958_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.8e-310
WP_073545248.1|464938_466258_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.4e-233
WP_001299443.1|466267_466600_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_073545249.1|466655_467681_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.5	1.3e-186
WP_000158899.1|467722_468118_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	92.4	2.0e-55
WP_000753019.1|468129_468483_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_023147608.1|468494_469073_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	7.8e-80
WP_000683145.1|469069_469465_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_073545342.1|469472_470213_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	1.1e-126
WP_000479153.1|470228_470651_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|470632_471067_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_073545250.1|471059_473639_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	94.4	0.0e+00
WP_072936127.1|473635_473965_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	97.2	3.1e-57
WP_001152619.1|473964_474663_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	7.3e-133
WP_000194780.1|474668_475412_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|475348_475981_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_073545251.1|476041_479455_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_073545252.1|479525_480125_+	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	97.5	1.4e-108
WP_073545343.1|480189_483735_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	96.8	0.0e+00
WP_001678535.1|484172_485543_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_069914208.1|485520_486072_-	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_032174297.1|486294_486543_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	98.8	5.4e-38
WP_000202564.1|486761_488348_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
WP_001295748.1|488740_489346_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490275.1|489472_489634_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	64.2	1.8e-10
WP_001299799.1|489755_490829_+	patatin family protein	NA	NA	NA	NA	NA
WP_000563058.1|490825_491608_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_001088379.1|491922_492786_-	YjjW family glycine radical enzyme activase	NA	NA	NA	NA	NA
WP_001143253.1|492757_494308_-	YjjI family glycine radical enzyme	NA	NA	NA	NA	NA
WP_001295412.1|494565_495345_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_000477811.1|495471_496794_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
496708:496723	attR	GCGGCGAAAGCGGTGA	NA	NA	NA	NA
WP_001774264.1|496845_498069_+	phosphopentomutase	NA	NA	NA	NA	NA
WP_000224877.1|498148_498868_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_000105889.1|499323_500340_-	lipoate--protein ligase LplA	NA	NA	NA	NA	NA
WP_000124615.1|500367_501012_-	YtjB family periplasmic protein	NA	NA	NA	NA	NA
WP_001132956.1|501117_502086_+	phosphoserine phosphatase	NA	NA	NA	NA	NA
WP_001029698.1|502134_503517_+	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_000093810.1|503537_504770_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|505076_506744_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|506954_508892_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
WP_000068679.1|508981_509308_+	trp operon repressor	NA	NA	NA	NA	NA
WP_001346116.1|509350_509863_-	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_000942344.1|509914_510562_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase GpmB	NA	NA	NA	NA	NA
WP_000371666.1|510558_511428_-	MDR efflux pump AcrAB transcriptional activator RobA	NA	NA	NA	NA	NA
WP_000875487.1|511638_512112_+	protein CreA	NA	NA	NA	NA	NA
WP_001188666.1|512124_512814_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_001219614.1|512813_514238_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
WP_000920307.1|514295_515648_+	cell envelope integrity protein CreD	NA	NA	NA	NA	NA
WP_001194358.1|515706_516423_-	two-component system response regulator ArcA	NA	NA	NA	NA	NA
WP_001303782.1|516518_516659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001223151.1|517058_517745_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	734109	849475	4971154	capsid,terminase,holin,transposase,plate,protease,tail,portal,tRNA,head,integrase	Shigella_phage(53.23%)	116	786197:786212	854287:854302
WP_001260708.1|734109_735828_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094031.1|735938_736646_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|736642_737047_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|737164_737980_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|738019_738673_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|738665_739697_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140186.1|739884_740457_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997010.1|746214_747018_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_000648601.1|747014_747929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|748169_748970_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211685.1|749047_749818_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|749865_751224_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052721.1|751295_752051_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|752084_752807_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|752803_753271_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001300756.1|753335_754067_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.1	1.3e-39
WP_001086142.1|754603_755389_+	aminopeptidase	NA	NA	NA	NA	NA
WP_069354207.1|755525_756005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908057.1|756014_756929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001284199.1|756972_757455_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087742.1|757478_758831_-	membrane protein	NA	NA	NA	NA	NA
WP_122791621.1|758841_762276_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240524.1|762384_763797_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088859.1|763801_764545_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_073545256.1|764541_767307_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	1.5e-80
WP_000343289.1|767315_768077_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246445.1|768081_769413_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|769415_769940_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001113713.1|769936_771217_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348793.1|771241_772324_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000393844.1|772287_774138_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000611741.1|774141_774555_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056978.1|774561_776037_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000123970.1|776087_776312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000037395.1|776346_776847_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142958.1|777544_778063_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_073545257.1|780491_784745_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	44.2	3.2e-21
WP_000978828.1|784756_785206_+	hypothetical protein	NA	NA	NA	NA	NA
786197:786212	attL	CTGATGAACTTATTGA	NA	NA	NA	NA
WP_001118055.1|786644_787415_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532698.1|787568_788042_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973093.1|788084_790529_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|790768_791347_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|791552_792320_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|792290_793031_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000009291.1|793322_794081_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	2.6e-19
WP_000006256.1|794256_794754_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_069354111.1|795071_796811_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207589.1|796755_797541_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226155.1|797611_798667_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_001059874.1|798663_799116_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|799422_799689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354110.1|800045_801503_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291992.1|801763_802222_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189539.1|802313_803558_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174677.1|803615_804017_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749881.1|804055_805111_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|805398_806502_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893260.1|806513_807767_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
WP_000051893.1|807971_809135_-|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	5.3e-229
WP_000433939.1|809011_809362_-	helix-turn-helix domain-containing protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_001519505.1|809361_809658_-	hypothetical protein	NA	U5P0J0	Shigella_phage	97.0	6.8e-48
WP_001242749.1|809657_810020_-	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_073545258.1|810010_810547_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.9	1.4e-99
WP_000917896.1|811223_811520_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000450735.1|811705_812332_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	5.5e-47
WP_000205494.1|812429_812630_+	cell division protein	NA	NA	NA	NA	NA
WP_001434539.1|812667_813219_+	hypothetical protein	NA	S5FXP0	Shigella_phage	98.9	7.6e-101
WP_001250269.1|813394_813574_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104954.1|813563_814505_+	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_072176118.1|814501_814996_+	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	4.3e-87
WP_015364417.1|814995_815649_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_021549921.1|815645_815972_+	LexA repressor	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_000767095.1|815968_816358_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	99.2	1.6e-68
WP_001061403.1|816377_817175_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	2.0e-150
WP_001360050.1|817182_818172_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_021519680.1|818185_818938_+	antitermination protein	NA	Q8SBE4	Shigella_phage	98.4	5.8e-136
WP_000484663.1|819152_819692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310393.1|819835_820069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449601.1|820347_820641_+	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001120501.1|820777_821113_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_016236818.1|821116_821593_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	94.3	1.5e-84
WP_032193237.1|821576_821969_+	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	82.9	1.3e-49
WP_021519683.1|822306_822813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021519684.1|822870_823221_+	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	2.3e-63
WP_000929173.1|823346_823841_+|terminase	phage terminase small subunit P27 family	terminase	Q8SBI1	Shigella_phage	100.0	1.3e-88
WP_123010488.1|824074_825571_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	99.8	2.0e-300
WP_000605606.1|825582_825765_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_023147731.1|825764_827006_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	1.3e-241
WP_016244986.1|826983_827634_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.1	1.6e-118
WP_000257519.1|827648_828854_+|capsid	phage major capsid protein	capsid	A0A1B5FPI9	Escherichia_phage	100.0	1.8e-224
WP_000601360.1|828903_829104_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927711.1|829106_829430_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_023147732.1|829426_829837_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	2.1e-71
WP_000213503.1|829811_830318_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_016244984.1|830314_830875_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	98.9	3.0e-105
WP_000497751.1|830883_831054_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_016244983.1|831037_832534_+|tail	phage tail sheath protein	tail	M1FN90	Enterobacteria_phage	99.4	5.4e-274
WP_000090998.1|832533_832890_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|832889_833159_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_016244982.1|833300_835136_+|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	2.9e-306
WP_032193238.1|835196_836525_+	DNA circularization protein	NA	Q8SBG8	Shigella_phage	98.6	2.5e-246
WP_000999511.1|836521_837601_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	2.6e-206
WP_001259084.1|837600_838149_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	98.9	5.1e-97
WP_016244980.1|838148_838574_+|tail	phage tail protein	tail	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_023147736.1|838560_839619_+|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	8.1e-200
WP_000383536.1|839609_840194_+	YmfQ family protein	NA	O22003	Shigella_phage	99.0	7.0e-113
WP_039000333.1|840197_841124_+	hypothetical protein	NA	U5P0I1	Shigella_phage	83.1	9.3e-51
WP_001515121.1|841123_841534_+|tail	tail assembly chaperone	tail	U5P0S4	Shigella_phage	81.6	2.3e-25
WP_001515122.1|841505_841949_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	1.5e-46
WP_023147383.1|841948_842323_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	49.4	2.8e-14
WP_032193087.1|842573_844463_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_023147381.1|845318_845651_+	protein FlxA	NA	NA	NA	NA	NA
WP_000169527.1|845733_846033_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000878221.1|846029_846896_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	1.1e-50
WP_000749408.1|847272_847704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045909840.1|848260_849475_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.3	7.7e-130
854287:854302	attR	CTGATGAACTTATTGA	NA	NA	NA	NA
>prophage 5
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	1924753	1978248	4971154	terminase,holin,lysis,tail,tRNA,integrase	Escherichia_phage(47.62%)	55	1919137:1919153	1959421:1959437
1919137:1919153	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_000628065.1|1924753_1925986_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387395.1|1926240_1927224_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123745.1|1927701_1929075_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157405.1|1929203_1930139_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040851.1|1930190_1931426_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.3	3.0e-238
WP_000079604.1|1931427_1931643_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1931742_1931931_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_042038331.1|1931923_1932118_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	1.3e-31
WP_000166319.1|1932174_1932984_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_069354050.1|1932976_1935577_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.4	3.9e-248
WP_001485242.1|1936027_1936198_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	6.1e-17
WP_000560223.1|1936197_1936419_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1936859_1937348_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1937344_1937500_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001394126.1|1937906_1938623_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.1e-51
WP_060615121.1|1938672_1938888_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693850.1|1938884_1939310_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073545275.1|1939381_1940452_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.1	1.4e-61
WP_069354172.1|1940492_1940915_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	3.4e-61
WP_001278661.1|1941314_1944947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122358658.1|1945386_1945494_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	93.1	9.4e-08
WP_001445775.1|1945594_1945720_+	Hok/Gef family protein	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|1945802_1946144_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|1947010_1947610_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|1947609_1947900_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|1947896_1948439_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|1948660_1949230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|1949198_1949501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|1949577_1949919_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_001194112.1|1949922_1950399_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	2.3e-85
WP_001228696.1|1950615_1950801_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1950997_1952455_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|1952592_1953384_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204028.1|1953376_1954309_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000126788.1|1954286_1954496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354180.1|1954499_1955594_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	1.0e-112
WP_000625348.1|1955574_1956876_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763702.1|1956878_1958285_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	1.0e-186
WP_001363932.1|1958268_1959381_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_000770042.1|1959485_1960250_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	6.9e-84
1959421:1959437	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|1960348_1961488_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000634214.1|1961710_1962106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|1962105_1962489_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029819.1|1962489_1962870_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	6.5e-19
WP_000673077.1|1962866_1963259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069354179.1|1963285_1964248_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	6.5e-55
WP_122452218.1|1964398_1964758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545276.1|1965229_1968463_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.3	1.3e-104
WP_000024051.1|1968455_1968794_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152428.1|1968793_1969492_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.0	2.7e-127
WP_032149348.1|1969497_1970241_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	1.9e-147
WP_032170523.1|1970138_1970786_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	93.0	1.7e-107
WP_073545277.1|1970846_1974245_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.0	0.0e+00
WP_052921398.1|1974311_1974911_+	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.0	5.7e-110
WP_073545344.1|1974975_1978248_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	72.4	0.0e+00
>prophage 6
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	2187593	2243160	4971154	terminase,protease,lysis,tail,portal,integrase	Enterobacteria_phage(51.02%)	65	2205673:2205688	2243251:2243266
WP_000527758.1|2187593_2189054_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
WP_000347482.1|2189142_2190426_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|2191029_2191143_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2191211_2191445_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086514.1|2191761_2192352_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	7.3e-25
WP_000885616.1|2192449_2193025_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_073545281.1|2193024_2195985_-	hypothetical protein	NA	A0A0K2FIZ6	Escherichia_phage	53.7	1.5e-54
WP_001233073.1|2196049_2196649_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	98.5	2.6e-110
WP_016238945.1|2196719_2200133_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.4	0.0e+00
WP_019843089.1|2200193_2200802_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.5	1.8e-103
WP_032143461.1|2200738_2201482_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	6.6e-148
WP_016238944.1|2201487_2202186_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	98.7	3.3e-133
WP_000447248.1|2202195_2202525_-|tail	phage tail protein	tail	A0A291AWW9	Escherichia_phage	100.0	1.7e-60
WP_000372032.1|2202524_2205590_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.3	0.0e+00
WP_001161009.1|2205561_2205891_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
2205673:2205688	attL	AAGGCTGAAATCAGCC	NA	NA	NA	NA
WP_001299384.1|2205899_2206286_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	99.2	4.7e-65
WP_000211114.1|2206346_2207090_-|tail	tail protein	tail	A5LH35	Enterobacteria_phage	99.2	1.7e-132
WP_073545282.1|2207100_2207502_-|tail	phage tail protein	tail	A5LH34	Enterobacteria_phage	98.5	1.2e-71
WP_000677102.1|2207498_2208077_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_001283153.1|2208088_2208364_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097039.1|2208356_2208680_-	DUF2190 family protein	NA	K7PLV6	Enterobacteria_phage	99.1	1.5e-51
WP_001774880.1|2208766_2210794_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_000985930.1|2210738_2212247_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.7e-288
WP_001072975.1|2212246_2212459_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000507036.1|2212455_2214555_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	96.6	0.0e+00
WP_000421823.1|2214563_2215103_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	1.8e-94
WP_001031431.1|2215663_2215870_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000035577.1|2216170_2216581_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001019606.1|2216732_2216906_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2217077_2217233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122134696.1|2217312_2217378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2217380_2217569_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2217579_2217792_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|2218154_2218652_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|2218648_2219182_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189915.1|2219178_2219490_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2219494_2219710_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2220464_2220680_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_001047131.1|2221355_2222108_-	antitermination protein	NA	Q8SBE4	Shigella_phage	94.4	1.4e-129
WP_001385829.1|2222121_2223171_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	3.7e-112
WP_023140913.1|2223172_2223451_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_000980997.1|2223517_2223769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000884073.1|2223985_2224198_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	6.6e-29
WP_001546200.1|2224242_2224350_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	2.5e-08
WP_021514655.1|2224815_2226603_+	DUF4209 domain-containing protein	NA	Q2P9X5	Enterobacteria_phage	23.4	7.1e-15
WP_001151190.1|2226821_2227223_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.7	7.1e-64
WP_000054490.1|2227263_2228241_-	hypothetical protein	NA	U5P0A0	Shigella_phage	61.3	4.5e-56
WP_000705349.1|2228221_2228743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921594.1|2228726_2228954_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|2229034_2229442_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379589.1|2229610_2229766_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000344944.1|2229767_2230343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2230829_2231018_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083282.1|2231014_2231206_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001296941.1|2233821_2234058_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000877001.1|2234092_2235373_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001360138.1|2235392_2235503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836079.1|2235560_2236580_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_069354043.1|2236591_2237806_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.8e-46
WP_000598292.1|2238011_2238338_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|2238472_2238814_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|2238848_2239409_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|2239411_2240122_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001307224.1|2240229_2240535_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041558.1|2240733_2243160_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2243251:2243266	attR	AAGGCTGAAATCAGCC	NA	NA	NA	NA
>prophage 7
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	2611176	2707282	4971154	capsid,terminase,holin,transposase,protease,lysis,tail,portal,head,integrase	Escherichia_phage(34.55%)	97	2687743:2687802	2715160:2715239
WP_000826451.1|2611176_2612340_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
WP_000879833.1|2613728_2614526_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2614535_2615087_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001274295.1|2615921_2616236_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994405.1|2616450_2618109_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2618101_2619097_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282706.1|2619089_2619776_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213294.1|2619775_2621149_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2621167_2621611_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620094.1|2621607_2622735_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2622839_2623304_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2623308_2624313_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2624309_2624723_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001348482.1|2624725_2625091_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2625090_2625828_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187359.1|2625837_2626107_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942316.1|2626114_2626900_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2627189_2627813_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|2627856_2628099_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2628207_2628435_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491504.1|2628732_2629551_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001597912.1|2629547_2631242_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2631412_2631595_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2631673_2632591_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212238.1|2632763_2633684_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_073545293.1|2633672_2634143_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_073545294.1|2634123_2635542_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365561.1|2635608_2636304_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_073545295.1|2636343_2636709_-	permease	NA	NA	NA	NA	NA
WP_000824362.1|2637275_2638349_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_000218209.1|2638941_2639793_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826746.1|2639900_2641259_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|2641258_2641930_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000920127.1|2642062_2642476_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_073545296.1|2642584_2643589_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240091.1|2643589_2644225_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007756.1|2644481_2645132_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2645474_2646005_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_073545345.1|2647495_2647621_-|tail	phage tail protein	tail	K7PMH7	Enterobacteria_phage	82.5	2.5e-12
WP_073545297.1|2647675_2650948_-|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.6	1.4e-290
WP_069354217.1|2651012_2651612_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	3.3e-110
WP_073545298.1|2651682_2655096_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.4	0.0e+00
WP_069354215.1|2655156_2655804_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	95.8	8.1e-110
WP_001312811.1|2655701_2656445_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	1.1e-150
WP_060565118.1|2656450_2657149_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.2e-132
WP_001330090.1|2657148_2657505_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_069354183.1|2657482_2660710_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.2	0.0e+00
WP_077628067.1|2660756_2661017_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|2661058_2661445_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_001517909.1|2661444_2662149_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	9.1e-115
WP_001206307.1|2662209_2662554_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	3.9e-55
WP_000968644.1|2662550_2663000_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|2662996_2663335_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|2663343_2663661_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|2663737_2664955_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2664969_2665569_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|2665561_2666788_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_001140892.1|2666935_2668693_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2668692_2669175_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135103.1|2669322_2669673_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|2670198_2670492_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001228695.1|2670582_2670765_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000992100.1|2670981_2671515_-	lysozyme	NA	Q08J98	Stx2-converting_phage	94.4	3.6e-100
WP_000193264.1|2671578_2671929_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2671933_2672149_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_073545299.1|2672298_2672460_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	84.8	3.9e-13
WP_072147991.1|2672456_2672660_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	5.9e-27
WP_001333560.1|2672905_2673241_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_000562553.1|2673521_2673653_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_000762889.1|2674548_2675370_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_000904111.1|2675384_2675741_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	6.1e-35
WP_069354185.1|2675753_2676803_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_001410105.1|2676804_2677083_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001013636.1|2677250_2677463_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_021568390.1|2677507_2677690_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	2.8e-12
WP_011076332.1|2677664_2677883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021568391.1|2678218_2678455_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	95.5	6.7e-14
WP_001538583.1|2678495_2679566_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	1.4e-63
WP_000693850.1|2679637_2680063_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001538582.1|2680681_2681020_+	hypothetical protein	NA	H9C160	Pectobacterium_phage	30.9	3.3e-06
WP_000379578.1|2681312_2681468_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|2681627_2681846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|2681849_2682014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|2682414_2682603_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2682599_2682791_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_069354169.1|2682884_2685326_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.5	1.7e-112
WP_000096344.1|2685384_2685588_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|2685587_2686613_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001392298.1|2686848_2687646_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
2687743:2687802	attL	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTC	NA	NA	NA	NA
WP_073545301.1|2687983_2688514_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.3	1.4e-30
WP_001292571.1|2688607_2689246_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	41.8	1.1e-29
WP_000041053.1|2690640_2691525_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000246269.1|2692612_2693074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069354168.1|2693592_2697783_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	1.7e-22
WP_000036084.1|2697770_2698163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_123059557.1|2698806_2705883_+	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_000483767.1|2705935_2707282_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
2715160:2715239	attR	CGATTCCTCTGTAGTTCAGTCGGTAGAACGGCGGACTGTTAATCCGTATGTCACTGGTTCGAGTCCAGTCAGAGGAGCCA	NA	NA	NA	NA
>prophage 8
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	2782386	2790538	4971154		Prochlorococcus_phage(16.67%)	7	NA	NA
WP_000089911.1|2782386_2783352_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	2.2e-87
WP_001746893.1|2783354_2784476_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	2.0e-132
WP_001581219.1|2784502_2785519_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_069354234.1|2785537_2786557_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.3	2.4e-84
WP_001363008.1|2786865_2787759_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000999466.1|2787990_2788986_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	1.9e-09
WP_001363019.1|2789143_2790538_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	4.9e-19
>prophage 9
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	2882292	2891733	4971154		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292774.1|2882292_2883429_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
WP_001317947.1|2883425_2885426_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|2885550_2886012_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2886051_2886522_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2886568_2887288_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2887284_2888970_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2889191_2889923_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2889982_2890090_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2890070_2890802_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569358.1|2890806_2891733_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
>prophage 10
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	3358516	3468603	4971154	capsid,terminase,holin,lysis,plate,tail,portal,tRNA,head,integrase	Salmonella_phage(55.43%)	131	3397592:3397606	3472434:3472448
WP_001356308.1|3358516_3359254_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|3359385_3360720_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_000365855.1|3360928_3361810_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189203.1|3361912_3362500_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3362555_3362939_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3363243_3363933_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3363980_3365018_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3365224_3365644_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000138184.1|3365712_3366411_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082969.1|3366442_3369103_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|3369216_3370572_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000464877.1|3370596_3370941_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000841103.1|3370937_3372236_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
WP_069354125.1|3378102_3380676_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.0e-127
WP_000040129.1|3380805_3381537_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079100.1|3381533_3382514_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|3382648_3383386_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|3383656_3383998_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001700969.1|3384101_3384149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200101.1|3384247_3385408_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225221.1|3385450_3386572_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168045.1|3386582_3387653_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000976004.1|3387862_3388228_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212391.1|3388377_3388896_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969010.1|3388885_3390112_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589828.1|3390127_3390610_+	OmpA family protein	NA	NA	NA	NA	NA
WP_073545311.1|3390781_3391831_-|integrase	site-specific integrase	integrase	A0A0M4S6G4	Salmonella_phage	91.1	2.6e-190
WP_000823621.1|3391853_3392192_-	DUF2511 domain-containing protein	NA	A0A0M3ULF8	Salmonella_phage	97.3	3.7e-58
WP_000093633.1|3392200_3393061_-	phage repressor protein CI	NA	Q6K1G0	Salmonella_virus	98.3	8.4e-163
WP_001544858.1|3393182_3393554_+	hypothetical protein	NA	A0A0M4R4X7	Salmonella_phage	97.6	2.6e-60
WP_000459334.1|3393586_3394096_+	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	97.0	1.1e-88
WP_000920167.1|3394103_3394304_+	DUF2724 domain-containing protein	NA	Q6K1F7	Salmonella_virus	95.5	1.1e-30
WP_000963463.1|3394267_3394606_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	94.6	7.3e-54
WP_001246238.1|3394673_3394901_+	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	98.7	2.0e-31
WP_073545312.1|3394900_3395122_+	TraR/DksA family transcriptional regulator	NA	A0A0M4S5Q7	Salmonella_phage	95.9	7.1e-34
WP_078071576.1|3395123_3397346_+	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	90.4	0.0e+00
WP_000232651.1|3397459_3397642_+	hypothetical protein	NA	A0A0M5M1G5	Salmonella_phage	98.3	4.5e-26
3397592:3397606	attL	AACAGCGAAAATAAC	NA	NA	NA	NA
WP_001622296.1|3397645_3397876_+	DinI family protein	NA	A0A218M4I0	Erwinia_phage	71.1	4.4e-26
WP_072662389.1|3398352_3398784_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	96.5	3.1e-73
WP_001407038.1|3398782_3398974_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	95.2	1.4e-25
WP_001407037.1|3399432_3400260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073545315.1|3400262_3401012_+	hypothetical protein	NA	S5W9H2	Leptospira_phage	40.2	2.8e-05
WP_072662392.1|3401083_3402094_-|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	82.9	1.5e-166
WP_073545316.1|3402095_3403865_-|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	98.0	0.0e+00
WP_073545317.1|3404030_3404885_+|capsid	GPO family capsid scaffolding protein	capsid	A0A218M4L9	Erwinia_phage	81.7	7.3e-127
WP_001247241.1|3404961_3406029_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.4	7.6e-198
WP_021532440.1|3406033_3406783_+|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	90.8	6.7e-116
WP_073545318.1|3406876_3407386_+|head	head completion/stabilization protein	head	A0A218M4L7	Erwinia_phage	97.0	8.1e-89
WP_001407031.1|3407385_3407589_+|tail	tail protein	tail	A0A0M3ULF4	Salmonella_phage	92.5	2.2e-29
WP_000134662.1|3407592_3407889_+|holin	holin	holin	O80308	Escherichia_phage	98.0	6.4e-46
WP_001407030.1|3407875_3408373_+	glycoside hydrolase family 104 protein	NA	M1TAR2	Escherichia_phage	94.5	3.0e-88
WP_001407029.1|3408369_3408783_+|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	70.8	2.0e-45
WP_001759348.1|3408754_3408928_+	hypothetical protein	NA	O80311	Escherichia_phage	96.5	2.3e-24
WP_001437785.1|3408890_3409358_+|tail	phage tail protein	tail	A0A218M4K6	Erwinia_phage	100.0	1.4e-84
WP_001293098.1|3409350_3409800_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	98.7	7.9e-72
WP_073545319.1|3409868_3410504_+|plate	phage baseplate assembly protein V	plate	A0A2I8TV69	Erwinia_phage	97.6	5.1e-109
WP_021532443.1|3410500_3410848_+	hypothetical protein	NA	A0A218M4K8	Erwinia_phage	98.3	1.2e-56
WP_000246679.1|3410854_3411763_+|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	97.7	5.0e-158
WP_000999856.1|3411755_3412364_+|tail	phage tail protein I	tail	A0A218M4J3	Erwinia_phage	98.0	1.1e-113
WP_004017449.1|3412360_3413344_+	phage Tail Collar domain protein	NA	A0A2I8TVA9	Erwinia_phage	82.0	2.8e-146
WP_073545320.1|3413343_3413940_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	80.7	1.8e-87
WP_073545321.1|3414071_3415250_+|tail	phage tail sheath protein	tail	Q37844	Escherichia_phage	96.2	7.6e-215
WP_001207675.1|3415265_3415784_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_078071577.1|3415847_3416183_+|tail	phage tail assembly protein	tail	S4TTB2	Salmonella_phage	97.3	3.4e-51
WP_000763319.1|3416215_3416335_+|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	94.9	9.7e-14
WP_073545322.1|3416327_3418772_+|tail	phage tail tape measure protein	tail	A0A0M3UL85	Salmonella_phage	91.8	0.0e+00
WP_001407015.1|3418785_3419271_+|tail	phage tail protein	tail	O80317	Escherichia_phage	94.4	2.6e-81
WP_073545323.1|3419267_3420437_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	95.9	1.7e-206
WP_000972010.1|3420512_3420731_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	100.0	1.2e-38
WP_000065253.1|3420875_3421223_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|3421264_3422032_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|3422062_3422611_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|3422629_3422878_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|3423014_3424376_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001189257.1|3424467_3425334_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_010723175.1|3425354_3426641_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001296310.1|3426695_3427289_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059169.1|3427411_3428290_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880910.1|3428375_3430037_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|3430185_3430527_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117838.1|3430588_3430879_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600189.1|3430868_3431345_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|3431476_3431959_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_021534458.1|3432659_3433142_+	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000980501.1|3433168_3433387_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_069354126.1|3433455_3434556_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	4.9e-176
WP_023135235.1|3434552_3435038_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_069354127.1|3435034_3438112_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	69.1	0.0e+00
WP_000763311.1|3438104_3438224_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|3438238_3438541_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207665.1|3438595_3439111_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	6.2e-89
WP_000046130.1|3439120_3440293_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.0e-203
WP_069354128.1|3440399_3440813_-|tail	phage tail protein	tail	U5P0S4	Shigella_phage	71.6	5.8e-21
WP_073545324.1|3440812_3442396_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	52.0	2.2e-84
WP_021534464.1|3442392_3442998_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	5.8e-110
WP_000268297.1|3442990_3443899_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.7	2.7e-143
WP_000177597.1|3443885_3444245_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.7	2.8e-51
WP_021534466.1|3444241_3444820_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	9.4e-94
WP_001504072.1|3444896_3445697_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_069354130.1|3445809_3446259_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	79.7	1.2e-59
WP_086258517.1|3446251_3446683_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	1.7e-71
WP_069354132.1|3446778_3447207_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.5	1.2e-45
WP_069354133.1|3447203_3447581_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.8	1.0e-16
WP_069354134.1|3447582_3448095_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.1	1.2e-87
WP_000171568.1|3448075_3448291_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_053921329.1|3448294_3448498_-|tail	phage tail protein	tail	E5G6M9	Salmonella_phage	91.0	6.8e-31
WP_000673523.1|3448497_3448962_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_069354135.1|3449057_3449708_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_069354136.1|3449711_3450770_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	2.4e-180
WP_000216240.1|3450786_3451620_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	92.1	3.1e-122
WP_001098431.1|3451762_3453529_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_042005418.1|3453528_3454554_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	87.9	1.1e-172
WP_119743262.1|3454639_3455128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086258518.1|3455133_3455448_-	STAS-like domain-containing protein	NA	NA	NA	NA	NA
WP_042005405.1|3455450_3456518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3456887_3457121_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3457131_3457320_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_069354137.1|3457473_3459888_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_069354138.1|3459884_3460742_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	1.7e-160
WP_000752619.1|3460738_3460966_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	3.5e-36
WP_001244230.1|3460965_3461199_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.1e-32
WP_001352070.1|3461266_3461608_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	96.5	4.3e-54
WP_000934004.1|3461689_3461938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001726296.1|3462023_3462320_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	1.3e-22
WP_001726297.1|3462327_3462837_-	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	93.5	1.9e-82
WP_000102105.1|3462869_3463112_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_021552395.1|3463231_3463864_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	60.0	3.7e-67
WP_069354139.1|3463866_3464886_+|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.7	3.9e-191
WP_021552396.1|3464890_3466102_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	37.6	1.4e-75
WP_021552397.1|3466186_3467089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552398.1|3467403_3468603_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.6	1.2e-106
3472434:3472448	attR	GTTATTTTCGCTGTT	NA	NA	NA	NA
>prophage 11
NZ_CP010140	Escherichia coli strain D3 chromosome, complete genome	4971154	3559352	3572535	4971154		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|3559352_3561914_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141340.1|3562019_3562676_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272549.1|3562726_3563524_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	5.9e-70
WP_000847985.1|3563689_3564598_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3564594_3565857_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3565853_3566492_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3566496_3567273_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|3567361_3568726_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3568819_3569812_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3569874_3571014_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3571153_3571780_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3571773_3572535_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
NZ_CP010141	Escherichia coli strain D3 plasmid A, complete sequence	174041	3482	39551	174041	transposase,integrase	Escherichia_phage(38.46%)	36	8398:8457	39546:40368
WP_001067858.1|3482_4187_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000219391.1|4309_5215_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|5211_6450_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|6449_7034_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|7526_8291_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
8398:8457	attL	AGGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACAT	NA	NA	NA	NA
WP_001067858.1|8451_9156_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|9472_10030_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|10212_11073_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_000599533.1|13185_14391_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562367.1|14834_15155_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460653.1|15147_15534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|15541_16228_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|16205_16829_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089068.1|16910_18116_+	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000428546.1|18228_18822_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000428546.1|19816_20410_+	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001089068.1|20522_21728_-	tetracycline efflux MFS transporter Tet(B)	NA	NA	NA	NA	NA
WP_000088605.1|21809_22433_+	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001284954.1|22410_23097_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000460653.1|23104_23491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562367.1|23483_23804_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000599533.1|24247_25453_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_001352368.1|25818_27027_-|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_000412211.1|27187_27847_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|28047_28425_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001138064.1|28491_31458_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.6	0.0e+00
WP_000147567.1|31460_32021_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|32146_32497_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|32699_33713_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|33870_34344_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|34474_35263_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_000679427.1|35468_35816_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|35809_36649_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|36776_36980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000184001.1|37135_38341_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_001067858.1|38846_39551_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
39546:40368	attR	ATGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCTGAAAACTATATCAAAGAAGCCAAATACGACATGGCGGTGGGTCATCTCTTGCTAAAGTCATTTTGGGCGAATGAAGCCGTGTTTCAAATGATGATGCTTTCATATAACCTATTTTTGTTGTTCAAGTTTGATTCCTTGGACTCTTCAGAATACAGACAGCAAATAAAGACCTTTCGTTTGAAGTATGTATTTCTTGCAGCAAAAATAATCAAAACCGCAAGATATGTAATCATGAAGTTGTCGGAAAACTATCCGTACAAGGGAGTGTATGAAAAATGTCTGGTATAATAAGAATATCATCAATAAAATTGAGTGTTGCTCTGTGGATAACTTGCAGAGTTTATTAAGTATCATTGCAGCAAAGATGAAATCAATGATTTATCAAAAATGATTGAAAGGTGGTTGTAAATAATGTTACAATGTGTGAGAAGCAGTCTAAATTCTTCGTGAAATAGTGATTTTTGAAGCTAATAAAAAACACACGTGGAATTTAGGGACTATTCATGTTGTTGTTATTTCGTATCTTCCAGAATAAGGAATCCCATGGTTAAAAAATCACTGCGCCAGTTCACGCTGATGGCGACGGCAACCGTCACGCTGTTGTTAGGAAGTGTGCCGCTGTATGCGCAAACGGCGGACGTACAGCAAAAACTTGCCGAATTAGAGCGGCAGTCGGGAGGCAGACTGGGTGTGGCATTGATTAACACAGCAGATAATTCGCAAATACTTTATCGTGCTGATGAGCGCTTTGCGATGTGCAGCA	NA	NA	NA	NA
