The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	23	6232	5060525	tail	Enterobacteria_phage(50.0%)	6	NA	NA
WP_073514764.1|23_800_+|tail	tail fiber protein	tail	X2KTY7	Enterobacteria_phage	62.7	5.2e-55
WP_000885601.1|799_1375_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	97.4	4.1e-105
WP_000078177.1|1472_2063_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2379_2613_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2681_2795_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527753.1|4771_6232_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
>prophage 2
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	342806	349473	5060525	transposase	Stx2-converting_phage(50.0%)	8	NA	NA
WP_001146442.1|342806_343037_-	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	6.5e-06
WP_001171554.1|343360_343741_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|343737_344085_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_073514543.1|344134_345673_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_001295620.1|345756_346857_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001178380.1|347173_348292_-|transposase	IS481 family transposase	transposase	A0A0M3LR35	Mannheimia_phage	23.8	3.1e-08
WP_000170954.1|348362_348470_+	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_000811065.1|348618_349473_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
>prophage 3
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	408673	467754	5060525	transposase,tail,tRNA,capsid,portal,terminase,head,holin,integrase	Enterobacteria_phage(34.04%)	64	416964:416978	467856:467870
WP_001297484.1|408673_409780_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|409815_410457_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|410460_411831_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|411998_412670_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|412669_414130_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|414205_415327_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359438.1|415472_416702_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|416951_418088_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
416964:416978	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799400.1|418071_418935_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_023307902.1|419297_420659_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	2.8e-51
WP_000950789.1|421064_422045_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	48.6	8.0e-85
WP_001023432.1|422221_422491_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_001340979.1|422492_423806_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	1.1e-78
WP_001230532.1|423870_424470_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_023307901.1|424536_428010_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|428143_428671_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_136148694.1|428861_429494_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.7e-104
WP_023307900.1|429439_430183_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
WP_023307899.1|430193_430892_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	1.1e-131
WP_000847304.1|430891_431221_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_023307898.1|431217_433794_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000533402.1|433774_434188_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|434214_434646_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_023307897.1|434664_435411_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683084.1|435418_435814_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	84.0	2.3e-59
WP_000974985.1|435810_436344_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_001204554.1|436359_436713_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_001299692.1|436705_437089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307896.1|437140_438169_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|438226_438574_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_073514547.1|438610_440116_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	2.7e-100
WP_073514548.1|440105_441698_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	6.5e-185
WP_000258991.1|441694_441901_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_000235436.1|443785_444295_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001300236.1|444697_444922_+	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	2.9e-19
WP_001303878.1|445003_445318_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|445845_446031_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001280929.1|446258_446390_-	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001303555.1|446402_446585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307893.1|446740_447274_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.2	1.2e-98
WP_000731192.1|447324_447669_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_024165672.1|447673_447889_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_023307892.1|448181_450032_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000762896.1|451110_451932_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	8.2e-83
WP_023307891.1|451928_452309_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	65.5	1.3e-38
WP_001373818.1|453486_454164_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_073514549.1|455342_455591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307889.1|455537_455717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|455757_455970_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_023307888.1|456251_457010_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_122996371.1|457708_457873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307887.1|457869_458616_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	83.9	1.9e-110
WP_023307886.1|458638_459385_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	79.3	1.3e-111
WP_023307885.1|459391_460357_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.9	1.3e-58
WP_023307884.1|460378_460804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307883.1|460787_461111_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	43.5	1.8e-09
WP_023307882.1|461235_461712_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	44.1	4.4e-12
WP_000367380.1|462032_462185_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	4.3e-06
WP_001339605.1|462196_462598_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000358771.1|462557_462836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449196.1|463394_463583_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_073514550.1|463864_466336_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	6.5e-59
WP_000003742.1|466397_466667_+	excisionase	NA	NA	NA	NA	NA
WP_023307880.1|466635_467754_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.4	2.0e-84
467856:467870	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 4
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	1492063	1574566	5060525	plate,tail,protease,capsid,portal,terminase,head,holin,integrase	Shigella_phage(48.28%)	91	1510983:1510999	1572012:1572028
WP_000131044.1|1492063_1494097_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295527.1|1494225_1494813_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001594798.1|1494826_1496299_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159102.1|1496312_1497983_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209088.1|1498195_1498861_+	membrane protein	NA	NA	NA	NA	NA
WP_001358288.1|1499106_1499802_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023906.1|1499794_1501222_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102119.1|1501232_1501952_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339593.1|1502478_1503333_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046325.1|1503558_1504884_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	6.5e-114
WP_000474084.1|1504992_1505229_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001358289.1|1505240_1505834_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001358290.1|1506425_1507283_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001594791.1|1507403_1511657_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
1510983:1510999	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_000662258.1|1512772_1512874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803999.1|1513236_1513500_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|1513499_1513640_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147277.1|1513674_1513902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001325913.1|1514724_1515267_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|1515341_1515929_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|1515986_1516655_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_069915028.1|1516680_1519206_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001446388.1|1519195_1520839_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001296887.1|1520807_1521518_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_032154401.1|1521830_1522160_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|1522407_1523022_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|1523439_1524129_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643328.1|1524125_1525082_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_073514587.1|1525078_1527277_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	3.7e-37
WP_000121330.1|1527286_1528243_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111349.1|1528221_1528632_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_032170462.1|1529293_1530037_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000951129.1|1531270_1531585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000947155.1|1531954_1532905_+	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_000355484.1|1533924_1534698_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_073514589.1|1534758_1535313_-	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.5	7.4e-88
WP_077897761.1|1535339_1535741_+|tail	phage tail protein	tail	F1BUP1	Erwinia_phage	38.4	3.4e-10
WP_000376436.1|1535744_1536164_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	55.8	1.7e-36
WP_033813583.1|1536135_1536738_-|tail	tail fiber assembly protein	tail	K7P870	Enterobacteria_phage	85.4	3.2e-92
WP_023892474.1|1536737_1537538_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	67.0	5.7e-57
WP_000383548.1|1537541_1538126_-	YmfQ family protein	NA	O22003	Shigella_phage	100.0	1.1e-113
WP_000785311.1|1538116_1539175_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.6	8.1e-200
WP_000424747.1|1539161_1539587_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	2.0e-80
WP_073514591.1|1539586_1540135_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	4.7e-95
WP_073514592.1|1540134_1541214_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.2	1.3e-205
WP_073514593.1|1541210_1542587_-	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	98.3	4.1e-252
WP_073514594.1|1542611_1544519_-|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	95.1	0.0e+00
WP_000571713.1|1544603_1544927_-|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	99.1	1.1e-51
WP_000090997.1|1544923_1545280_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	9.0e-63
WP_073514595.1|1545279_1546773_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.8	4.5e-273
WP_065312204.1|1546759_1546927_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
WP_000779292.1|1546935_1547496_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000224835.1|1547492_1547999_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_052909138.1|1547973_1548384_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.1	1.8e-70
WP_000927715.1|1548380_1548704_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	98.1	3.3e-56
WP_000601363.1|1548706_1548907_-	hypothetical protein	NA	S5FNU1	Shigella_phage	98.5	1.7e-26
WP_000257507.1|1548956_1550162_-|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_001193631.1|1550176_1550827_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466255.1|1550804_1552046_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_000605605.1|1552045_1552228_-	hypothetical protein	NA	S5FXQ9	Shigella_phage	98.3	3.8e-25
WP_072011717.1|1552239_1553736_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929181.1|1553969_1554464_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_072672167.1|1554589_1554940_-	HNH endonuclease	NA	S5FKR6	Shigella_phage	91.4	2.0e-59
WP_021530159.1|1554979_1555231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072672165.1|1555585_1555978_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	84.6	4.6e-52
WP_072672163.1|1555961_1556438_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	96.2	2.1e-86
WP_027661774.1|1556441_1556777_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_072672161.1|1556854_1557907_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	98.6	2.0e-206
WP_032217105.1|1558056_1558251_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	96.9	1.5e-27
WP_073514596.1|1558552_1559488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047653682.1|1559622_1560090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047653676.1|1560109_1560457_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	1.6e-56
WP_072672159.1|1560474_1561464_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	2.3e-193
WP_072672157.1|1561471_1562269_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.6	1.2e-150
WP_072672155.1|1562288_1562678_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.7	1.3e-67
WP_000210164.1|1562674_1563001_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_072672153.1|1563000_1563486_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	76.1	6.8e-61
WP_072672151.1|1563482_1564301_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	88.4	2.4e-127
WP_000933944.1|1564297_1564534_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	96.2	2.1e-36
WP_072672148.1|1564526_1565363_-	ash family protein	NA	Q8SBF3	Shigella_phage	95.7	4.5e-145
WP_072672146.1|1565359_1565911_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	5.8e-101
WP_000649477.1|1565954_1566155_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|1566245_1566920_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|1567092_1567389_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|1568065_1568602_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_032301943.1|1568592_1568955_+	phage protein	NA	U5P092	Shigella_phage	98.3	1.0e-66
WP_000627693.1|1568954_1569260_+	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_032207578.1|1569486_1570650_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.7	9.1e-229
WP_000893257.1|1570854_1572108_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.3e-95
1572012:1572028	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001285288.1|1572119_1573223_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749865.1|1573510_1574566_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	2.0e-118
>prophage 5
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	1600881	1654068	5060525	tRNA,plate,transposase	Shigella_phage(11.11%)	43	NA	NA
WP_085947772.1|1600881_1602094_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_073514597.1|1602087_1603314_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_001142958.1|1603523_1604042_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_073514598.1|1604740_1605241_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|1605275_1605500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056978.1|1605550_1607026_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000611742.1|1607032_1607446_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_073514599.1|1607449_1609300_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|1609263_1610346_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|1610370_1611651_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|1611647_1612172_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246421.1|1612174_1613506_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343302.1|1613510_1614272_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_073514600.1|1614280_1617058_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.6	2.3e-81
WP_000088862.1|1617054_1617798_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240545.1|1617802_1619215_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_123059139.1|1619323_1622758_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087750.1|1622768_1624121_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284199.1|1624144_1624627_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001373818.1|1626595_1627273_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_073514602.1|1627539_1628019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086142.1|1628155_1628941_-	aminopeptidase	NA	NA	NA	NA	NA
WP_001297205.1|1629476_1630208_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_073514603.1|1630272_1630740_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	6.1e-51
WP_001298887.1|1630736_1631459_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052751.1|1631492_1632248_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|1632319_1633678_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|1633725_1634496_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|1634573_1635374_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648572.1|1635614_1636529_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_073514604.1|1636525_1637329_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140175.1|1642999_1643575_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|1643762_1644794_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|1644786_1645440_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|1645479_1646295_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|1646412_1646817_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094011.1|1646813_1647521_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260712.1|1647631_1649350_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001297208.1|1649403_1650228_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_073514605.1|1650430_1651411_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_085947598.1|1651526_1652689_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_000239192.1|1652921_1653632_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|1653645_1654068_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	2672006	2682029	5060525	integrase	Enterobacteria_phage(88.89%)	11	2671509:2671531	2682190:2682212
2671509:2671531	attL	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_000783658.1|2672006_2674340_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|2674354_2674675_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459295.1|2674810_2675266_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244670.1|2675258_2675546_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_001360858.1|2675538_2676138_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001149160.1|2676134_2676401_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_025210993.1|2676953_2677688_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.4	2.0e-128
WP_000638628.1|2677684_2678185_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446147.1|2678258_2678831_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.9e-94
WP_000022311.1|2679118_2680804_+	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	54.2	5.1e-180
WP_001218969.1|2680856_2682029_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.2	3.6e-209
2682190:2682212	attR	TTTGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 7
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	3417291	3438757	5060525	lysis,holin,integrase	Enterobacteria_phage(39.47%)	42	3426913:3426928	3449954:3449969
WP_073514666.1|3417291_3417816_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.1	3.9e-86
WP_001591714.1|3418014_3418482_-|lysis	lysis protein	lysis	K7PH77	Enterobacteria_phage	97.4	2.7e-75
WP_001591713.1|3418478_3418976_-	lysozyme	NA	H6WZK1	Escherichia_phage	98.8	3.8e-91
WP_000284524.1|3418975_3419191_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_033816266.1|3419333_3419732_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499456.1|3419812_3419971_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3420056_3420800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235472.1|3421052_3421676_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_032330300.1|3421672_3422338_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	1.5e-130
WP_032330302.1|3422334_3422946_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.0	1.0e-98
WP_000567000.1|3422938_3423109_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_073514667.1|3423105_3423288_-	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	96.7	8.2e-28
WP_073514668.1|3423254_3423428_-	protein ninD	NA	I6S1V2	Salmonella_phage	89.5	1.5e-26
WP_073514669.1|3423424_3424015_-	S-adenosylmethionine-binding protein	NA	A0A193GYV6	Enterobacter_phage	76.0	5.7e-86
WP_073514670.1|3424011_3424452_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	98.6	7.7e-80
WP_000145931.1|3424525_3424816_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788877.1|3424812_3425514_-	Replication protein 14	NA	K7P6G2	Enterobacteria_phage	100.0	9.9e-130
WP_053294713.1|3425510_3426410_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	3.2e-173
WP_000195204.1|3426442_3426739_-	Regulatory protein CII from phage origin	NA	A0A1U9AJB5	Stx1_converting_phage	99.0	1.5e-47
WP_001180318.1|3426845_3427073_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
3426913:3426928	attL	ATCTCTTCGATTTTTG	NA	NA	NA	NA
WP_000250469.1|3427151_3427859_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	98.3	3.7e-132
WP_024167659.1|3427956_3428499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000528775.1|3428486_3429263_+	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_073514671.1|3429706_3430042_+	hypothetical protein	NA	F1C5C1	Cronobacter_phage	66.7	1.0e-31
WP_000213975.1|3430120_3430321_+	antirestriction Ral family protein	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_024234862.1|3430357_3430981_+	hypothetical protein	NA	K7PKU5	Enterobacteria_phage	93.2	3.2e-103
WP_023565733.1|3431154_3431571_+	hypothetical protein	NA	A0A0U2DAF7	Escherichia_phage	66.4	2.6e-53
WP_001183771.1|3431655_3431826_+	hypothetical protein	NA	A0A192Y6R1	Salmonella_phage	100.0	1.3e-24
WP_000604111.1|3431910_3432219_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_021527656.1|3432215_3433127_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	99.3	2.8e-169
WP_021527657.1|3433110_3433593_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	96.9	1.0e-77
WP_024186733.1|3433604_3433919_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	99.0	5.9e-50
WP_021527658.1|3433935_3434217_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	3.7e-43
WP_001214452.1|3434213_3434378_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_073514672.1|3434374_3434860_+	hypothetical protein	NA	A0A220NRQ7	Escherichia_phage	54.0	9.8e-36
WP_001595494.1|3434856_3435156_+	hypothetical protein	NA	G8C7K8	Escherichia_phage	98.0	9.6e-58
WP_073514674.1|3435888_3436395_+	DUF551 domain-containing protein	NA	V5UT79	Shigella_phage	64.3	6.9e-40
WP_073514675.1|3436394_3436673_+	DUF4752 family protein	NA	K7P6P7	Enterobacteria_phage	96.7	4.6e-46
WP_000545737.1|3436831_3436999_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001281203.1|3437025_3437370_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	98.2	2.2e-58
WP_001303849.1|3437487_3437706_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533671.1|3437683_3438757_+|integrase	tyrosine-type recombinase/integrase	integrase	K7PHK0	Enterobacteria_phage	96.4	7.9e-195
3449954:3449969	attR	CAAAAATCGAAGAGAT	NA	NA	NA	NA
>prophage 8
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	3493186	3502628	5060525		Enterobacteria_phage(85.71%)	10	NA	NA
WP_073514680.1|3493186_3494323_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_001317947.1|3494319_3496320_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.1	0.0e+00
WP_001295429.1|3496444_3496906_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|3496946_3497417_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|3497463_3498183_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|3498179_3499865_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|3500086_3500818_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|3500877_3500985_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|3500965_3501697_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569313.1|3501701_3502628_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	3.1e-22
>prophage 9
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	4100909	4108049	5060525		Escherichia_phage(83.33%)	6	NA	NA
WP_001272898.1|4100909_4103471_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
WP_001141314.1|4103576_4104233_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	47.9	1.1e-50
WP_001297141.1|4104283_4105051_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|4105246_4106155_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|4106151_4107414_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|4107410_4108049_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 10
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	4332705	4445190	5060525	lysis,transposase,tRNA,protease,integrase	Stx2-converting_phage(22.86%)	109	4324243:4324257	4454706:4454722
4324243:4324257	attL	AAATCGACGCTGTTA	NA	NA	NA	NA
WP_000701841.1|4332705_4333464_+|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
4324243:4324257	attL	AAATCGACGCTGTTA	NA	NA	NA	NA
WP_000105559.1|4333669_4334590_-	agmatinase	NA	NA	NA	NA	NA
WP_000758905.1|4334725_4335457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295380.1|4335602_4337579_-	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_001297406.1|4337587_4337719_-	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001303650.1|4337854_4338070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001062128.1|4338373_4339528_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001112301.1|4339963_4341358_+	galactose/proton symporter	NA	NA	NA	NA	NA
WP_000858396.1|4341434_4341932_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_073514704.1|4342026_4342734_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222508.1|4342813_4343545_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593284.1|4343557_4344508_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4344616_4345180_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017103.1|4345179_4345596_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055620.1|4345779_4346760_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4346777_4347482_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4347499_4348066_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4348062_4348353_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174743.1|4348360_4348954_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239928.1|4348946_4350083_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4350399_4351386_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577033.1|4351430_4351934_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378946.1|4351933_4353235_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745217.1|4353290_4354298_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394125.1|4354414_4355461_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|4355636_4356356_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001107564.1|4356539_4356866_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4356865_4357585_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001297399.1|4357745_4358798_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4358825_4359101_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001298916.1|4359165_4360245_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4360446_4361703_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839757.1|4361752_4363888_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234514.1|4364285_4364993_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218873.1|4365371_4366634_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.3	1.2e-77
WP_073514705.1|4367793_4368315_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_001068910.1|4368311_4369265_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_073514706.1|4369351_4371676_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_000879157.1|4371720_4372623_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000125187.1|4372619_4373618_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000684859.1|4373614_4374571_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000177055.1|4375895_4376153_-	hypothetical protein	NA	NA	NA	NA	NA
4374692:4374706	attR	AAATCGACGCTGTTA	NA	NA	NA	NA
WP_088550849.1|4376235_4377404_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	2.6e-183
4374692:4374706	attR	AAATCGACGCTGTTA	NA	NA	NA	NA
WP_000024636.1|4378872_4379781_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000131689.1|4381047_4382076_+	gentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_000196044.1|4382091_4382793_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_000781202.1|4382801_4383446_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_000170152.1|4383460_4384654_+	3-hydroxybenzoate 6-monooxygenase	NA	NA	NA	NA	NA
WP_001134749.1|4385003_4385144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|4387325_4387706_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4387702_4388050_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_073514543.1|4388099_4389638_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_000271016.1|4390785_4391187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221499.1|4391445_4392015_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001373818.1|4392819_4393497_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_071529669.1|4395431_4395581_-	hemolysin activation protein	NA	NA	NA	NA	NA
WP_097760994.1|4395685_4396833_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	1.3e-147
WP_000632607.1|4397564_4397771_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000804452.1|4397857_4398460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297234.1|4398781_4400266_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001069675.1|4401489_4402362_+	GTPase family protein	NA	NA	NA	NA	NA
WP_073514709.1|4402734_4405854_+	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001378240.1|4405974_4408491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581504.1|4408566_4409022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001119729.1|4409100_4409334_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_001234620.1|4409433_4410252_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	2.0e-44
WP_000849569.1|4410306_4410792_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	2.6e-12
WP_001186726.1|4410807_4411284_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692311.1|4411346_4411568_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	44.4	3.2e-10
WP_001280948.1|4411730_4412099_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000854753.1|4412188_4412563_+	toxin	NA	NA	NA	NA	NA
WP_000777552.1|4412559_4413048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839281.1|4413059_4413257_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001290252.1|4413353_4413923_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_149025796.1|4413985_4414186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526745.1|4414258_4414447_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|4414457_4414670_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071776.1|4415033_4415531_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_001092971.1|4415527_4416061_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189918.1|4416057_4416369_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	62.6	5.0e-25
WP_000839587.1|4416373_4416589_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_073514710.1|4416779_4417493_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000592549.1|4417899_4418859_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_085947598.1|4419260_4420422_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_033557398.1|4420992_4421370_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	9.0e-53
WP_073514712.1|4421387_4422437_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.9	2.5e-113
WP_001325325.1|4422438_4422717_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	7.4e-12
WP_000813254.1|4423175_4423331_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001171554.1|4424006_4424387_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|4424383_4424731_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_073514543.1|4424780_4426319_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_001278661.1|4426429_4430062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029393093.1|4430461_4430884_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	86.3	1.5e-61
WP_000054502.1|4430924_4431914_-	hypothetical protein	NA	U5P0A0	Shigella_phage	63.6	1.9e-57
WP_000705353.1|4431894_4432416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|4432399_4432630_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448563.1|4432713_4433121_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379593.1|4433287_4433443_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171943.1|4433602_4433821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|4434388_4434577_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_073514714.1|4434857_4436165_+	exonuclease	NA	NA	NA	NA	NA
WP_187661458.1|4436216_4437429_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	100.0	2.9e-169
WP_073514716.1|4438714_4439005_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.6e-15
WP_001373818.1|4439004_4439682_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_033557429.1|4440944_4442225_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.1	1.9e-155
WP_001360138.1|4442244_4442355_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836054.1|4442412_4443432_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_001295394.1|4443443_4444658_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|4444863_4445190_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
4454706:4454722	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 11
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	4842895	4883376	5060525	tail,capsid,portal,terminase,head	Enterobacteria_phage(63.89%)	37	NA	NA
WP_073514733.1|4842895_4843165_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	96.6	6.0e-43
WP_073514734.1|4843166_4844471_-|tail	phage tail protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.1	6.5e-74
WP_073514735.1|4844535_4845135_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	99.0	1.2e-110
WP_122996001.1|4848678_4849281_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	4.0e-87
WP_073514737.1|4849967_4850666_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	4.7e-132
WP_073514738.1|4850665_4850995_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	1.0e-52
WP_073514739.1|4850991_4853571_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.5	0.0e+00
WP_000533431.1|4853551_4853965_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000479086.1|4853991_4854423_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_001143013.1|4854436_4855189_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000683071.1|4855196_4855592_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_073514740.1|4855588_4856164_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.3	1.7e-50
WP_001204544.1|4856178_4856532_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000201528.1|4856524_4856899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073514742.1|4858212_4860138_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_001349919.1|4860338_4861940_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.6	5.9e-311
WP_000123248.1|4861920_4863240_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_073514743.1|4863249_4863582_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	1.9e-54
WP_022645311.1|4863637_4864663_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	1.0e-191
WP_021514935.1|4864704_4865100_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	3.5e-55
WP_000752963.1|4865111_4865465_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	9.9e-62
WP_000975081.1|4865476_4866055_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683125.1|4866051_4866447_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.5	6.5e-70
WP_021514938.1|4866454_4867195_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	4.7e-130
WP_000479153.1|4867210_4867633_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|4867614_4868049_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_073514744.1|4868041_4870621_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	93.7	0.0e+00
WP_000847362.1|4870617_4870947_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	1.4e-57
WP_073514745.1|4870946_4871645_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	2.4e-131
WP_073514746.1|4871650_4872394_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.7	9.2e-142
WP_122996001.1|4872330_4872933_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.2	4.0e-87
WP_073514747.1|4872993_4876392_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.0	0.0e+00
WP_073514777.1|4877123_4879958_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	2.5e-54
WP_073514749.1|4879957_4880539_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	92.1	1.8e-100
WP_000652080.1|4881027_4881876_+	type III secretion system effector Cif	NA	A5LH49	Enterobacteria_phage	98.5	3.5e-153
WP_021351651.1|4881979_4882351_-	hypothetical protein	NA	K7PH54	Enterobacteria_phage	95.1	1.1e-58
WP_073514750.1|4882794_4883376_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	65.8	1.4e-65
>prophage 12
NZ_CP010134	Escherichia coli strain D1 chromosome, complete genome	5060525	4973732	5053604	5060525	lysis,transposase,terminase,portal,head,holin,integrase	Enterobacteria_phage(30.77%)	68	4974665:4974680	5021880:5021895
WP_073514755.1|4973732_4975352_+|transposase	ISL3-like element ISEc38 family transposase	transposase	NA	NA	NA	NA
4974665:4974680	attL	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_000813432.1|4976263_4976866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235214.1|4976959_4977166_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000221530.1|4978692_4979262_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270967.1|4979521_4979923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221623.1|4979910_4980318_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_000656344.1|4982632_4983667_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739825.1|4983669_4984635_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066367.1|4984691_4985450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|4987621_4988773_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001373818.1|4990567_4991245_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_000973176.1|4994849_4995395_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001326708.1|4995391_4996135_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001166160.1|4996146_4997226_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986321.1|4997287_4998223_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011462.1|4998680_4999598_+	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_001011008.1|4999699_5000650_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000943916.1|5000767_5002411_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532923.1|5003039_5003756_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|5004098_5005553_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378575.1|5005654_5006971_-	shikimate transporter	NA	NA	NA	NA	NA
WP_032170019.1|5008599_5015676_-	inverse autotransporter adhesin YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|5016165_5016963_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533628.1|5017198_5018224_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	2.9e-101
WP_000096342.1|5018223_5018427_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073514758.1|5018485_5020966_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	61.3	8.6e-59
WP_001083297.1|5021058_5021250_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|5021246_5021435_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001171942.1|5022002_5022221_-	hypothetical protein	NA	NA	NA	NA	NA
5021880:5021895	attR	TTTCAGGGAAATATCC	NA	NA	NA	NA
WP_000379669.1|5022380_5022536_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.5e-06
WP_000362155.1|5022803_5023223_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391946.1|5023323_5023605_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|5023588_5024014_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_088550849.1|5024078_5025247_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	99.0	2.6e-183
WP_073514759.1|5025338_5026409_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151226.1|5026449_5026872_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.8e-65
WP_000209148.1|5027221_5027440_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|5027441_5027705_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000967411.1|5028603_5028816_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.4e-26
WP_032175188.1|5028983_5029256_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.2e-12
WP_024173616.1|5029257_5030307_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	4.7e-107
WP_000904119.1|5030319_5030679_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	3.6e-35
WP_000640046.1|5030687_5031239_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.0	1.2e-66
WP_000917767.1|5031463_5031661_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935529.1|5031811_5032861_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	89.7	1.4e-183
WP_000871291.1|5033451_5033787_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001213059.1|5035054_5035237_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001373818.1|5035325_5036003_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	4.3e-21
WP_001346898.1|5037217_5037409_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000411813.1|5037984_5038191_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|5038195_5039185_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092861.1|5039227_5039761_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_000459345.1|5039920_5040058_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082561.1|5040059_5040527_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	2.8e-56
WP_000347012.1|5040877_5041015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|5041151_5041337_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|5041731_5042241_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_073514760.1|5042212_5044141_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.5e-260
WP_000258991.1|5044124_5044331_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	60.0	4.2e-12
WP_073514761.1|5044327_5045920_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	1.4e-184
WP_001253992.1|5045909_5047415_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	4.6e-100
WP_000256723.1|5047451_5047799_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001064889.1|5050456_5051146_-	antiterminator	NA	I6PDF8	Cronobacter_phage	50.6	9.6e-61
WP_001217464.1|5051142_5051502_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.3	2.0e-38
WP_001265301.1|5051514_5052564_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	1.6e-107
WP_001360223.1|5052565_5052844_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	6.3e-11
WP_000975572.1|5052910_5053174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967409.1|5053391_5053604_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.2e-25
>prophage 1
NZ_CP010135	Escherichia coli strain D1 plasmid A, complete sequence	91607	60324	90225	91607	tRNA,tail,head,capsid	Enterobacteria_phage(47.83%)	30	NA	NA
WP_001297484.1|60324_61431_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001297479.1|61466_62108_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|62111_63482_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265481.1|63649_64321_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735412.1|64320_65781_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001295435.1|65856_66978_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359438.1|67123_68353_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|68602_69739_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799400.1|69722_70586_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_023307902.1|70948_72310_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.6	2.8e-51
WP_000950789.1|72715_73696_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	48.6	8.0e-85
WP_001023432.1|73872_74142_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_001340979.1|74143_75457_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.3	1.1e-78
WP_001230532.1|75521_76121_-	Ail/Lom family outer membrane beta-barrel protein	NA	B6ETG5	Enterobacteria_phage	99.0	4.4e-110
WP_023307901.1|76187_79661_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|79794_80322_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_136148694.1|80512_81145_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	92.8	1.7e-104
WP_023307900.1|81090_81834_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.2	2.8e-146
WP_023307899.1|81844_82543_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	1.1e-131
WP_000847304.1|82542_82872_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_023307898.1|82868_85445_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.2	0.0e+00
WP_000533402.1|85425_85839_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|85865_86297_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_023307897.1|86315_87062_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683084.1|87069_87465_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	84.0	2.3e-59
WP_000974985.1|87461_87995_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.1	1.7e-57
WP_001204554.1|88010_88364_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_001299692.1|88356_88740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023307896.1|88791_89820_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	5.0e-114
WP_000256723.1|89877_90225_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
>prophage 1
NZ_CP010136	Escherichia coli strain D1 plasmid B, complete sequence	55203	28862	37737	55203		Enterobacteria_phage(42.86%)	11	NA	NA
WP_073514802.1|28862_29546_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	9.6e-29
WP_073514814.1|29622_29937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_106426746.1|30377_30716_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	67.0	3.9e-39
WP_000422702.1|30712_31138_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	100.0	6.8e-49
WP_001270421.1|31610_31898_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	48.4	5.8e-20
WP_001132895.1|31894_32146_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000402944.1|32319_32532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817642.1|32905_34111_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	89.4	5.6e-205
WP_000756329.1|34107_35070_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	68.2	1.0e-113
WP_032163448.1|36671_36977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073514802.1|37053_37737_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	9.6e-29
