The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	1145921	1159104	4527935		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1145921_1146683_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1146676_1147303_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1147442_1148582_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1148644_1149637_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1149730_1151095_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|1151183_1151960_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1151964_1152603_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1152599_1153862_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1153858_1154767_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1154962_1155730_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1155780_1156437_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_073510611.1|1156542_1159104_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	1763425	1772867	4527935		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|1763425_1764352_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1764356_1765088_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_073510731.1|1765068_1765176_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1765235_1765967_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1766188_1767874_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1767870_1768590_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1768636_1769107_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1769147_1769609_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_073510739.1|1769733_1771734_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.4	0.0e+00
WP_001333512.1|1771730_1772867_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 3
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	1863892	1871331	4527935		Enterobacteria_phage(28.57%)	7	NA	NA
WP_032180930.1|1863892_1865287_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.3	2.2e-19
WP_073510767.1|1865461_1866355_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	7.9e-47
WP_181654714.1|1866750_1867872_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.0	6.4e-30
WP_073510769.1|1867875_1868961_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	52.5	6.3e-99
WP_073510771.1|1868960_1869860_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.1	4.1e-27
WP_073510774.1|1869917_1870796_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.7e-107
WP_001559383.1|1870800_1871331_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.4	5.0e-49
>prophage 4
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	2295261	2361567	4527935	integrase,terminase,capsid,head,lysis,protease,portal,tail,transposase	Enterobacteria_phage(38.0%)	71	2302837:2302852	2330960:2330975
WP_073510896.1|2295261_2296083_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2296182_2296266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2296358_2296694_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2297090_2298344_-	MFS transporter	NA	NA	NA	NA	NA
WP_073510897.1|2298450_2299344_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2299478_2300699_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2300823_2301519_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2301471_2302764_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2302837:2302852	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2302922_2303537_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2303579_2304434_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_073510898.1|2304435_2305053_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.1	6.1e-75
WP_001340362.1|2305063_2307487_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_073510900.1|2307547_2309974_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	1.7e-213
WP_001300836.1|2310172_2310478_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2310585_2311296_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2311298_2311859_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2311893_2312235_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2312369_2312696_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2312901_2314116_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836066.1|2314127_2315147_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2315204_2315315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2315334_2316615_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|2316649_2316901_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_085947771.1|2318553_2319715_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000887486.1|2322557_2322770_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	3.9e-29
WP_000980999.1|2322986_2323238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012775982.1|2323304_2323583_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265274.1|2323584_2324634_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	58.2	3.0e-114
WP_001204787.1|2324651_2325029_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.5	1.8e-53
WP_001616188.1|2325184_2325709_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	52.9	1.3e-46
WP_000592549.1|2325901_2326861_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_073510901.1|2327267_2327981_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000839587.1|2328171_2328387_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_073510902.1|2328391_2328586_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	84.4	2.6e-24
WP_085947771.1|2328648_2329810_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001092971.1|2329960_2330494_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_001071769.1|2330490_2330988_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2330960:2330975	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2331351_2331564_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2331574_2331763_+	cold-shock protein	NA	NA	NA	NA	NA
WP_122134696.1|2331765_2331831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2331910_2332066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019606.1|2332237_2332411_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000373090.1|2332562_2332973_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_073510904.1|2333030_2333264_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	1.9e-21
WP_000453611.1|2333652_2334198_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	2.3e-94
WP_001027297.1|2334172_2336098_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000198149.1|2336094_2336301_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001316944.1|2336297_2337899_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.8	1.2e-311
WP_000123271.1|2337879_2339199_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	1.0e-231
WP_001299443.1|2339208_2339541_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_073510905.1|2339596_2340622_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	4.4e-187
WP_000158875.1|2340663_2341059_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000785282.1|2341070_2341424_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000975081.1|2341435_2342014_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000683129.1|2342010_2342406_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	8.5e-70
WP_001361512.1|2342413_2343154_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	96.7	5.7e-128
WP_000479193.1|2343169_2343592_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	85.7	2.2e-60
WP_000459457.1|2343573_2344008_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840337.1|2344000_2346580_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	95.1	0.0e+00
WP_001543782.1|2346576_2346906_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	7.3e-59
WP_001152624.1|2346905_2347604_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	5.6e-133
WP_000194780.1|2347609_2348353_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|2348289_2348922_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_073510908.1|2348982_2352381_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_001619152.1|2352447_2353047_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.8e-109
WP_073511192.1|2353111_2356135_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	U5N099	Enterobacteria_phage	81.4	2.1e-67
WP_073510910.1|2356134_2356710_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.3	7.7e-104
WP_000086527.1|2356807_2357398_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2357714_2357948_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2358016_2358130_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_073510914.1|2360106_2361567_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.1e-42
>prophage 5
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	2500914	2604593	4527935	terminase,lysis,tRNA,tail,transposase	Escherichia_phage(31.25%)	81	NA	NA
WP_000826416.1|2500914_2502123_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001261013.1|2502654_2503323_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_073510956.1|2503624_2504218_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001301046.1|2504214_2505207_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234042.1|2505330_2506311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000140873.1|2506302_2506842_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2506904_2507129_-	YdcH family protein	NA	NA	NA	NA	NA
WP_073510958.1|2507268_2508924_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_000013789.1|2509148_2510492_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414567.1|2510708_2511632_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2511669_2513310_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_085947770.1|2513688_2515057_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001320773.1|2515157_2515307_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731833.1|2515378_2515552_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2515796_2516327_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000115943.1|2517557_2518997_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2519193_2519994_-	YdcF family protein	NA	NA	NA	NA	NA
WP_073510960.1|2520265_2524168_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	1.7e-53
WP_073510962.1|2524368_2524974_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_000627368.1|2525027_2526344_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_073510964.1|2526333_2528028_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723099.1|2532888_2532954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001123464.1|2533057_2533648_-	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_000039887.1|2533629_2534580_-	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_073510966.1|2534680_2535994_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001206197.1|2536020_2537226_-	bifunctional 3-oxoadipyl-CoA/3-oxo-5,6-dehydrosuberyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000018413.1|2537225_2537648_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_000973360.1|2537637_2539065_-	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_073510970.1|2539066_2539855_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_001292353.1|2539854_2540622_-	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000206388.1|2540618_2541689_-	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001189201.1|2541696_2542194_-	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001072837.1|2542208_2542955_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_000073393.1|2542963_2543251_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_000191077.1|2543262_2544192_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_001186469.1|2544476_2546522_+	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000535469.1|2546769_2549043_+	primary-amine oxidase	NA	NA	NA	NA	NA
WP_073510972.1|2549100_2550600_-	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_073510974.1|2550835_2551741_+	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001300734.1|2551912_2552239_-	YdbL family protein	NA	NA	NA	NA	NA
WP_000698145.1|2552246_2552432_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_073510975.1|2552428_2555068_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762236.1|2555275_2556265_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_001298828.1|2556375_2556798_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|2556794_2557061_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_000628243.1|2557334_2560859_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837921.1|2561224_2562358_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_001300461.1|2562498_2562933_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000286865.1|2563517_2564432_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000983718.1|2564431_2565259_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|2565255_2566113_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|2566109_2566967_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_032252927.1|2567422_2568754_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.1e-20
WP_032345642.1|2568827_2569412_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	7.8e-104
WP_073510976.1|2569411_2572765_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001619152.1|2572829_2573429_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	2.8e-109
WP_073510908.1|2573495_2576894_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.4	0.0e+00
WP_000090943.1|2576954_2577557_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	84.7	4.0e-87
WP_032155200.1|2577493_2578237_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	1.4e-145
WP_001152432.1|2578242_2578941_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_000024051.1|2578940_2579279_-|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_073510977.1|2579271_2582505_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	5.1e-112
WP_032155199.1|2582635_2582869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012565075.1|2582976_2583336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089642800.1|2584543_2584720_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	60.7	1.4e-11
WP_000918483.1|2584762_2585902_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	3.3e-159
WP_000770038.1|2586000_2586765_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
WP_001317036.1|2586869_2587982_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000625347.1|2590151_2591453_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_073510982.1|2591433_2592528_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	5.0e-112
WP_187650993.1|2592531_2592783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204037.1|2592718_2593651_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_001291094.1|2593643_2594435_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001097895.1|2594572_2596030_-	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001228688.1|2596226_2596412_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_000839565.1|2598192_2598408_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.3e-32
WP_001348108.1|2598659_2599034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000506936.1|2599205_2599634_-	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_000640161.1|2600678_2601221_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	75.7	2.9e-76
WP_000247763.1|2601217_2601508_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	3.7e-46
WP_001157406.1|2603657_2604593_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
>prophage 6
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	3680105	3733011	4527935	holin,portal,integrase,terminase,capsid,head,protease,lysis,plate,tail,transposase	Shigella_phage(58.82%)	65	3681485:3681532	3718556:3718603
WP_073511090.1|3680105_3681320_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.5	9.7e-133
3681485:3681532	attL	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_073511092.1|3682105_3683137_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_073511093.1|3683309_3684458_+	acyltransferase	NA	A0A088CPR9	Enterobacteria_phage	72.4	3.0e-152
WP_073511094.1|3684737_3685349_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	84.0	7.2e-92
WP_073511095.1|3685348_3686137_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	93.5	5.1e-50
WP_073511096.1|3686140_3686725_-	YmfQ family protein	NA	O22003	Shigella_phage	99.5	7.0e-113
WP_073511097.1|3686715_3687774_-|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	98.9	7.3e-201
WP_000424737.1|3687760_3688186_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	99.3	6.7e-81
WP_000643722.1|3688185_3688734_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	96.2	1.8e-94
WP_073511098.1|3688733_3689813_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	1.0e-205
WP_149025920.1|3689809_3691138_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	1.9e-246
WP_073511100.1|3691198_3693034_-|tail	phage tail tape measure protein	tail	S5FM63	Shigella_phage	99.3	1.7e-306
WP_000661051.1|3693175_3693445_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|3693444_3693801_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_073511101.1|3693800_3695297_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	S5FKL0	Shigella_phage	98.0	1.1e-274
WP_000497751.1|3695280_3695451_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779294.1|3695459_3696020_-	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000224835.1|3696016_3696523_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000702392.1|3696497_3696908_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	92.6	2.4e-67
WP_000924829.1|3696904_3697228_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	99.1	1.7e-52
WP_000766098.1|3697306_3698536_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.8	1.5e-226
WP_064503058.1|3698546_3699149_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	99.5	3.4e-110
WP_000923135.1|3699141_3700368_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	99.8	3.4e-242
WP_000838376.1|3700357_3700519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096859749.1|3700515_3702012_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	98.8	1.1e-290
WP_000929184.1|3702245_3702740_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	100.0	2.3e-88
WP_032257815.1|3702866_3703217_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	96.6	2.3e-63
WP_000738423.1|3703742_3704036_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|3704126_3704309_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001546526.1|3704525_3705002_-	glycoside hydrolase family protein	NA	K7P7P0	Enterobacteria_phage	96.2	5.0e-85
WP_001120497.1|3705005_3705332_-|holin	phage holin, lambda family	holin	S5FM86	Shigella_phage	99.1	1.5e-56
WP_024225789.1|3705624_3705888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024225790.1|3705884_3706625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032141727.1|3706651_3706993_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	86.7	6.0e-56
WP_073511102.1|3707010_3708000_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	3.1e-193
WP_073511103.1|3708007_3708817_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	99.3	1.5e-150
WP_000767113.1|3708836_3709226_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210171.1|3709222_3709549_-	LexA family transcriptional regulator	NA	Q8SBE8	Shigella_phage	99.1	9.2e-54
WP_001433188.1|3709545_3710199_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	5.6e-127
WP_073511104.1|3710198_3710693_-	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.8	4.3e-87
WP_000104954.1|3710689_3711631_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	4.3e-144
WP_023148278.1|3711620_3711800_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	66.7	3.9e-14
WP_000515830.1|3711975_3712527_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|3712570_3712771_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3712861_3713536_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000159356.1|3713948_3714140_-	hypothetical protein	NA	S5FM78	Shigella_phage	100.0	3.3e-27
WP_000135680.1|3714578_3714941_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_073511105.1|3715006_3715831_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	5.0e-149
WP_000008200.1|3715958_3716495_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3716485_3716848_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_021548941.1|3716847_3717153_+	hypothetical protein	NA	U5P0J0	Shigella_phage	98.0	9.8e-50
WP_073511106.1|3717379_3718543_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.5	3.5e-228
WP_000893278.1|3718747_3720001_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3718556:3718603	attR	AATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3720012_3721116_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3721403_3722459_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_000174677.1|3722497_3722899_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189541.1|3722956_3724201_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|3724292_3724751_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293003.1|3725011_3726469_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001059847.1|3727494_3727947_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263493.1|3727956_3728355_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|3728357_3728651_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226164.1|3728702_3729758_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207549.1|3729828_3730614_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_000006261.1|3732513_3733011_-|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP010129	Escherichia coli strain C9 chromosome, complete genome	4527935	4100571	4161654	4527935	protease,transposase	Klosneuvirus(11.11%)	58	NA	NA
WP_001162165.1|4100571_4101924_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4102017_4102569_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4102651_4104025_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|4104200_4105199_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595979.1|4105231_4106227_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001353963.1|4106213_4107236_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000210557.1|4107249_4108752_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265933.1|4108891_4109848_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|4110157_4110688_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|4110764_4111115_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|4111108_4111360_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4111571_4111913_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_040064550.1|4111915_4115695_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4115691_4117425_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001305659.1|4117630_4118269_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935042.1|4118591_4119935_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4119996_4120203_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175310.1|4120527_4121082_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_073511150.1|4123643_4124042_+	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_073511151.1|4124862_4125987_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.3	5.7e-79
WP_001491463.1|4126070_4127696_+	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000811566.1|4127812_4128088_-|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000254636.1|4128236_4128566_-	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000569691.1|4128747_4129497_+	esterase	NA	NA	NA	NA	NA
WP_000133631.1|4129493_4130249_-	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_001299242.1|4130356_4131421_-	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_001350568.1|4131775_4133173_+	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000218360.1|4133188_4133494_+	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_073511152.1|4133503_4133968_+	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000056760.1|4133981_4134632_+	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000949511.1|4134641_4135496_+	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_001170830.1|4135495_4136182_+	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000985137.1|4136276_4136828_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_000492914.1|4136902_4137178_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001216676.1|4137504_4137900_+	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001296681.1|4137906_4138221_+	primosomal replication protein N	NA	NA	NA	NA	NA
WP_000135199.1|4138225_4138453_+	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001196062.1|4138494_4138944_+	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_001491466.1|4139014_4139809_-	DUF2686 family protein	NA	NA	NA	NA	NA
WP_044697636.1|4140249_4140864_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	4.7e-43
WP_061128813.1|4140871_4142080_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.5	1.4e-208
WP_001119458.1|4142214_4142853_-	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000211239.1|4143071_4143692_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_000228346.1|4144000_4145413_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000331456.1|4145457_4146120_-	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_001295194.1|4146227_4147193_-	DMT family transporter	NA	NA	NA	NA	NA
WP_000560597.1|4147301_4148162_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000084622.1|4148250_4148631_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000886909.1|4150886_4151627_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_001339197.1|4152052_4153261_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000511955.1|4153702_4154401_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4154419_4154821_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4154947_4155679_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076335.1|4155858_4158300_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4158338_4158764_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4158968_4160267_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4160370_4160568_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4160649_4161654_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 1
NZ_CP010130	Escherichia coli strain C9 plasmid A, complete sequence	93062	84110	93010	93062	transposase,integrase	Escherichia_phage(37.5%)	12	80937:80951	91942:91956
80937:80951	attL	GACAGCCAGAAACGG	NA	NA	NA	NA
WP_000086147.1|84110_84794_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.4	1.1e-29
WP_032072582.1|84870_85182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072748701.1|85178_86081_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|86498_86747_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|86743_87181_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457523.1|87180_88452_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.9e-142
WP_000340829.1|88456_88849_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103690.1|88853_89825_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|90053_90698_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|90691_90967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372173.1|91104_91887_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.4e-52
WP_001067855.1|92305_93010_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
91942:91956	attR	CCGTTTCTGGCTGTC	NA	NA	NA	NA
>prophage 1
NZ_CP010131	Escherichia coli strain C9 plasmid B, complete sequence	56460	2219	17525	56460	transposase,integrase	Escherichia_phage(56.25%)	20	1602:1614	6457:6469
1602:1614	attL	CCACCAGCATTGC	NA	NA	NA	NA
WP_048659775.1|2219_3248_+|integrase	tyrosine-type recombinase/integrase	integrase	Q5XLQ5	Enterobacteria_phage	42.1	1.1e-60
WP_004010537.1|3320_3665_+	hypothetical protein	NA	A0A222YYS6	Escherichia_phage	78.9	3.1e-44
WP_004010538.1|3661_4153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048659776.1|4145_4640_+	dUTP diphosphatase	NA	A0A222YYP1	Escherichia_phage	88.4	1.5e-79
WP_001743161.1|4653_5454_+	hypothetical protein	NA	A0A222YXM9	Escherichia_phage	71.1	9.4e-92
WP_024166788.1|5537_5918_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	90.3	1.8e-56
WP_001190712.1|5917_6139_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_000506718.1|6211_6604_-	hypothetical protein	NA	Q1MVE7	Enterobacteria_phage	76.2	2.1e-52
6457:6469	attR	CCACCAGCATTGC	NA	NA	NA	NA
WP_001286530.1|6715_6964_-	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	85.4	2.8e-31
WP_001408980.1|6966_7167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048659784.1|7589_7787_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	57.7	1.9e-09
WP_000957857.1|8518_8707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|8716_9916_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001711179.1|10264_10543_+	hypothetical protein	NA	J9Q7T9	Salmonella_phage	92.4	2.1e-38
WP_024172705.1|10602_11025_+	hypothetical protein	NA	J9Q806	Salmonella_phage	92.9	4.2e-67
WP_032216024.1|12126_13107_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	3.0e-185
WP_001281116.1|13387_13780_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	99.2	2.0e-71
WP_021546926.1|14097_14958_+	replication protein RepA	NA	Q71TL8	Escherichia_phage	99.7	1.4e-157
WP_000817632.1|15357_16563_+	AAA family ATPase	NA	Q1MVJ3	Enterobacteria_phage	100.0	2.0e-226
WP_000725192.1|16559_17525_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	100.0	3.3e-168
