The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010125	Escherichia coli strain C8 chromosome, complete genome	4901865	1027208	1094145	4901865	tRNA,lysis,terminase,integrase,transposase,capsid,portal,tail,head,protease	Enterobacteria_phage(59.32%)	78	1037369:1037415	1085619:1085665
WP_000912345.1|1027208_1028594_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143552.1|1028629_1029151_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1029258_1029471_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729154.1|1029472_1030339_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1030819_1031362_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_071665947.1|1031581_1032274_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000691050.1|1034925_1035933_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001250422.1|1035943_1036459_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|1036461_1037094_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
1037369:1037415	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001406354.1|1037428_1038592_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	4.4e-199
WP_000488407.1|1038790_1039069_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_000763384.1|1039125_1039335_-	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	4.4e-33
WP_001443983.1|1039433_1039715_-	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	7.2e-47
WP_000548537.1|1039725_1039917_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000149544.1|1039889_1040072_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000611716.1|1040068_1040749_-	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000100841.1|1040745_1041531_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000995452.1|1041536_1041833_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	2.3e-48
WP_000233579.1|1041910_1042117_-	hypothetical protein	NA	K7PM31	Enterobacteria_phage	83.8	7.1e-28
WP_001444023.1|1042666_1042987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000066829.1|1043122_1043386_-	hypothetical protein	NA	A0A2H4FNC7	Salmonella_phage	95.4	4.2e-41
WP_001295669.1|1043468_1044161_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	1.5e-109
WP_000184665.1|1044271_1044499_+	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_073533431.1|1044529_1045069_+	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	7.5e-61
WP_077899781.1|1045065_1046085_+	replication protein	NA	M1FN81	Enterobacteria_phage	68.0	1.8e-111
WP_000788820.1|1046081_1046783_+	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	98.3	2.7e-127
WP_000145944.1|1046779_1047073_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	90.3	1.0e-40
WP_000062289.1|1047069_1047270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096891597.1|1047287_1047497_+	hypothetical protein	NA	A0A0F6TK62	Escherichia_coli_O157_typing_phage	79.7	4.7e-27
WP_050487536.1|1047903_1048710_+	hypothetical protein	NA	M9NZE4	Enterobacteria_phage	28.9	6.5e-16
WP_000017329.1|1049005_1049515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303586.1|1049604_1049706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054342.1|1049702_1050158_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_000224916.1|1050157_1050328_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_073533433.1|1050320_1050611_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	2.1e-46
WP_001099712.1|1050607_1050970_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971068.1|1050966_1051107_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001204791.1|1051192_1051576_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000737275.1|1051764_1052847_-	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_000839596.1|1053436_1053652_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135277.1|1053651_1054149_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1054365_1054548_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_000738421.1|1054638_1054932_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001307652.1|1055291_1055486_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_000453587.1|1055875_1056421_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001027269.1|1056395_1058321_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1058317_1058524_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_073533441.1|1058520_1060122_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000123305.1|1060102_1061422_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	99.3	2.5e-235
WP_001299443.1|1061431_1061764_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_073533443.1|1061819_1062845_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.4	5.2e-188
WP_073533445.1|1062886_1063282_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	2.6e-58
WP_000752960.1|1063293_1063647_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	7.6e-62
WP_000985132.1|1063658_1064237_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|1064233_1064629_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_047656713.1|1064636_1065377_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.6e-130
WP_000479155.1|1065392_1065815_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	99.3	1.9e-72
WP_000459457.1|1065796_1066231_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_044861873.1|1066223_1068785_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	90.3	0.0e+00
WP_000847345.1|1068781_1069111_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_073533456.1|1069110_1069809_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_044861875.1|1069813_1070557_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.1	1.8e-142
WP_000090857.1|1070493_1071126_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	5.0e-96
WP_073533458.1|1071186_1074684_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	97.3	0.0e+00
WP_001233090.1|1074754_1075354_+	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_001561581.1|1075418_1078445_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001354832.1|1079352_1079928_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	7.9e-101
WP_000087131.1|1080025_1080616_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.3	4.7e-24
WP_000836765.1|1080934_1081168_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_120795384.1|1081236_1081350_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000239872.1|1081715_1082384_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000386784.1|1083243_1083993_+	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_001201857.1|1084242_1085196_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_073533460.1|1085708_1086470_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
1085619:1085665	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001224569.1|1086652_1087543_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_073533462.1|1087543_1090516_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_000383951.1|1090502_1092740_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000420923.1|1093008_1094145_-|transposase	ISAs1-like element ISEc1 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP010125	Escherichia coli strain C8 chromosome, complete genome	4901865	1798898	1861677	4901865	terminase,integrase,capsid,portal,tail,head,protease,plate,holin	Enterobacteria_phage(27.91%)	73	1795642:1795655	1829806:1829819
1795642:1795655	attL	GTCCGGCATCACCG	NA	NA	NA	NA
WP_000113656.1|1798898_1800029_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	5.7e-103
WP_000113184.1|1800006_1800255_-	excisionase	NA	NA	NA	NA	NA
WP_073533562.1|1800318_1802790_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.5	1.6e-57
WP_001090191.1|1802870_1803074_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_049595150.1|1803076_1803259_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_157905264.1|1803887_1804091_+	DUF2622 domain-containing protein	NA	NA	NA	NA	NA
WP_167778740.1|1804087_1804234_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	82.5	4.3e-11
WP_000447543.1|1804235_1804391_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	6.1e-08
WP_073534244.1|1804664_1805381_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	41.6	3.2e-51
WP_073533564.1|1805430_1805646_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_073533565.1|1806137_1806944_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	89.4	1.5e-65
WP_049595159.1|1806950_1807697_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	82.9	1.1e-113
WP_049595160.1|1807719_1808466_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	86.4	1.9e-102
WP_049595212.1|1808504_1808786_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	63.4	3.1e-26
WP_049595161.1|1808782_1809088_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.0	1.7e-49
WP_073533567.1|1809074_1809530_+	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	48.6	3.9e-34
WP_049595163.1|1809625_1809808_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	91.7	1.1e-24
WP_049595164.1|1810017_1810617_+	ead/Ea22-like family protein	NA	K7P881	Enterobacteria_phage	68.4	9.3e-28
WP_000813254.1|1811653_1811809_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_064757999.1|1811905_1812238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049595214.1|1812424_1812697_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	4.7e-11
WP_049595167.1|1812698_1813748_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.0	7.9e-107
WP_049595168.1|1813760_1814132_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.4e-34
WP_077793029.1|1814121_1814493_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.7	8.8e-53
WP_073533568.1|1814643_1815462_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_073533569.1|1816088_1817135_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	89.9	1.3e-186
WP_001362368.1|1818634_1819027_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	86.2	8.2e-49
WP_000950574.1|1819016_1819292_+|holin	phage holin family protein	holin	Q9MBZ4	Enterobacteria_phage	96.7	2.8e-43
WP_049595171.1|1819294_1819672_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	99.2	3.5e-65
WP_137466182.1|1819686_1819869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533570.1|1820042_1820339_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	94.9	2.8e-49
WP_063079834.1|1820398_1821064_+	hypothetical protein	NA	G8EY51	Synechococcus_phage	30.2	4.5e-07
WP_063079836.1|1821824_1822442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533573.1|1822395_1824375_+|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.1	3.8e-134
WP_073533575.1|1824371_1824623_+|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_073533576.1|1824631_1826272_+|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	37.2	3.5e-93
WP_001072415.1|1826268_1827129_+	S49 family peptidase	NA	A0A1I9KF73	Aeromonas_phage	37.2	1.1e-48
WP_073533578.1|1827121_1827703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063079841.1|1827699_1828101_+|head	head decoration protein	head	NA	NA	NA	NA
WP_001290410.1|1828156_1829212_+|capsid	major capsid protein	capsid	A0A2D1GMR5	Marinobacter_phage	31.5	9.6e-36
WP_000146203.1|1829213_1829399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918573.1|1829382_1829715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090179.1|1829714_1830275_+	hypothetical protein	NA	NA	NA	NA	NA
1829806:1829819	attR	CGGTGATGCCGGAC	NA	NA	NA	NA
WP_000497760.1|1830288_1830525_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_049595178.1|1830521_1832024_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.1	6.9e-104
WP_049595179.1|1832063_1832429_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_049595180.1|1832431_1832710_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_073533582.1|1832845_1834804_+	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	42.1	3.6e-20
WP_063079844.1|1834814_1836221_+	DNA circularization protein	NA	J7FAD8	Agrobacterium_phage	33.0	4.0e-05
WP_049595183.1|1836217_1837306_+	hypothetical protein	NA	Q8SBG7	Shigella_phage	31.7	7.3e-39
WP_073533584.1|1837302_1837884_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	33.3	1.6e-16
WP_049595185.1|1837885_1838323_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	41.6	4.3e-22
WP_063079846.1|1838324_1839479_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	32.2	6.4e-33
WP_073533586.1|1839487_1843819_+	leucine-rich repeat protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	32.0	8.6e-14
WP_073533587.1|1843865_1844657_+|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	55.8	2.6e-17
WP_049595189.1|1844666_1845206_+|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	41.3	5.6e-32
WP_049595190.1|1845425_1846226_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_073533589.1|1846843_1847407_-	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	71.2	3.8e-47
WP_001079504.1|1848050_1848557_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|1848602_1849103_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|1849188_1849368_-	general stress protein	NA	NA	NA	NA	NA
WP_073533590.1|1849748_1850555_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209520.1|1850554_1851748_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_073533592.1|1851759_1853121_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	1.1e-36
WP_000763511.1|1853121_1854717_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194590.1|1854716_1856279_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1856369_1856414_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285661.1|1856551_1857433_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1857429_1858050_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001291216.1|1858150_1859023_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278904.1|1859062_1859653_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559280.1|1859649_1860408_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	25.0	1.5e-06
WP_000422045.1|1860627_1861677_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 3
NZ_CP010125	Escherichia coli strain C8 chromosome, complete genome	4901865	1938085	1991083	4901865	tRNA,terminase,integrase,tail,holin	Escherichia_phage(54.35%)	58	1932469:1932485	1972611:1972627
1932469:1932485	attL	GATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001307164.1|1938085_1939318_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1939572_1940556_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001296046.1|1940830_1941004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533604.1|1941033_1942407_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157407.1|1942535_1943471_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1943522_1944758_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1944759_1944975_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_021565074.1|1945053_1945263_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	96.8	8.8e-26
WP_001317028.1|1945255_1945450_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_073533605.1|1945506_1946316_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	1.3e-104
WP_000632297.1|1949009_1949285_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_077899810.1|1949359_1949530_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	69.6	1.4e-16
WP_000560223.1|1949529_1949751_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001324055.1|1950192_1950681_+	superinfection exclusion B family protein	NA	NA	NA	NA	NA
WP_001169151.1|1950677_1950833_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1950843_1951023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1951265_1951685_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1951764_1952019_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1952015_1952438_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|1952515_1953304_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_000788970.1|1953310_1954057_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_073533608.1|1954079_1954802_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.3	4.3e-112
WP_040091718.1|1954856_1955261_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	2.1e-63
WP_073533610.1|1958487_1959087_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.3e-106
WP_073533612.1|1959086_1959377_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	1.6e-46
WP_073533613.1|1959373_1959916_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.6	1.9e-75
WP_001314667.1|1961194_1961425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533614.1|1961421_1961934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000839585.1|1962150_1962366_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	97.2	9.0e-34
WP_073533616.1|1962370_1962715_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	89.3	2.6e-35
WP_001390122.1|1962680_1962953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073533617.1|1963058_1963592_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.1	1.0e-94
WP_077899786.1|1963808_1963994_+	hypothetical protein	NA	K7PHU6	Enterobacteria_phage	78.9	3.4e-13
WP_073533620.1|1964190_1965648_+	Trk system potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001614533.1|1965785_1966574_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.7	9.7e-49
WP_073533622.1|1966566_1967499_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	53.8	1.3e-81
WP_000613571.1|1967434_1967686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533624.1|1967689_1968784_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	79.8	1.7e-112
WP_000625347.1|1968764_1970066_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.8	8.0e-149
WP_000763709.1|1970068_1971475_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_073533626.1|1971458_1972571_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	55.1	1.2e-113
WP_000770037.1|1972675_1973440_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
1972611:1972627	attR	TTTTTATTGCTGCGATC	NA	NA	NA	NA
WP_000918487.1|1973538_1974678_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|1974720_1974897_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|1974900_1975296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|1975295_1975679_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_073533628.1|1975679_1976060_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	43.6	1.9e-18
WP_000673077.1|1976056_1976449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533630.1|1976475_1977438_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.3	1.7e-55
WP_012565075.1|1977588_1977948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073533632.1|1978421_1981655_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.6	3.9e-112
WP_000024051.1|1981647_1981986_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001774438.1|1981985_1982684_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	1.1e-128
WP_073533634.1|1982689_1983433_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	4.5e-149
WP_073533636.1|1983330_1983978_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	90.2	7.1e-106
WP_073533637.1|1984038_1987437_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.0	0.0e+00
WP_073533644.1|1987503_1988103_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.5	8.8e-111
WP_073534247.1|1988167_1991083_+|tail	phage tail protein	tail	A0A2D1UII2	Escherichia_phage	98.3	1.0e-58
>prophage 4
NZ_CP010125	Escherichia coli strain C8 chromosome, complete genome	4901865	2554646	2663650	4901865	terminase,integrase,transposase,capsid,portal,tail,head,protease,holin	Escherichia_phage(39.22%)	104	2555451:2555466	2672137:2672152
WP_000826451.1|2554646_2555810_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	8.9e-200
2555451:2555466	attL	GAGCTTAACGCCCTGC	NA	NA	NA	NA
WP_000879833.1|2557198_2557996_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000734031.1|2558005_2558557_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001274292.1|2559391_2559706_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994405.1|2559920_2561579_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|2561571_2562567_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282700.1|2562559_2563246_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213311.1|2563245_2564619_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|2564637_2565081_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620094.1|2565077_2566205_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|2566309_2566774_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|2566778_2567783_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282098.1|2567779_2568193_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001348482.1|2568195_2568561_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253441.1|2568560_2569298_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187359.1|2569307_2569577_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000942316.1|2569584_2570370_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103987.1|2570659_2571283_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000867217.1|2571326_2571515_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|2571677_2571905_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491504.1|2572202_2573021_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001597912.1|2573017_2574712_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|2574882_2575065_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922682.1|2575143_2576061_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212238.1|2576233_2577154_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786004.1|2577142_2577613_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	1.5e-33
WP_001157239.1|2577593_2579012_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000365561.1|2579078_2579774_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|2579813_2580179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824362.1|2580745_2581819_+	porin	NA	Q1MVN1	Enterobacteria_phage	51.6	6.2e-99
WP_000218209.1|2582411_2583263_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826746.1|2583370_2584729_-	two-component system sensor histidine kinase HprS	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.5	8.7e-05
WP_001362894.1|2584728_2585400_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.6	3.1e-32
WP_000920127.1|2585532_2585946_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740094.1|2586054_2587059_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240091.1|2587059_2587695_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001007756.1|2587951_2588602_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001079074.1|2588944_2589475_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_073533751.1|2591145_2594760_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	K7PGT9	Enterobacteria_phage	87.0	0.0e+00
WP_073533753.1|2594824_2595424_-	Ail/Lom family outer membrane beta-barrel protein	NA	K7PJP9	Enterobacteria_phage	97.5	3.7e-109
WP_073533755.1|2595494_2598908_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.8	0.0e+00
WP_032146366.1|2598968_2599616_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	9.5e-111
WP_073533756.1|2599513_2600257_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_073533758.1|2600261_2600960_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.7	1.7e-129
WP_001330090.1|2600959_2601316_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_073533760.1|2601293_2604533_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	96.8	0.0e+00
WP_000394908.1|2604581_2604923_-	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	67.3	2.6e-35
WP_000978929.1|2604980_2605259_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	89.1	4.2e-39
WP_000164661.1|2605282_2605654_-|tail	phage tail assembly chaperone	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_021537293.1|2605668_2606373_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	99.1	2.5e-120
WP_001209399.1|2606433_2606778_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000347790.1|2606774_2607221_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001147820.1|2607220_2607559_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_073533767.1|2607567_2607873_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	99.0	2.1e-39
WP_000601355.1|2607884_2608073_-	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_073533769.1|2608123_2609329_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	98.8	2.2e-222
WP_001193631.1|2609343_2609994_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466247.1|2609971_2611213_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_000478567.1|2611212_2611395_-	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_001140902.1|2611406_2613164_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_001317918.1|2613163_2613646_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140099.1|2613794_2614145_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_000671993.1|2614152_2614353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001114684.1|2614597_2615083_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_077899788.1|2615323_2615509_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	82.0	2.2e-20
WP_001274714.1|2615725_2616259_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_000193292.1|2616314_2616629_-	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_000839572.1|2616633_2616849_-|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064894.1|2617645_2618335_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_073533770.1|2618331_2618697_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_073533771.1|2618697_2619753_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.8	1.3e-88
WP_073533772.1|2619754_2620033_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	2.2e-11
WP_001357494.1|2620099_2620360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2620580_2620793_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_149026004.1|2621074_2621806_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001443694.1|2622531_2622696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073533773.1|2622692_2623439_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.6	8.4e-111
WP_159065192.1|2623473_2623935_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	2.9e-85
WP_149026005.1|2623927_2624968_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	84.6	6.9e-87
WP_000705383.1|2624939_2625491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912294.1|2625474_2625702_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2625778_2626186_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000379557.1|2626393_2626549_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171947.1|2626708_2626927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2627494_2627683_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|2627679_2627871_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073534252.1|2627963_2630435_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096344.1|2630493_2630697_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_073533775.1|2630696_2631722_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	5.8e-102
WP_001392298.1|2631957_2632755_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000041053.1|2635749_2636634_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_157900909.1|2636856_2637006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000246269.1|2637721_2638183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073533777.1|2638701_2642892_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.3	1.7e-22
WP_000036084.1|2642879_2643272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149026006.1|2643915_2651898_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_073533779.1|2652159_2653212_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_073533781.1|2653526_2654843_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2654944_2656399_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532912.1|2656741_2657458_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001700809.1|2658093_2659737_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_073533783.1|2659854_2660805_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011461.1|2660906_2661824_-	nitrogen assimilation transcriptional regulator NAC	NA	NA	NA	NA	NA
WP_000059622.1|2662387_2663650_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	39.0	1.1e-73
2672137:2672152	attR	GAGCTTAACGCCCTGC	NA	NA	NA	NA
>prophage 5
NZ_CP010125	Escherichia coli strain C8 chromosome, complete genome	4901865	2873169	2882610	4901865		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000040703.1|2873169_2874306_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
WP_001296829.1|2874302_2876303_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|2876427_2876889_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950409.1|2876928_2877399_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_000598641.1|2877445_2878165_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2878161_2879847_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240401.1|2880068_2880800_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001216963.1|2880859_2880967_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2880947_2881679_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569325.1|2881683_2882610_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.0e-08
>prophage 6
NZ_CP010125	Escherichia coli strain C8 chromosome, complete genome	4901865	3478683	3491866	4901865		Escherichia_phage(50.0%)	12	NA	NA
WP_001272924.1|3478683_3481245_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_073533972.1|3481350_3482007_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	1.4e-48
WP_001297141.1|3482057_3482825_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_000847985.1|3483020_3483929_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_000590392.1|3483925_3485188_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3485184_3485823_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136918.1|3485827_3486604_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104456.1|3486692_3488057_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3488150_3489143_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272592.1|3489205_3490345_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3490484_3491111_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3491104_3491866_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 1
NZ_CP010126	Escherichia coli strain C8 plasmid A, complete sequence	143617	9095	70406	143617	holin,integrase,transposase,bacteriocin	Stx2-converting_phage(27.27%)	49	15438:15460	75994:76016
WP_148713380.1|9095_9389_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	2.5e-34
WP_000612591.1|9473_9821_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_073534267.1|9870_11277_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	90.8	2.1e-264
WP_073534268.1|12433_13621_+	peptide antibiotic transporter SbmA	NA	NA	NA	NA	NA
WP_073534269.1|14226_15135_+	DMT family transporter	NA	NA	NA	NA	NA
15438:15460	attL	GTGTCAGCGCCAGTGATATAAGA	NA	NA	NA	NA
WP_073534273.1|17928_18309_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_073534277.1|21149_22259_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.6	1.2e-116
WP_073534278.1|22420_23188_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_073534354.1|23609_23846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073534279.1|24388_25792_-|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_073534280.1|27744_31242_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	34.9	1.2e-98
WP_073534282.1|32479_34015_+|bacteriocin	pore-forming bacteriocin colicin B	bacteriocin	NA	NA	NA	NA
WP_000203274.1|34032_34560_-	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001382745.1|34805_35621_+|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000864816.1|35670_36024_-	colicin M immunity protein	NA	NA	NA	NA	NA
WP_000016972.1|36196_37006_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	97.3	1.2e-54
WP_001159873.1|37006_37312_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813639.1|37313_37532_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001261277.1|38125_38356_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_077899813.1|38352_38769_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_073534286.1|40347_40758_-	subtilase cytotoxin subunit B-like protein	NA	NA	NA	NA	NA
WP_073534356.1|40867_41593_-	pertussis toxin-like subunit ArtA	NA	A0A0U2KD26	Escherichia_phage	66.4	3.2e-83
WP_149026017.1|41993_43171_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	97.4	3.5e-180
WP_149026018.1|43232_44380_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	93.0	7.8e-148
WP_073534291.1|44856_45615_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_073534292.1|45995_46787_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_149026019.1|48127_49411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149026020.1|49424_49940_-	fimbrial protein	NA	NA	NA	NA	NA
WP_073534295.1|49930_50617_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001239411.1|50607_53115_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000665199.1|53143_53587_-	molecular chaperone	NA	NA	NA	NA	NA
WP_073534296.1|53567_54272_-	molecular chaperone	NA	NA	NA	NA	NA
WP_073534297.1|54330_54930_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_073534298.1|55236_56013_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077899815.1|56177_56297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073534299.1|56565_57375_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_073534300.1|57853_58594_+|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361610.1|58878_59856_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001045099.1|60944_61472_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_073534301.1|61547_62135_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_073534302.1|62255_64766_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_073534303.1|64834_65566_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_019842693.1|65602_66118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187658841.1|66149_66659_+	fimbrial protein	NA	NA	NA	NA	NA
WP_073534304.1|66686_67679_+	nuclease PIN	NA	NA	NA	NA	NA
WP_000845366.1|68345_68663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467268.1|69247_69496_+	DUF883 family protein	NA	NA	NA	NA	NA
WP_000990989.1|69567_69921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001258981.1|70004_70406_+|holin	phage holin family protein	holin	NA	NA	NA	NA
75994:76016	attR	TCTTATATCACTGGCGCTGACAC	NA	NA	NA	NA
