The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	356220	416405	5333488	portal,capsid,protease,terminase,transposase,head,lysis,tail,integrase	Enterobacteria_phage(55.36%)	69	364701:364747	416419:416465
WP_000420935.1|356220_357357_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383951.1|357625_359863_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000662373.1|359849_362822_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224602.1|362822_363713_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177469.1|363895_364657_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
364701:364747	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001201857.1|365170_366124_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_000386784.1|366373_367123_-	DNA-binding transcriptional activator AppY	NA	NA	NA	NA	NA
WP_000239872.1|367982_368651_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_120795384.1|369016_369130_+	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836765.1|369198_369432_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	3.2e-32
WP_000087131.1|369750_370341_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	35.3	4.7e-24
WP_001354832.1|370438_371014_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	7.9e-101
WP_000631346.1|371022_371925_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	63.9	4.0e-99
WP_001561581.1|371921_374948_-|tail	phage tail protein	tail	U5N099	Enterobacteria_phage	82.1	7.2e-68
WP_001233090.1|375012_375612_-	Ail/Lom family protein	NA	A5LH44	Enterobacteria_phage	97.5	8.2e-109
WP_085947772.1|376495_377709_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_000090891.1|380500_381133_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_000140728.1|381069_381813_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.4e-150
WP_001152632.1|381818_382517_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	9.5e-133
WP_000847379.1|382516_382846_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840349.1|382842_385422_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	97.4	0.0e+00
WP_000459457.1|385414_385849_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|385830_386253_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001358372.1|386268_387009_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.0	1.4e-129
WP_000683105.1|387016_387412_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975081.1|387408_387987_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	5.9e-80
WP_000785282.1|387998_388352_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	6.4e-61
WP_000158875.1|388363_388759_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	95.5	1.1e-58
WP_000063250.1|388800_389826_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.9	1.1e-188
WP_001358225.1|389881_390214_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	98.2	2.5e-54
WP_000123248.1|390223_391543_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.6	1.8e-233
WP_073520835.1|391523_393125_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	3.2e-309
WP_000198149.1|393121_393328_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|393324_395250_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|395224_395770_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001307652.1|396159_396354_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.8	9.7e-27
WP_001558756.1|396714_397008_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	89.7	1.3e-43
WP_001228695.1|397098_397281_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001135277.1|397497_397995_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_000839596.1|397994_398210_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737275.1|398799_399882_+	porin OmpD	NA	Q1MVN1	Enterobacteria_phage	76.3	8.9e-154
WP_001204791.1|400070_400454_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_000971068.1|400539_400680_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001099712.1|400676_401039_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000774488.1|401035_401326_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|401318_401489_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|401488_401944_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|401940_402042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|402158_402956_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001306955.1|402965_403517_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000709082.1|403981_405508_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001299444.1|405565_405715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070442.1|405762_406095_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|406162_406465_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788793.1|406461_407163_-	Replication protein 14	NA	M1FJ72	Enterobacteria_phage	97.4	2.7e-127
WP_000147894.1|407159_408179_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_001182903.1|408175_408715_-	toxin YdaT domain-containing protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|408784_409015_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|409119_409809_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|410404_410611_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995433.1|410686_410983_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100841.1|410988_411774_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000611716.1|411770_412451_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.0e-131
WP_000149544.1|412447_412630_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.7	6.9e-27
WP_000548537.1|412602_412794_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.1e-26
WP_000188859.1|412870_413086_+	hypothetical protein	NA	A0A1I9LJM7	Stx_converting_phage	98.6	2.9e-32
WP_000763384.1|413184_413394_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	4.4e-33
WP_073520836.1|413450_413678_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	90.9	6.4e-30
WP_001406354.1|415241_416405_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	4.4e-199
416419:416465	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
>prophage 2
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	664751	675052	5333488	integrase	Enterobacteria_phage(100.0%)	11	661916:661929	676909:676922
661916:661929	attL	AAGAATGGCGGCAG	NA	NA	NA	NA
WP_001016257.1|664751_665498_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000856729.1|667472_667793_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_024243194.1|667928_668384_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|668376_668664_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_073520852.1|668656_669247_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	87.3	1.5e-57
WP_001149160.1|669243_669510_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283023.1|670062_670797_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	5.2e-129
WP_000984202.1|670793_671039_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	98.8	3.9e-41
WP_073520853.1|671053_671626_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.9	3.4e-96
WP_046123073.1|672243_673815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001130500.1|673885_675052_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.0	2.4e-144
676909:676922	attR	AAGAATGGCGGCAG	NA	NA	NA	NA
>prophage 3
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	710321	772513	5333488	transposase,plate,protease,tRNA	Enterobacteria_phage(12.5%)	51	NA	NA
WP_000611742.1|710321_710735_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393850.1|710738_712589_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348793.1|712552_713635_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113725.1|713659_714940_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|714936_715461_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246423.1|715463_716795_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343298.1|716799_717561_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_044687233.1|717569_720347_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	8.1e-82
WP_000088859.1|720343_721087_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240530.1|721091_722504_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_122990699.1|722612_726047_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087745.1|726057_727410_+	ImpA family type VI secretion system protein	NA	NA	NA	NA	NA
WP_001284199.1|727433_727916_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000908052.1|727959_728874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001236649.1|728883_729363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021565401.1|729499_730285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297205.1|730820_731552_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	3.4e-40
WP_000917888.1|731616_732084_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001298887.1|732080_732803_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052750.1|732836_733592_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644685.1|733663_735022_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211726.1|735069_735840_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|735917_736718_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648576.1|736958_737873_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997037.1|737869_738673_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.1	1.6e-38
WP_001140187.1|744418_744994_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|745181_746213_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294600.1|746205_746859_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874224.1|746898_747714_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202329.1|747831_748236_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094005.1|748232_748940_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260716.1|749051_750770_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000399648.1|751849_752830_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000239154.1|753079_753790_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635545.1|753803_754226_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185293.1|754222_754768_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|754933_755134_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|755120_755381_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176577.1|755429_756728_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|756792_757182_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020972.1|757238_759380_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055746.1|759478_760438_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_021565404.1|760450_763933_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	3.7e-209
WP_000569430.1|763969_764566_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_000139659.1|764562_765711_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565966.1|765710_766499_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|766502_766958_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139279.1|767062_768088_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|768091_768577_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|768698_771131_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_073520854.1|771160_772513_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	1131197	1190433	5333488	transposase,protease	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|1131197_1132550_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|1132643_1133195_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|1133350_1134724_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853753.1|1134899_1135898_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
WP_000595986.1|1135930_1136926_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001296689.1|1136912_1137935_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205791.1|1137948_1139451_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.1e-11
WP_000265933.1|1139760_1140717_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055072.1|1141026_1141557_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000239579.1|1141636_1141987_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223208.1|1141980_1142232_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|1142444_1142786_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060921.1|1142788_1146568_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|1146564_1148298_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001295196.1|1148503_1149142_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000399648.1|1149367_1150348_-|transposase	IS110-like element IS621 family transposase	transposase	NA	NA	NA	NA
WP_000935036.1|1150743_1152087_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|1152148_1152355_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175289.1|1152679_1153237_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000886909.1|1153226_1153967_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589416.1|1154156_1156100_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|1156228_1156609_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560563.1|1156697_1157558_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001296686.1|1157665_1158631_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331456.1|1158738_1159401_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|1159445_1160858_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|1161166_1161787_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119478.1|1162005_1162644_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_001371426.1|1162778_1163987_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.8	1.1e-208
WP_001350063.1|1165047_1165842_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|1165912_1166362_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|1166403_1166631_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|1166635_1166950_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|1166956_1167352_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|1167678_1167954_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170840.1|1168082_1168769_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949492.1|1168768_1169623_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|1169632_1170283_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776505.1|1170296_1170761_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218360.1|1170770_1171076_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001300695.1|1171091_1172489_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|1172843_1173908_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|1174015_1174771_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569695.1|1174767_1175517_-	esterase	NA	NA	NA	NA	NA
WP_000254642.1|1175698_1176028_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|1176176_1176452_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001299244.1|1176568_1178194_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943982.1|1178277_1179441_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101653.1|1179443_1180082_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|1180091_1180490_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012553.1|1180507_1181167_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511955.1|1181217_1181916_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220137.1|1181934_1182336_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|1182462_1183194_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076316.1|1183373_1185815_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|1185853_1186279_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|1186485_1187784_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|1187887_1188085_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|1188166_1189171_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|1189173_1190433_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 5
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	1593587	1600727	5333488		Escherichia_phage(83.33%)	6	NA	NA
WP_001278994.1|1593587_1594226_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590385.1|1594222_1595485_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	3.7e-135
WP_000847985.1|1595481_1596390_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1596585_1597353_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141330.1|1597403_1598060_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.7	4.3e-50
WP_021534487.1|1598165_1600727_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	3.0e-30
>prophage 6
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	1638595	1742660	5333488	portal,capsid,protease,holin,terminase,transposase,head,integrase,tail,tRNA	Enterobacteria_phage(39.39%)	104	1693261:1693287	1741601:1741627
WP_073520931.1|1638595_1641226_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1641460_1641646_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1642828_1643395_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287457.1|1643391_1643820_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611804.1|1643892_1645449_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130210.1|1645598_1646114_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1646177_1647716_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001295175.1|1647732_1648905_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1649031_1649562_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119763.1|1649652_1649988_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1649977_1650715_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165699.1|1650838_1652023_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216527.1|1652313_1653306_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774996.1|1653363_1654428_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_001299852.1|1654420_1655623_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
WP_000777968.1|1655977_1656937_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.2e-132
WP_021565383.1|1656946_1659091_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000080944.1|1659063_1659474_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	2.7e-18
WP_001223227.1|1659470_1659716_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_001295174.1|1659963_1660293_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1660444_1660789_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1660825_1661275_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1661942_1662347_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229467.1|1662393_1662918_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000137280.1|1662927_1663227_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1663409_1663568_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_000522424.1|1663651_1664101_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1664101_1664764_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001295173.1|1664784_1666185_-	GABA permease	NA	NA	NA	NA	NA
WP_000097642.1|1666495_1667776_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	4.2e-33
WP_021565382.1|1667789_1669238_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271938.1|1669260_1670529_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_000993087.1|1670548_1671526_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_085947771.1|1677338_1678500_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000927517.1|1678865_1678985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085947772.1|1679489_1680703_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_001367084.1|1681149_1681389_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	49.2	2.5e-08
WP_000655916.1|1681502_1682384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000925811.1|1682651_1682831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044687237.1|1682817_1683564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000963924.1|1683609_1687461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173672928.1|1689422_1691675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113815.1|1691813_1693055_-|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	47.3	4.5e-101
1693261:1693287	attL	TGGTGGAGCTGGCGGGAGTTGAACCCG	NA	NA	NA	NA
WP_061351739.1|1693419_1694592_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	87.6	3.8e-198
WP_001030140.1|1694764_1694911_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	91.7	1.6e-21
WP_000457714.1|1694914_1695157_-	DUF4222 domain-containing protein	NA	Q8W656	Enterobacteria_phage	92.5	3.2e-35
WP_061351741.1|1695188_1695560_-	DUF5406 family protein	NA	Q8W655	Enterobacteria_phage	95.9	3.2e-63
WP_040080126.1|1695839_1696859_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_042973948.1|1697028_1697856_-|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.9	1.1e-130
WP_061352044.1|1698218_1698800_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	94.3	2.5e-110
WP_057698620.1|1699184_1699391_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	55.2	7.1e-12
WP_072301616.1|1699546_1700008_-	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.1	3.3e-41
WP_057697516.1|1700153_1700843_-	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	89.5	8.6e-118
WP_057697517.1|1700976_1701249_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	89.7	1.6e-35
WP_000132761.1|1701370_1701598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186943.1|1701686_1702007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000932280.1|1702082_1702394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061352046.1|1702393_1703101_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	79.1	2.4e-99
WP_001197746.1|1703120_1703297_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	83.9	2.2e-22
WP_000147080.1|1703315_1703624_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	91.2	1.3e-44
WP_072301615.1|1703613_1703943_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	89.7	2.0e-40
WP_157916595.1|1704057_1704348_-	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_171840557.1|1704432_1705299_+	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	62.5	7.0e-85
WP_047089426.1|1705295_1705520_+	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	53.4	1.2e-15
WP_052773596.1|1705651_1706494_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	93.4	2.8e-62
WP_000988199.1|1706504_1707383_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	89.3	3.3e-130
WP_061351023.1|1707379_1708780_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.4	5.4e-252
WP_001064803.1|1708776_1709034_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.9e-34
WP_057780576.1|1709033_1709417_+	antitermination protein	NA	A0A088CD47	Shigella_phage	77.0	1.2e-52
WP_057697525.1|1709597_1710701_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	75.9	1.3e-152
WP_000917767.1|1711211_1711409_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_061352042.1|1711559_1712606_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.9	2.8e-189
WP_032215181.1|1713375_1713765_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_000950579.1|1713754_1714033_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	85.9	7.3e-36
WP_047088412.1|1714034_1714580_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	87.3	5.2e-94
WP_073520934.1|1715026_1715236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061352116.1|1715307_1715490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032084561.1|1715843_1716065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867509.1|1716308_1716857_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	86.3	7.2e-59
WP_061352117.1|1716828_1718745_+|terminase	phage terminase large subunit family protein	terminase	O64317	Escherichia_phage	64.8	3.3e-252
WP_000640654.1|1718748_1718958_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	49.2	1.0e-10
WP_050552957.1|1719002_1720526_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	63.8	6.8e-184
WP_073520935.1|1720515_1722132_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.4	1.0e-100
WP_073520936.1|1722172_1722508_+|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	5.2e-20
WP_000522659.1|1722578_1723607_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
WP_032192457.1|1723657_1724038_+	DNA packaging protein	NA	A0A2R9YJP4	Escherichia_phage	61.1	2.8e-09
WP_040073331.1|1724051_1724426_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	58.9	2.6e-28
WP_061351886.1|1724412_1724991_+|tail	phage tail protein	tail	A0A291AWZ0	Escherichia_phage	87.5	1.6e-88
WP_040073329.1|1724987_1725389_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	82.0	1.2e-58
WP_040073328.1|1725403_1726144_+	Ig domain-containing protein	NA	A0A291AWU6	Escherichia_phage	85.7	1.1e-110
WP_040073327.1|1726204_1726594_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	65.9	3.4e-39
WP_001161001.1|1726602_1726917_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	74.0	4.0e-38
WP_061351885.1|1726900_1729924_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	75.7	0.0e+00
WP_000402323.1|1729923_1730253_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	82.4	4.9e-47
WP_001152670.1|1730262_1730961_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	85.3	2.5e-117
WP_061351884.1|1730965_1731709_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	90.7	5.9e-141
WP_047656448.1|1731606_1732254_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	80.9	1.2e-97
WP_061351883.1|1732314_1735713_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	95.4	0.0e+00
WP_040073323.1|1735774_1736395_+	outer membrane beta-barrel protein Lom	NA	A0A1U8QHD6	Enterobacteria_phage	99.0	1.6e-110
WP_072301589.1|1736459_1738784_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	99.4	1.1e-222
WP_061351882.1|1738783_1739365_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	7.3e-102
WP_073521232.1|1739405_1740830_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	47.3	6.6e-56
WP_061351881.1|1740837_1741401_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	74.7	4.6e-77
WP_000162574.1|1742177_1742660_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1741601:1741627	attR	TGGTGGAGCTGGCGGGAGTTGAACCCG	NA	NA	NA	NA
>prophage 7
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	2280586	2290028	5333488		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569329.1|2280586_2281513_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|2281517_2282249_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216961.1|2282229_2282337_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|2282396_2283128_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|2283349_2285035_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|2285031_2285751_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_073520966.1|2285797_2286268_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|2286308_2286770_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_024262233.1|2286894_2288895_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	97.0	0.0e+00
WP_001292774.1|2288891_2290028_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.1e-162
>prophage 8
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	2382444	2388746	5333488		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001702362.1|2382444_2383839_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	32.6	1.1e-18
WP_000183032.1|2384013_2384907_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_016231042.1|2385278_2386364_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	1.4e-101
WP_001702365.1|2386363_2387263_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	35.2	5.7e-29
WP_001702366.1|2387320_2388199_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	1.7e-107
WP_001702367.1|2388203_2388746_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	60.6	1.2e-53
>prophage 9
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	2835560	2904044	5333488	portal,protease,terminase,holin,lysis,integrase,tail	Enterobacteria_phage(43.14%)	78	2843136:2843151	2873553:2873568
WP_001260849.1|2835560_2836382_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2836481_2836565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743951.1|2836657_2836993_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091849.1|2837389_2838643_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2838749_2839643_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2839777_2840998_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2841122_2841818_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_001315626.1|2841770_2843063_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
2843136:2843151	attL	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000148710.1|2843221_2843836_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526490.1|2843878_2844733_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2844734_2845352_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001342404.1|2845362_2847786_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041556.1|2847846_2850273_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
WP_001295396.1|2850471_2850777_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2850884_2851595_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138584.1|2851597_2852158_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705197.1|2852192_2852534_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2852668_2852995_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2853200_2854415_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836079.1|2854426_2855446_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	25.9	9.7e-17
WP_001531709.1|2855503_2855608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149027138.1|2855633_2856914_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.6	6.6e-156
WP_000005552.1|2856948_2857200_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_073520997.1|2857272_2859744_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083270.1|2859837_2860029_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854560.1|2860025_2860214_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001573395.1|2860613_2860778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2860781_2861000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042960935.1|2861159_2861315_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000233320.1|2861613_2862033_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001072337.1|2862112_2862367_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000693867.1|2862363_2862789_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073520998.1|2862860_2863931_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	65.7	3.8e-64
WP_001534244.1|2863971_2864394_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.0	8.2e-63
WP_073520999.1|2864961_2865843_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_000371964.1|2865820_2866402_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001429093.1|2867097_2867295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2867962_2868118_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_032155008.1|2868285_2868564_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_073521000.1|2868565_2869615_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	56.7	9.7e-113
WP_073521001.1|2869628_2870381_+	antitermination protein	NA	Q8SBE4	Shigella_phage	95.2	4.3e-131
WP_000066484.1|2871056_2871272_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_073521002.1|2872025_2872241_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	93.0	4.2e-31
WP_000189921.1|2872245_2872557_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.6	1.0e-25
WP_001092973.1|2872553_2873087_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	8.4e-97
WP_001071769.1|2873083_2873581_+	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
2873553:2873568	attR	CTTTAAGAGATAAAAA	NA	NA	NA	NA
WP_000066495.1|2873943_2874156_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071524604.1|2874166_2874355_+	cold-shock protein	NA	NA	NA	NA	NA
WP_120795388.1|2874357_2874423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309517.1|2874502_2874658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019139.1|2874829_2875003_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_063120819.1|2875154_2875565_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	89.7	1.2e-63
WP_001031431.1|2875865_2876072_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	91.2	6.7e-26
WP_000373425.1|2876625_2877120_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	100.0	9.9e-84
WP_000934105.1|2877119_2879222_+|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.7	0.0e+00
WP_001072975.1|2879218_2879431_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_077897860.1|2879358_2880939_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	9.0e-288
WP_001360054.1|2880883_2882911_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097046.1|2882997_2883321_+	DUF2190 family protein	NA	A5LH31	Enterobacteria_phage	100.0	8.5e-52
WP_001283147.1|2883313_2883589_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.1e-44
WP_000677102.1|2883600_2884179_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	1.2e-101
WP_073521003.1|2884175_2884577_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	98.5	1.2e-71
WP_000211132.1|2884587_2885331_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	8.1e-130
WP_001341514.1|2885391_2885778_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	97.7	5.2e-64
WP_001161009.1|2885786_2886116_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_063120821.1|2886087_2889153_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
WP_000447253.1|2889152_2889482_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152368.1|2889491_2890190_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_073521004.1|2890195_2890939_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.0	3.0e-145
WP_044061166.1|2890875_2891484_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.5	2.1e-104
WP_073521005.1|2891544_2894958_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.6	0.0e+00
WP_063120824.1|2895027_2895627_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	98.5	1.5e-110
WP_073521235.1|2895691_2898613_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	92.3	4.4e-54
WP_000885584.1|2898612_2899188_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	8.5e-103
WP_000086527.1|2899285_2899876_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2900192_2900426_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|2900494_2900608_-	hypothetical protein	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000527753.1|2902583_2904044_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	4.3e-42
>prophage 10
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	3106597	3167472	5333488	plate,holin,terminase,transposase,tail,integrase,tRNA	Escherichia_phage(75.36%)	75	3148006:3148021	3167824:3167839
WP_000837924.1|3106597_3107731_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001082294.1|3107871_3108306_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.0e-28
WP_061351682.1|3108864_3109818_+	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	27.4	3.4e-24
WP_061330200.1|3109906_3110470_-	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	72.6	1.0e-76
WP_073521022.1|3110477_3111902_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	53.9	1.2e-73
WP_061317084.1|3111925_3112474_-|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	96.7	6.0e-98
WP_061358683.1|3112476_3113970_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	71.5	4.8e-198
WP_001199731.1|3113966_3114593_-	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_072279421.1|3114576_3115803_-|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	99.0	3.4e-226
WP_061322967.1|3115845_3116592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061322964.1|3116924_3117494_+	antA/AntB antirepressor family protein	NA	A0A0U2QL80	Escherichia_phage	86.8	8.1e-90
WP_061322962.1|3117469_3117817_-	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	3.7e-61
WP_061317090.1|3118064_3118778_-	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	98.3	1.1e-128
WP_061317091.1|3118777_3119785_-	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	90.1	1.2e-179
WP_000209262.1|3119784_3120051_-	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_061317092.1|3120047_3120716_-	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	99.1	5.0e-123
WP_061317093.1|3120719_3122693_-	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	99.4	0.0e+00
WP_061317094.1|3122756_3123374_-	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	99.0	8.5e-109
WP_000613368.1|3123370_3123802_-	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_061322955.1|3123825_3125163_-	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.4	2.3e-244
WP_001139505.1|3125162_3126107_-	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_000762302.1|3126093_3126534_-	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_000175376.1|3126530_3126971_-	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000780862.1|3126970_3127441_-	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_001272364.1|3127498_3128527_-	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_061322950.1|3128541_3129159_-	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	97.6	5.5e-116
WP_040092212.1|3129151_3130474_-	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.5	2.3e-188
WP_052512567.1|3130454_3131288_-	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	98.1	3.1e-154
WP_040092210.1|3131232_3132669_-	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	97.3	4.5e-270
WP_040092208.1|3132687_3134016_-|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	97.3	1.5e-259
WP_000089453.1|3134005_3135097_-|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
WP_170815536.1|3135100_3135352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040092207.1|3135287_3136220_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_040092206.1|3136212_3137001_-	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.5	2.5e-49
WP_040092205.1|3137399_3137696_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	3.3e-50
WP_164839673.1|3137870_3138026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305859.1|3138054_3138168_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_040092204.1|3138298_3138580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040092203.1|3138650_3139028_-	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.0	2.5e-63
WP_061317098.1|3139030_3139306_-|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	84.6	2.3e-34
WP_032215181.1|3139295_3139685_-|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.8	7.1e-45
WP_073521023.1|3141051_3141594_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.4e-75
WP_040092199.1|3141590_3141881_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	1.8e-45
WP_040092198.1|3141880_3142480_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.9e-106
WP_040092197.1|3142539_3142713_-	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	73.1	1.1e-16
WP_040092196.1|3143562_3143850_+	hypothetical protein	NA	Q3LZN5	Bacteriophage	50.5	1.5e-15
WP_040092222.1|3143958_3144192_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	87.0	1.0e-30
WP_164475766.1|3144321_3144495_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	71.9	5.8e-15
WP_040092195.1|3144621_3144933_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	1.2e-50
WP_001016257.1|3145154_3145901_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3145915_3147457_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_171000847.1|3147672_3148885_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
3148006:3148021	attL	TGCTGGATAAGCTGCG	NA	NA	NA	NA
WP_072278257.1|3149023_3149314_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	90.4	2.6e-44
WP_077874968.1|3149310_3149565_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	67.9	5.0e-23
WP_061351712.1|3149621_3150407_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	48.6	3.5e-51
WP_157902152.1|3150441_3150984_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	8.3e-84
WP_061322983.1|3150895_3151810_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	90.6	8.2e-100
WP_040092190.1|3152319_3152733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000702035.1|3152752_3153175_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.4e-67
WP_001053423.1|3153158_3153434_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	3.4e-41
WP_000753628.1|3153541_3154003_+	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_001169150.1|3154398_3154551_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	3.5e-08
WP_000560220.1|3154975_3155197_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	100.0	6.2e-38
WP_001349883.1|3155196_3155367_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	91.1	6.7e-24
WP_001594001.1|3155441_3155717_+	phage protein	NA	A0A0U2QW85	Escherichia_phage	96.7	2.3e-42
WP_061351808.1|3155815_3158941_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	95.3	0.0e+00
WP_073521237.1|3158955_3160044_+	recombinase RecT	NA	A0A0U2S5Y9	Escherichia_phage	99.2	7.2e-204
WP_021500490.1|3160107_3160302_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	100.0	9.0e-33
WP_001302840.1|3160294_3160483_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|3160582_3160798_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_072301576.1|3160799_3162035_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	99.0	1.2e-239
WP_001157377.1|3162086_3163022_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	100.0	2.8e-148
WP_000123739.1|3163150_3164524_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387395.1|3165001_3165985_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628065.1|3166239_3167472_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
3167824:3167839	attR	CGCAGCTTATCCAGCA	NA	NA	NA	NA
>prophage 11
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	3525020	3655877	5333488	portal,capsid,plate,protease,terminase,holin,transposase,head,tail,integrase	Escherichia_phage(40.6%)	181	3521486:3521500	3660584:3660598
3521486:3521500	attL	TTAGCGGCTTTTTCA	NA	NA	NA	NA
WP_073521041.1|3525020_3527477_-	exonuclease	NA	V5UQJ3	Shigella_phage	44.4	8.4e-107
WP_024207684.1|3527554_3527758_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_077828395.1|3527754_3528039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187655783.1|3528361_3528997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521238.1|3529159_3529795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521239.1|3529806_3529959_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_000692026.1|3530234_3530537_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	43.3	3.7e-17
WP_061355629.1|3530539_3530899_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	93.3	2.1e-59
WP_000578360.1|3530945_3531338_-	helix-turn-helix domain-containing protein	NA	H6WRX4	Salmonella_phage	39.6	1.7e-14
WP_061355628.1|3531464_3531737_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.4	3.2e-20
WP_073521042.1|3531720_3532146_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_073521043.1|3532166_3533132_+	hypothetical protein	NA	U5P0A0	Shigella_phage	61.1	1.7e-55
WP_061351712.1|3533177_3533963_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	48.6	3.5e-51
WP_077756511.1|3534019_3534274_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	67.9	1.7e-23
WP_054626788.1|3534270_3534567_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.8	2.4e-45
WP_073521044.1|3534759_3535071_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	84.5	1.8e-51
WP_073521240.1|3535472_3535793_+	hypothetical protein	NA	A0A1B0V865	Salmonella_phage	74.2	1.1e-27
WP_057697768.1|3535792_3536356_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	91.0	1.4e-28
WP_057698089.1|3536589_3536802_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	95.7	7.3e-28
WP_073521045.1|3537048_3537255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521046.1|3538200_3538473_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	1.2e-11
WP_073521047.1|3538474_3539533_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	8.3e-88
WP_073521048.1|3539533_3539899_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	3.5e-38
WP_073521049.1|3539895_3540585_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.9	1.0e-57
WP_000917767.1|3540797_3540995_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_073521050.1|3541145_3542192_+	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	92.7	1.8e-191
WP_073521051.1|3542886_3543378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000466935.1|3543575_3544001_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	85.1	2.5e-59
WP_064767393.1|3543997_3544156_+	DUF3927 family protein	NA	A0A0A0YRI9	Escherichia_phage	59.1	5.8e-06
WP_061358522.1|3544190_3544679_-	DUF4145 domain-containing protein	NA	A4JX50	Burkholderia_virus	38.8	2.5e-07
WP_061358523.1|3544871_3545078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521052.1|3545171_3545561_+|holin	holin	holin	Q9MBZ5	Enterobacteria_phage	83.1	2.7e-44
WP_073521053.1|3545550_3545826_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	90.1	1.0e-37
WP_061362016.1|3545828_3546206_+	M15 family metallopeptidase	NA	Q9MBZ3	Enterobacteria_phage	96.8	5.1e-64
WP_040092204.1|3546276_3546558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001305859.1|3546688_3546802_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	89.2	2.5e-11
WP_164839673.1|3546830_3546986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040092205.1|3547160_3547457_+	hypothetical protein	NA	Q8W634	Enterobacteria_phage	96.9	3.3e-50
WP_040092206.1|3547855_3548644_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	41.5	2.5e-49
WP_040092207.1|3548636_3549569_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_170815536.1|3549504_3549756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089453.1|3549759_3550851_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	92.2	9.6e-148
WP_040092208.1|3550840_3552169_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	97.3	1.5e-259
WP_040092210.1|3552187_3553624_+	DUF1073 domain-containing protein	NA	A0A0U2S5X9	Escherichia_phage	97.3	4.5e-270
WP_052512567.1|3553568_3554402_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	98.1	3.1e-154
WP_040092212.1|3554382_3555705_+	DUF2213 domain-containing protein	NA	A0A0U2QW61	Escherichia_phage	95.5	2.3e-188
WP_061322950.1|3555697_3556315_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	97.6	5.5e-116
WP_001272364.1|3556329_3557358_+	hypothetical protein	NA	A0A0U2QQI2	Escherichia_phage	99.1	1.6e-189
WP_000780862.1|3557415_3557886_+	hypothetical protein	NA	A0A0U2SAX6	Escherichia_phage	99.4	4.2e-84
WP_000175376.1|3557885_3558326_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	99.3	1.2e-77
WP_000762302.1|3558322_3558763_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	98.6	2.2e-82
WP_001139505.1|3558749_3559694_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	99.7	1.3e-172
WP_061322955.1|3559693_3561031_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	96.4	2.3e-244
WP_000613368.1|3561054_3561486_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	100.0	3.3e-75
WP_061317094.1|3561482_3562100_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	99.0	8.5e-109
WP_061317093.1|3562163_3564137_+	transglycosylase SLT domain-containing protein	NA	A0A0U2QV45	Escherichia_phage	99.4	0.0e+00
WP_061317092.1|3564140_3564809_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	99.1	5.0e-123
WP_000209262.1|3564805_3565072_+	hypothetical protein	NA	A0A0U2JGJ3	Escherichia_phage	100.0	9.8e-46
WP_061317091.1|3565071_3566079_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	90.1	1.2e-179
WP_061317090.1|3566078_3566792_+	hypothetical protein	NA	A0A0U2JTX5	Escherichia_phage	98.3	1.1e-128
WP_061322962.1|3567039_3567387_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	97.4	3.7e-61
WP_061322964.1|3567362_3567932_-	antA/AntB antirepressor family protein	NA	A0A0U2QL80	Escherichia_phage	86.8	8.1e-90
WP_061322967.1|3568264_3569011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072279421.1|3569053_3570280_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	99.0	3.4e-226
WP_001199731.1|3570263_3570890_+	hypothetical protein	NA	A0A0U2RK03	Escherichia_phage	100.0	2.0e-121
WP_061358683.1|3570886_3572380_+	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	71.5	4.8e-198
WP_061317084.1|3572382_3572931_+|tail	tail fiber assembly protein	tail	Q8W612	Enterobacteria_phage	96.7	6.0e-98
WP_073521054.1|3574244_3575321_-	late control protein	NA	R9TNM7	Vibrio_phage	30.1	2.7e-33
WP_057698229.1|3575311_3575530_-|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	49.3	1.9e-10
WP_057698228.1|3575504_3575993_-|tail	phage tail protein	tail	R9TMP6	Vibrio_phage	43.4	2.5e-23
WP_073521055.1|3575995_3577651_-	hypothetical protein	NA	R9TRP8	Vibrio_phage	36.7	2.2e-50
WP_057698226.1|3577768_3578071_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_057698225.1|3578131_3578650_-|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_073521056.1|3578646_3580122_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	37.8	4.7e-73
WP_073521057.1|3580178_3580706_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	69.9	5.3e-67
WP_073521241.1|3580719_3581946_-|tail	phage tail protein	tail	A0A0U2SAV1	Escherichia_phage	54.7	5.3e-54
WP_063119927.1|3581955_3582537_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.5	1.6e-24
WP_073521058.1|3582529_3583444_-|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	44.2	1.4e-62
WP_057698219.1|3583418_3583775_-	GPW/gp25 family protein	NA	V5YTB2	Pseudomonas_phage	45.5	5.5e-20
WP_073521059.1|3583809_3584433_-|plate	phage baseplate assembly protein V	plate	F1BUP5	Erwinia_phage	31.0	7.5e-12
WP_057698241.1|3584416_3584968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057698217.1|3584979_3585702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061352094.1|3585682_3586084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521060.1|3586086_3586473_-	DNA breaking-rejoining protein	NA	NA	NA	NA	NA
WP_000522659.1|3586523_3587552_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	58.7	5.8e-110
WP_073520936.1|3587622_3587958_-|head	head decoration protein	head	A0A0K2FIF9	Escherichia_phage	49.1	5.2e-20
WP_073520935.1|3587998_3589615_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	53.4	1.0e-100
WP_149027144.1|3589604_3591128_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.2	1.4e-184
WP_057698605.1|3591172_3591382_-	gpW family protein	NA	K7PM10	Enterobacteria_phage	44.4	3.4e-09
WP_073521062.1|3591385_3593302_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	64.2	7.4e-252
WP_073521063.1|3593273_3593783_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.0	8.8e-19
WP_061352123.1|3594365_3594758_-	hypothetical protein	NA	Q8W634	Enterobacteria_phage	91.6	2.5e-45
WP_001373032.1|3594819_3595035_-	hypothetical protein	NA	K7PJU3	Enterobacteria_phage	63.6	2.8e-19
WP_052921098.1|3595075_3595300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_137596387.1|3595462_3595645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000417401.1|3595801_3595984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521064.1|3596055_3596352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063848360.1|3596619_3597267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000989761.1|3597449_3597686_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	57.4	1.8e-14
WP_073521065.1|3597685_3599728_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	49.9	1.7e-174
WP_052922017.1|3599746_3600640_+	AAA family ATPase	NA	A0A2D1GNS0	Pseudomonas_phage	53.9	8.6e-86
WP_042966146.1|3600654_3600879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063101233.1|3600891_3601107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521066.1|3601136_3601781_+	DUF3164 family protein	NA	A4JWM8	Burkholderia_virus	66.4	1.3e-75
WP_000553851.1|3601782_3602016_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000992254.1|3601996_3602188_+	hypothetical protein	NA	A0A2D1GNV5	Pseudomonas_phage	54.4	6.2e-10
WP_000117574.1|3602268_3602655_+	hypothetical protein	NA	U5PRY6	Bacillus_phage	47.9	1.1e-21
WP_000653689.1|3602719_3603265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521067.1|3603541_3604252_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_073521068.1|3604254_3604482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521069.1|3604478_3604709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521070.1|3604698_3604989_+	DUF4752 family protein	NA	A0A088CD82	Shigella_phage	70.2	2.2e-27
WP_077897866.1|3604985_3605294_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	69.7	1.5e-05
WP_000687850.1|3605548_3605827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012904642.1|3605798_3606212_+	regulatory protein GemA	NA	A0A2D1GNN4	Pseudomonas_phage	64.3	3.6e-39
WP_001192995.1|3606307_3606775_+	hypothetical protein	NA	A0A2D1GNW5	Pseudomonas_phage	39.6	2.3e-18
WP_000186337.1|3606801_3607080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001372993.1|3607262_3607655_+|holin	phage holin family protein	holin	Q9MBZ5	Enterobacteria_phage	55.7	1.6e-28
WP_000445983.1|3607644_3607941_+|holin	phage holin family protein	holin	A0A0U2SHD1	Escherichia_phage	50.5	8.1e-17
WP_073521073.1|3607924_3608470_+	glycoside hydrolase family 108 protein	NA	A0A0U2S643	Escherichia_phage	86.2	2.9e-92
WP_073521074.1|3608466_3608649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172955477.1|3608723_3608876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312575.1|3608875_3609376_+	DUF1804 family protein	NA	A0A0M3VI86	Ralstonia_phage	47.8	4.4e-39
WP_073521075.1|3609422_3610163_+	DNA methylase	NA	Q775B4	Bordetella_phage	52.8	4.3e-67
WP_073521076.1|3610164_3611811_+|terminase	phage terminase large subunit	terminase	B7SDN0	Haemophilus_phage	63.7	6.0e-194
WP_073521077.1|3611814_3613410_+	DUF935 domain-containing protein	NA	L7P7P3	Pseudomonas_phage	46.0	4.1e-123
WP_073521078.1|3613396_3614563_+|capsid	minor capsid protein	capsid	Q6QIB9	Burkholderia_phage	45.3	1.6e-60
WP_073521079.1|3614559_3615111_+	phage virion morphogenesis protein	NA	A0A0M3LSP9	Mannheimia_phage	30.1	3.1e-09
WP_073521242.1|3615320_3616436_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	37.7	3.5e-52
WP_000375808.1|3616436_3616832_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	44.5	2.3e-19
WP_000960878.1|3616842_3617751_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A2H4J778	uncultured_Caudovirales_phage	60.3	3.3e-101
WP_073521080.1|3617754_3618084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521081.1|3618087_3618540_+	DUF1320 family protein	NA	A0A1X9SGZ3	Bradyrhizobium_phage	28.1	4.3e-09
WP_077897882.1|3619829_3620483_+	DUF1834 family protein	NA	NA	NA	NA	NA
WP_063848394.1|3620496_3620706_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_073521082.1|3620698_3622120_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B7SDP8	Haemophilus_phage	44.5	5.9e-97
WP_073521083.1|3622132_3622507_+|tail	phage tail protein	tail	F6MIK8	Haemophilus_phage	59.3	8.7e-32
WP_001402716.1|3622503_3622887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178828.1|3622901_3623060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521084.1|3623049_3625332_+|tail	phage tail tape measure protein	tail	A0A0M3LPB6	Mannheimia_phage	32.0	5.6e-81
WP_063848385.1|3625331_3626681_+	DNA circularization N-terminal domain-containing protein	NA	F6MIL2	Haemophilus_phage	26.7	9.1e-39
WP_073521085.1|3626664_3627876_+|tail	phage tail protein	tail	A0A2H4J9E6	uncultured_Caudovirales_phage	37.8	1.2e-69
WP_187655794.1|3627875_3628526_+|plate	phage baseplate assembly protein	plate	F6MIL4	Haemophilus_phage	47.0	6.8e-40
WP_073521087.1|3628579_3628930_+	phage GP46 family protein	NA	A0A2H4JDR8	uncultured_Caudovirales_phage	62.9	8.1e-32
WP_073521088.1|3628929_3630009_+|plate	baseplate J/gp47 family protein	plate	A0A0M3LQN4	Mannheimia_phage	41.5	9.8e-68
WP_073521089.1|3630013_3630586_+	DUF2313 domain-containing protein	NA	A0A2H4J9D6	uncultured_Caudovirales_phage	32.6	2.0e-19
WP_073521090.1|3630585_3631389_+|tail	tail fiber protein	tail	A0A0U2SAV1	Escherichia_phage	83.6	4.6e-30
WP_073521091.1|3631403_3631928_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	69.0	1.8e-67
WP_073521092.1|3631975_3633400_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q8W611	Enterobacteria_phage	54.3	9.9e-60
WP_073521093.1|3633407_3633974_+	DUF4376 domain-containing protein	NA	A0A0U2QQK4	Escherichia_phage	74.3	1.0e-76
WP_001016257.1|3634128_3634875_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3634889_3636431_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_061351725.1|3637032_3637779_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071525566.1|3638118_3638520_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_061351720.1|3638712_3639402_-	antiterminator	NA	I6PDF8	Cronobacter_phage	47.6	1.6e-55
WP_061351719.1|3639398_3639764_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	6.5e-40
WP_061351718.1|3639764_3640823_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.4	5.4e-87
WP_061351724.1|3640824_3641097_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	38.7	7.7e-06
WP_061351717.1|3641278_3641611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061351723.1|3641918_3642152_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	83.1	2.8e-28
WP_171840562.1|3642282_3642456_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	73.7	6.8e-16
WP_061351716.1|3642546_3642903_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.1	2.4e-55
WP_061351715.1|3642904_3643234_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	35.8	8.4e-23
WP_061351714.1|3643230_3643545_-	hypothetical protein	NA	A0A222YY67	Escherichia_phage	88.8	9.1e-51
WP_054626788.1|3643737_3644034_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	93.8	2.4e-45
WP_077875550.1|3644030_3644285_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	66.7	2.5e-22
WP_061351712.1|3644341_3645127_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	48.6	3.5e-51
WP_073521094.1|3645172_3646282_-	DNA-binding protein	NA	V5URT9	Shigella_phage	66.4	1.2e-124
WP_000273724.1|3646360_3646816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061358504.1|3647022_3647448_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391950.1|3647431_3647713_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362152.1|3647813_3648233_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000379570.1|3648497_3648650_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	7.8e-08
WP_073521244.1|3648661_3649297_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	1.3e-06
WP_157902150.1|3649459_3650095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032215066.1|3650530_3650719_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_073521096.1|3650715_3650919_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_073521097.1|3650996_3653504_+	exonuclease	NA	V5UQJ3	Shigella_phage	40.8	1.7e-102
WP_000273158.1|3653570_3653822_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_072095559.1|3653790_3654810_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	2.9e-85
WP_000375136.1|3655217_3655877_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
3660584:3660598	attR	TTAGCGGCTTTTTCA	NA	NA	NA	NA
>prophage 12
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	3781231	3806037	5333488	protease	Escherichia_phage(37.93%)	33	NA	NA
WP_040092195.1|3781231_3781543_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	82.5	1.2e-50
WP_164475766.1|3781669_3781843_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	71.9	5.8e-15
WP_040092222.1|3781972_3782206_+	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	87.0	1.0e-30
WP_040092196.1|3782314_3782602_-	hypothetical protein	NA	Q3LZN5	Bacteriophage	50.5	1.5e-15
WP_040092197.1|3783451_3783625_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	73.1	1.1e-16
WP_040092198.1|3783684_3784284_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	91.5	2.9e-106
WP_040092199.1|3784283_3784574_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	1.8e-45
WP_073521023.1|3784570_3785113_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.9	1.4e-75
WP_061352042.1|3787164_3788211_-	site-specific DNA-methyltransferase	NA	Q8W637	Enterobacteria_phage	91.9	2.8e-189
WP_000917767.1|3788361_3788559_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_057697525.1|3789069_3790173_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	75.9	1.3e-152
WP_057780576.1|3790353_3790737_-	antitermination protein	NA	A0A088CD47	Shigella_phage	77.0	1.2e-52
WP_001064803.1|3790736_3790994_-	hypothetical protein	NA	Q8W639	Enterobacteria_phage	97.5	2.9e-34
WP_061351023.1|3790990_3792391_-	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	95.4	5.4e-252
WP_000988199.1|3792387_3793266_-	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	89.3	3.3e-130
WP_052773596.1|3793276_3794119_-	hypothetical protein	NA	Q8W642	Enterobacteria_phage	93.4	2.8e-62
WP_047089426.1|3794250_3794475_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	53.4	1.2e-15
WP_171840557.1|3794471_3795338_-	Rha family transcriptional regulator	NA	A0A1C9IHV9	Salmonella_phage	62.5	7.0e-85
WP_157916595.1|3795422_3795713_+	SWIM zinc finger family protein	NA	NA	NA	NA	NA
WP_072301615.1|3795827_3796157_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	89.7	2.0e-40
WP_000147080.1|3796146_3796455_+	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	91.2	1.3e-44
WP_001197746.1|3796473_3796650_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	83.9	2.2e-22
WP_061352046.1|3796669_3797377_-	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	79.1	2.4e-99
WP_000932280.1|3797376_3797688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000186943.1|3797763_3798084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132761.1|3798172_3798400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057697517.1|3798521_3798794_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPK9	Escherichia_phage	89.7	1.6e-35
WP_057697516.1|3798927_3799617_+	LexA family transcriptional regulator	NA	A0A1B5FPF4	Escherichia_phage	89.5	8.6e-118
WP_072301616.1|3799762_3800224_+	helix-turn-helix transcriptional regulator	NA	A0A1B5FPB8	Escherichia_phage	71.1	3.3e-41
WP_057698620.1|3800379_3800586_+	hypothetical protein	NA	Q8W651	Enterobacteria_phage	55.2	7.1e-12
WP_061352044.1|3800970_3801552_+	hypothetical protein	NA	Q8W653	Enterobacteria_phage	94.3	2.5e-110
WP_042973948.1|3801914_3802742_+|protease	serine protease	protease	Q8W654	Enterobacteria_phage	98.9	1.1e-130
WP_061352008.1|3804003_3806037_-	M13 family metallopeptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	30.5	2.8e-84
>prophage 13
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	4649593	4657348	5333488	transposase	Enterobacteria_phage(87.5%)	10	NA	NA
WP_001298859.1|4649593_4651135_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4651149_4651896_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_073521160.1|4651949_4652108_-	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	65.7	4.9e-05
WP_003827212.1|4652124_4652370_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	8.2e-31
WP_060682977.1|4652366_4653104_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	63.9	2.6e-80
WP_003827209.1|4653644_4653911_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_024228213.1|4653907_4654459_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.2	7.0e-30
WP_003827205.1|4654455_4654683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021563885.1|4654679_4655000_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_060682979.1|4655014_4657348_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.0	0.0e+00
>prophage 14
NZ_CP010122	Escherichia coli strain C5 chromosome, complete genome	5333488	5209067	5276966	5333488	transposase,plate	Escherichia_phage(22.22%)	49	NA	NA
WP_000255946.1|5209067_5210090_-|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.4	4.6e-200
WP_061358626.1|5210397_5211135_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_061358629.1|5212317_5213922_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_073521176.1|5215514_5216081_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_170998614.1|5216201_5216351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077897873.1|5216365_5216926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521255.1|5216994_5217222_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_137596247.1|5218549_5219347_+	IS21-like element IS21 family helper ATPase IstB	NA	U5N3V8	Enterobacteria_phage	98.9	4.7e-144
WP_073521180.1|5219547_5219940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106421269.1|5221286_5221709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521183.1|5221767_5222379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521184.1|5222484_5223294_+	DsbA family protein	NA	NA	NA	NA	NA
WP_073521185.1|5223345_5224605_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	42.7	6.0e-93
WP_073521186.1|5224588_5225023_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	42.7	9.1e-17
WP_073521187.1|5225200_5225806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521188.1|5226958_5227384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521189.1|5228037_5229516_-	anion permease	NA	NA	NA	NA	NA
WP_073521190.1|5229563_5231216_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_077897888.1|5234008_5235016_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_073521195.1|5236178_5240138_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	35.7	1.3e-112
WP_172901787.1|5240554_5241355_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_073521197.1|5241989_5242244_+	molecular chaperone DnaJ	NA	NA	NA	NA	NA
WP_171000847.1|5242283_5243497_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_123001163.1|5244375_5244630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021580263.1|5245190_5245802_-	YfdX family protein	NA	NA	NA	NA	NA
WP_073521199.1|5247609_5248116_-	ProQ/FinO family protein	NA	Q2A0A1	Sodalis_phage	39.7	4.1e-08
WP_157908426.1|5248235_5248379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521200.1|5248990_5249614_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_057698032.1|5249709_5249943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057697586.1|5249995_5250187_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_073521201.1|5250697_5251195_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_057697584.1|5251216_5252761_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_073521202.1|5252776_5254114_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_073521203.1|5254110_5254764_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_077897875.1|5254766_5256497_+	OmpA family protein	NA	NA	NA	NA	NA
WP_001007315.1|5256502_5256994_+	type VI secretion system effector Hcp	NA	NA	NA	NA	NA
WP_073521204.1|5257162_5259820_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	32.8	3.0e-94
WP_001559822.1|5259816_5260383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521205.1|5260905_5263437_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_073521206.1|5263439_5265461_+	lipase family protein	NA	G9E505	Ostreococcus_lucimarinus_virus	33.3	5.1e-09
WP_061352067.1|5265453_5266278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033802316.1|5266644_5266911_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_073521207.1|5266913_5268053_+	type VI secretion protein	NA	NA	NA	NA	NA
WP_073521208.1|5268045_5271435_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_057698468.1|5271434_5273033_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_032252203.1|5273166_5274930_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_073521209.1|5274884_5275985_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_073521210.1|5275965_5276502_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_073521211.1|5276504_5276966_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 1
NZ_CP010123	Escherichia coli strain C5 plasmid A, complete sequence	214445	148302	208767	214445	transposase,integrase	Stx2-converting_phage(30.0%)	43	173027:173041	196266:196280
WP_073521323.1|148302_149841_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	98.8	6.7e-296
WP_073521324.1|151832_154157_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_073521325.1|154357_155515_+	amidohydrolase	NA	NA	NA	NA	NA
WP_073521326.1|155663_157076_+	MFS transporter	NA	NA	NA	NA	NA
WP_157913999.1|157624_157777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187655799.1|157931_160844_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_057697845.1|160879_161443_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_073521328.1|161709_161943_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_077897894.1|162011_162572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_073521330.1|162830_163397_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_061323313.1|166763_168356_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_024207583.1|171132_171342_-	KTSC domain-containing protein	NA	A0A0K1LMB5	Caulobacter_phage	49.3	5.2e-10
WP_061323311.1|171344_173177_-	ATP-binding protein	NA	NA	NA	NA	NA
173027:173041	attL	TTCTGACAAAACTGC	NA	NA	NA	NA
WP_061323308.1|173166_174429_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_061323306.1|174783_175854_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_106422978.1|176213_177251_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_073521332.1|178866_179421_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_024207779.1|179689_180253_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_073521334.1|182636_182984_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	95.7	5.3e-60
WP_024207780.1|182980_183361_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	87.3	5.1e-56
WP_073521338.1|184592_185477_+	50S ribosome-binding GTPase	NA	NA	NA	NA	NA
WP_073521339.1|185597_186275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521340.1|186532_187351_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	4.2e-47
WP_073521341.1|187442_187928_+	antirestriction protein	NA	NA	NA	NA	NA
WP_073521342.1|187943_188420_+	RadC family protein	NA	NA	NA	NA	NA
WP_063073973.1|188476_188698_+	DUF987 domain-containing protein	NA	A0A1U8V471	Klebsiella_phage	45.8	1.1e-10
WP_073521343.1|188772_189141_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_073521344.1|189230_189608_+	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_073521345.1|189604_190093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073521346.1|190104_190302_+	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_073521347.1|190386_191232_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000208385.1|191300_191696_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_057697651.1|191688_192636_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_001218789.1|193039_194305_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	43.7	3.8e-87
WP_069904771.1|194623_196123_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_073521348.1|196274_196982_-	porin family protein	NA	NA	NA	NA	NA
196266:196280	attR	GCAGTTTTGTCAGAA	NA	NA	NA	NA
WP_171000847.1|197030_198244_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	6.0e-167
WP_028132772.1|198504_198735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028132771.1|199899_200865_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_028132770.1|201383_202706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028132769.1|202801_206083_-	DEAD/DEAH box helicase family protein	NA	U6E9C9	Streptococcus_phage	24.4	1.1e-08
WP_028132767.1|207956_208187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028132766.1|208308_208767_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	33.1	2.2e-13
